ID: 1179072183

View in Genome Browser
Species Human (GRCh38)
Location 21:38082012-38082034
Sequence GGCTGTTCCCTATTTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179072183 Original CRISPR GGCTGTTCCCTATTTTCAGG AGG Intronic
900593729 1:3471175-3471197 TGCTGCTCCCTATATGCAGGAGG + Intronic
902072825 1:13755379-13755401 TGCTGTGCCCTATTTTTAGGTGG + Intronic
903741833 1:25562867-25562889 GGCTGTTCCCATTTTTCAGATGG - Intronic
903816311 1:26066889-26066911 GGCTGTTCCCTATGATATGGGGG - Intronic
908654842 1:66377356-66377378 GTCTGGTTCCTATTTTCAAGTGG - Intergenic
912333085 1:108836942-108836964 TGCTATTCTTTATTTTCAGGTGG + Intronic
917743403 1:177983771-177983793 GGCTGTTAAATATTTTGAGGAGG - Intronic
918455527 1:184708698-184708720 GGTTGTTCACTATTTCAAGGAGG - Intronic
919557892 1:199083776-199083798 TGCTGTTGCCTATTTTCAGCTGG + Intergenic
1069834146 10:71298004-71298026 GGCTGTTGCATATCTTCTGGCGG - Exonic
1072323185 10:94271095-94271117 GGATGGTCCCTATTTTCAGCTGG + Intronic
1073711195 10:106044548-106044570 GGCAGTAGCCTAATTTCAGGGGG + Intergenic
1075262539 10:120975755-120975777 GGAGGTTGCCTATTTTTAGGAGG - Intergenic
1075390002 10:122085051-122085073 GTCTCTTTCCCATTTTCAGGTGG - Exonic
1077151178 11:1073802-1073824 GGCCCCTCTCTATTTTCAGGAGG + Intergenic
1078616694 11:12872409-12872431 GGCATTTCCCAATCTTCAGGGGG + Intronic
1084107182 11:66987696-66987718 GTCTGTTGTCTATGTTCAGGAGG - Intergenic
1084638313 11:70408333-70408355 GGCTGTGCCTTCTTTTCTGGAGG - Intronic
1086467814 11:87073520-87073542 TGCTGTACTCTCTTTTCAGGTGG - Intronic
1091345880 11:134853680-134853702 GTCTGTTTCCTCTCTTCAGGTGG - Intergenic
1091414559 12:270087-270109 GGCTCTTATCTATATTCAGGGGG - Intergenic
1094562406 12:31567846-31567868 GGCTCTTTTCTATTTTTAGGGGG + Intronic
1098539399 12:71636950-71636972 GGCTGTTCTGGATCTTCAGGTGG + Exonic
1100079992 12:90837479-90837501 GGCTCTTCCTTCTTTTCACGTGG + Intergenic
1106189165 13:27435890-27435912 GGCTGTTTCCCTTTTTTAGGAGG - Exonic
1107540363 13:41383930-41383952 GGATGTTCCTTCTTTTTAGGGGG + Intergenic
1109705650 13:66088445-66088467 GGGTCTTCTCTATTTTCAGCTGG - Intergenic
1115055369 14:29119983-29120005 GGCGCTTCCCAATTTTCAGTGGG - Intergenic
1116069875 14:40030407-40030429 GTCTGTTTCCCATTTTTAGGGGG - Intergenic
1120098568 14:80418199-80418221 TGCTTTCCCGTATTTTCAGGAGG - Intergenic
1120999735 14:90443027-90443049 TGCTGTTCCCTTTTGCCAGGTGG + Intergenic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1129427299 15:75473025-75473047 ATCTGTTCCCTATTTCCAGAGGG - Intronic
1134266081 16:12693848-12693870 TGCTGTTCCCCATGTTCTGGGGG + Intronic
1138438109 16:57017773-57017795 GGCTGTGCCCAATTTCAAGGAGG + Intronic
1141212589 16:81995070-81995092 CGCTCTTCCCTTTTTGCAGGTGG + Exonic
1148763513 17:50022023-50022045 GTCTGATCCCTTTCTTCAGGTGG + Intergenic
1150007708 17:61479886-61479908 GGTTGTTCTCAATTTTCAGCTGG - Exonic
1151951260 17:77355499-77355521 GGCTGTTCCCTTGTGTCACGTGG + Intronic
1152125295 17:78443114-78443136 GGCTGTTTCCTTCTTTTAGGTGG + Intronic
1152651575 17:81496452-81496474 GGCTTTTCCTAATTTTCAAGGGG - Intergenic
1155209943 18:23591976-23591998 AGCTGTTCCCTGTGTTCAGCTGG - Intergenic
1159695213 18:71548624-71548646 GGCTGTTCCTGATTTGCAGATGG - Intergenic
1163035865 19:14568452-14568474 GGCTGTTCCCTATCTGCACTTGG + Intronic
1164041137 19:21493681-21493703 GCCTGTCCCCTGCTTTCAGGAGG + Intergenic
1164172571 19:22738233-22738255 ACCTGTGCCCTACTTTCAGGAGG - Intergenic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164282629 19:23782205-23782227 GCCTGTTCCCTAATCACAGGGGG + Intronic
1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG + Intronic
1165372155 19:35415344-35415366 GGCTGGTCCCTCTCTTCTGGGGG + Intergenic
1168095042 19:54109766-54109788 TGCTGTTCCCTCCCTTCAGGGGG + Intronic
1168554665 19:57327861-57327883 GGCCTATCCCTATTTTCAAGTGG - Exonic
931702341 2:64919139-64919161 TGCTGTTTCCTATTTCTAGGGGG - Intergenic
938058502 2:128234164-128234186 GGCAGTTCCCTTTGGTCAGGCGG + Intergenic
941398234 2:164997462-164997484 GGCTGTTGCCTATTTTGATTGGG + Intergenic
942393737 2:175524345-175524367 GGGTGTTCCGTATTTGCAGCTGG - Intergenic
947702795 2:232249220-232249242 GCCTGTGCTCTATTTACAGGTGG + Exonic
948322251 2:237080027-237080049 GGCTTTTCTCTATGATCAGGAGG - Intergenic
1172089083 20:32414830-32414852 GGCTGGTCACTTTTTCCAGGAGG + Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176964734 21:15199405-15199427 GGCTGTTTCATATTTTCATCAGG - Intergenic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
954993177 3:54858594-54858616 CTCTGTTTCCTATTTTAAGGAGG - Intronic
957343902 3:78938137-78938159 GGTGGTTCCCCATTCTCAGGAGG + Intronic
960667160 3:120120670-120120692 CACTGTTCACTAATTTCAGGCGG + Intergenic
961176030 3:124835634-124835656 GGCGGGTCCCTCTCTTCAGGTGG + Intronic
961828840 3:129612920-129612942 GGCTGTTCCCTGTTCTCCAGGGG + Intergenic
966057293 3:175709985-175710007 GTCTTTTCCCTATTTTCTGTGGG - Intronic
970032124 4:11687772-11687794 GCCTGTTCCCCATTTTTAAGTGG - Intergenic
970187927 4:13483117-13483139 GGCTCTTCACTATTTGCTGGTGG + Intronic
971239357 4:24873679-24873701 ACCTGTTTCCTTTTTTCAGGAGG + Exonic
972694596 4:41433471-41433493 GGCTGGTCCCTGTGTTCAGTTGG + Intronic
974300374 4:60058475-60058497 AGCAGTTCTCTTTTTTCAGGTGG - Intergenic
985975214 5:3414484-3414506 GGCTAGTCCCTGTTTTCATGGGG - Intergenic
986063396 5:4212658-4212680 GGCTGCTTCCTATTTGCAGACGG + Intergenic
987456066 5:18148319-18148341 CCCTGATCCCAATTTTCAGGGGG + Intergenic
990697293 5:58434382-58434404 GGCTATTCCCTGTTTCCAGATGG - Intergenic
990820027 5:59828476-59828498 GGCAGACCCTTATTTTCAGGAGG + Intronic
990857402 5:60284701-60284723 AGCTGTTCTCTATTTTAAAGTGG - Intronic
991915587 5:71601634-71601656 TGCCGTTCTCTATTTTCAGCAGG + Intronic
997801790 5:136870628-136870650 GGCTTTTACCTATTTCAAGGTGG + Intergenic
998042324 5:138959566-138959588 GGCTGCTCCCAACTTTCAGAAGG - Intronic
999616586 5:153431499-153431521 TTCTGTTTCTTATTTTCAGGGGG + Intergenic
1002202630 5:177538824-177538846 GGCTGTTCCCTGTCCTCAGGTGG - Intronic
1004316776 6:14595537-14595559 GGCTGTTCCCTTATTTGCGGTGG + Intergenic
1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG + Intronic
1009198734 6:60718994-60719016 GGCTTCTCCCATTTTTCAGGGGG + Intergenic
1013488701 6:110622834-110622856 GCAGGATCCCTATTTTCAGGAGG - Exonic
1015780310 6:136858595-136858617 GGCTGTTCACTAGATTCAGCTGG - Intronic
1017206331 6:151807824-151807846 GGCTGTGCTCTTTTTCCAGGTGG + Exonic
1017412720 6:154186458-154186480 GGCTGCTGCCTGTGTTCAGGTGG - Intronic
1032497822 7:132376050-132376072 GGCTGTTCCAAATTTGCAGATGG - Intronic
1035421319 7:158731097-158731119 CGCTGTTCTCTATTTGCAGTGGG + Exonic
1037721581 8:21449081-21449103 GGCTGAAGCATATTTTCAGGCGG - Intergenic
1042081788 8:65061683-65061705 GGCTTCTCCTTATTTTTAGGGGG - Intergenic
1042733038 8:71957954-71957976 AGCTGTTCCCTTTTCTCCGGAGG + Intronic
1043413727 8:80027985-80028007 GGCTGTTCAGTTTTTCCAGGAGG - Intronic
1044231009 8:89777744-89777766 GACTGTTTCCTATTTTCAGTGGG + Intronic
1046382842 8:113473310-113473332 AGCTGTTCCCATTTTTCTGGAGG + Intergenic
1047351854 8:124081627-124081649 GGCAGGTCCCTATTCTCAAGGGG + Intronic
1049751941 8:144289046-144289068 GGCTGTCCCCCATGTGCAGGTGG - Intronic
1050018437 9:1260018-1260040 GGGTGTTCTCTTTTTTTAGGTGG - Intergenic
1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG + Intergenic
1058545963 9:106060275-106060297 GCCTGTTCCCTAGCTTCCGGTGG + Intergenic
1060749803 9:126161823-126161845 GGCACTTCCCAATCTTCAGGGGG + Intergenic
1061263208 9:129491252-129491274 GTCTGTTCCCTCTCTTCAGAGGG + Intergenic
1203786590 EBV:131701-131723 GCCTGTTCCCTATTTTTGGAAGG - Intergenic
1193382797 X:80835479-80835501 GGCTGATCATTATTTTAAGGAGG - Intergenic
1193993983 X:88342871-88342893 AGCTGTTTCCCATTATCAGGAGG + Intergenic
1194523833 X:94951339-94951361 AGCTGTTTCCTATTATCAGGAGG + Intergenic
1196061106 X:111409276-111409298 GGATTTTCCCTATTTTGAGGTGG + Intronic
1196742789 X:119040134-119040156 CACTCTTCCCTATTATCAGGAGG + Intergenic
1198078312 X:133215008-133215030 GGCTGGTCCCTGTTTTTTGGGGG - Intergenic
1199522633 X:148753458-148753480 AGCTGTCCCATATTATCAGGAGG - Intronic
1199810902 X:151347414-151347436 GGCTGTGAGCTCTTTTCAGGAGG + Intergenic
1199948936 X:152690055-152690077 GGCTGTGCCCTACTTCCAGTGGG + Intergenic
1199960740 X:152778394-152778416 GGCTGTGCCCTACTTCCAGTGGG - Intergenic
1199988611 X:152970649-152970671 GGCTCTTCCTTATGTTCAGGGGG + Intronic
1200702362 Y:6413028-6413050 GGCTGTTTGCAATTTGCAGGAGG - Intergenic
1200865113 Y:8035132-8035154 GCCTTTTCCCTGTTCTCAGGTGG + Intergenic
1201031749 Y:9751670-9751692 GGCTGTTTGCAATTTGCAGGAGG + Intergenic
1202073516 Y:21016395-21016417 GGCTGTTCCTTGTTTGAAGGTGG + Intergenic
1202078216 Y:21058249-21058271 GGCTGTTCCTTGTTTGAAGGTGG + Intergenic