ID: 1179072524

View in Genome Browser
Species Human (GRCh38)
Location 21:38084950-38084972
Sequence TGGGCCCTTCTCAGGGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179072524 Original CRISPR TGGGCCCTTCTCAGGGCATC AGG Intronic
900323744 1:2097336-2097358 TGGGCCCCTCTCAGGGTCTTTGG + Intronic
900332952 1:2145345-2145367 GGGGCCATTCTAAGGGCCTCTGG - Intronic
900436382 1:2633164-2633186 GGTGCCCTTCTCAGGGCCTCTGG + Intergenic
900436531 1:2633746-2633768 TGGGCATGTGTCAGGGCATCTGG + Intergenic
900776108 1:4586580-4586602 TGTGCCCTTCTGAGGACCTCTGG - Intergenic
901068441 1:6505747-6505769 TGGGCCCTGCACTGGGCTTCAGG - Intronic
904801980 1:33099455-33099477 TGGTCCCTTCTCAGTGCAGTAGG - Intronic
905866102 1:41377592-41377614 TGGGCCCAGCTCTGGGCACCTGG + Intronic
906521113 1:46467458-46467480 TGGGGCCTTCTCAGGGTAGGTGG + Intergenic
907305257 1:53509587-53509609 TGGCCTCTCCTCAGGGCAGCGGG + Intronic
907940666 1:59084216-59084238 TGGGCCTTGCTCAGAGCAACAGG - Intergenic
908028073 1:59971823-59971845 TGAGCCCTGCTCAGGGACTCAGG + Intergenic
909719936 1:78755500-78755522 TGGGCCCTTCCCATGGCATGTGG - Intergenic
910559994 1:88579762-88579784 TGCTCCCTTCCCAGGGCAACTGG + Intergenic
910968308 1:92830037-92830059 TGTGTTCTTCTCAGTGCATCAGG + Intergenic
911062294 1:93758895-93758917 TGAACCTTTCTCAGGCCATCAGG + Intronic
912549967 1:110479209-110479231 TGGCCACTTCCCAGGGCATGAGG + Intergenic
915610486 1:156988092-156988114 AGGGCACTTCCCCGGGCATCAGG - Intronic
917256390 1:173120897-173120919 TGGGCCCTACTCATGGCCCCAGG - Intergenic
919129381 1:193434064-193434086 TGGGTCCCTCTCAGGACACCTGG + Intergenic
922414718 1:225410578-225410600 TGTGTCCTTCTCAGTGCATTGGG - Intronic
923037450 1:230294175-230294197 TGGGCATTGCTCAGGCCATCTGG - Intergenic
1062938674 10:1406265-1406287 TGGGCCCTCCCCAGGGGCTCAGG + Intronic
1064241957 10:13638724-13638746 ATGGCCCTTCTCAGTGCATACGG - Intronic
1064509199 10:16071360-16071382 AGGGCCCTTCTCAAAGAATCAGG - Intergenic
1064976177 10:21118318-21118340 TTGCCCCTTCTCAGGGAAGCAGG - Intronic
1069626085 10:69868450-69868472 TGGGCTCTTCTCAGGTTCTCTGG - Intronic
1071430336 10:85601935-85601957 TGGGCCTTTCTGAGGGCAGGAGG - Exonic
1074235115 10:111577122-111577144 AGGCACCTTCACAGGGCATCAGG + Intergenic
1075675557 10:124293500-124293522 GGCTCCCTGCTCAGGGCATCCGG + Intergenic
1077348068 11:2073540-2073562 TGGGCCATACTCTGGGCAACAGG - Intergenic
1077529372 11:3088012-3088034 TGGGCCCCTCTCAGGGGCACTGG - Exonic
1078946243 11:16071389-16071411 TGGGCACTTCCCAGGACATCAGG - Intronic
1079209810 11:18450734-18450756 TGGGTCCTTCTAAAGGCCTCTGG + Intronic
1081722744 11:45302144-45302166 GGGGCCCATCTCAGGGCAAAGGG + Intergenic
1085238408 11:75032569-75032591 TGGCCCCTTCCCAGGGCACAAGG + Intergenic
1087214242 11:95478295-95478317 TGGCCCCTGCCCAGGGCATCAGG - Intergenic
1088861280 11:113802042-113802064 AGGGCCCTTCCCAGGGATTCTGG + Intronic
1089216071 11:116835465-116835487 TGAGCCCCTTTCAGGGCACCTGG + Intergenic
1089650492 11:119909778-119909800 AGGGCCCTTCCAAGGGCACCAGG - Intergenic
1091545272 12:1497527-1497549 TGGGCCCTTTCCAGGACACCTGG - Intergenic
1091971723 12:4793094-4793116 TGTGCCCTGCACAGGGCAGCTGG - Intronic
1096370853 12:51067809-51067831 CGGGCCCTGCTGAGGGCTTCTGG - Exonic
1096737004 12:53663499-53663521 TGAGGCCTTCCAAGGGCATCAGG - Intronic
1101241866 12:102847043-102847065 TGGGCTGTTCTGAAGGCATCTGG - Intronic
1101475351 12:105041402-105041424 TGAGCTTTTCTCAGGACATCAGG + Intronic
1101732484 12:107438084-107438106 TGGGCCCCGCTCAGGGTCTCTGG - Intronic
1104714090 12:131005234-131005256 TGGGCCCTTCCCTTGGCTTCTGG - Intronic
1104756166 12:131270598-131270620 TGGTCACTTCCCAGGTCATCAGG - Intergenic
1104777611 12:131400427-131400449 TGGTCCCTTCCCAGGTCATCAGG + Intergenic
1104914538 12:132257927-132257949 TGGACCCTCCTCAGGGAATGCGG - Intronic
1105986316 13:25570901-25570923 TGGCCCCTTCTCAGGACACCTGG + Intronic
1106349908 13:28920653-28920675 TTGGACCCACTCAGGGCATCAGG - Intronic
1108392238 13:49957787-49957809 TTGTATCTTCTCAGGGCATCTGG + Intergenic
1111411279 13:87880349-87880371 TGGGTCCTTCCCAAGACATCTGG + Intergenic
1112024223 13:95397659-95397681 TGGGCCTTTGTCAGGGAATATGG - Intergenic
1112157470 13:96833276-96833298 TGAGCCATTCTGAGGACATCTGG + Exonic
1113806565 13:113113560-113113582 TGGCCCCTCCCCAGGACATCTGG - Intronic
1113871176 13:113560792-113560814 TGGGCCCTTCTCTTGCCCTCCGG - Intergenic
1114740952 14:25096487-25096509 AGGGCCCAGCTCTGGGCATCTGG + Intergenic
1114917941 14:27290168-27290190 TGGGTCCTTCCCATGACATCTGG + Intergenic
1118348983 14:64960169-64960191 AGGGCCCTCCTCTGGGCACCGGG + Intronic
1120401701 14:84040769-84040791 TGTCCCCTTCTCTGGGAATCAGG - Intergenic
1121093962 14:91202839-91202861 TGGGCCCTTCTCACGGCCTCAGG + Intronic
1122166567 14:99829251-99829273 AGGGCCCCTCTCAGTGCCTCTGG + Intronic
1123035440 14:105469994-105470016 TGGGGCCTTCCCAGGGCAGGCGG + Intronic
1126446958 15:48758064-48758086 TGGGCCCTGGCCTGGGCATCAGG - Intronic
1128244396 15:66123337-66123359 TAGCCCCATATCAGGGCATCTGG - Intronic
1128544064 15:68555590-68555612 TGGGCCCCTCTCCCAGCATCTGG - Intergenic
1129519261 15:76175812-76175834 TGTCCCCTTCTCTGGGCTTCAGG - Intronic
1129707652 15:77803954-77803976 TGGGCCCTTCTTAAGGCAGCAGG + Intronic
1129876333 15:78978015-78978037 GAGGCCACTCTCAGGGCATCTGG + Intronic
1131368603 15:91861061-91861083 TGGGCCTTTCTCAGTGAATCAGG + Intronic
1131478721 15:92763778-92763800 AGGGCCCCTCTCAAAGCATCAGG + Intronic
1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG + Intronic
1132460428 16:51048-51070 TGGGCCCCTCCCAGGACACCTGG + Intronic
1132684056 16:1154875-1154897 AAGGCCCTTCTCAGGGCACGCGG - Intronic
1134222079 16:12362723-12362745 TGTGACCTTGTCAGGGCTTCAGG - Intronic
1138215623 16:55202591-55202613 TGGGTCCTTCCTAGAGCATCAGG - Intergenic
1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG + Intronic
1138387942 16:56648899-56648921 TGGGGCCTTCCCTGGGAATCAGG + Intronic
1138936686 16:61734949-61734971 TGGAGGCTTCTCAGGGCATGTGG - Intronic
1138962521 16:62044698-62044720 TGGGTCCCTCTCAGGACATGTGG - Intergenic
1139519044 16:67469496-67469518 TGGACCCTTCTCATGTCAGCTGG - Intronic
1140857428 16:78990338-78990360 AGGGCCCTTCTCAAGGCACAAGG - Intronic
1140974058 16:80042358-80042380 GGGGCCCTTATCAGGTCACCTGG - Intergenic
1142033790 16:87851652-87851674 TGTGTCCTTCACAGGGCATGAGG - Intronic
1142189147 16:88709628-88709650 TGGGCCCTTCTGAGCGCCTGTGG + Intronic
1143923940 17:10352713-10352735 TGGGCCTTTCTCAGTGGATGGGG + Intronic
1145119845 17:20248242-20248264 AGGCCCCTTCTCAGAGGATCTGG - Intronic
1147651156 17:42062729-42062751 TGGGCCCCTCTGAGGGGCTCTGG - Intronic
1147793924 17:43029442-43029464 TGGGCAATTCTCAGGCCATTAGG + Intergenic
1148091757 17:45026622-45026644 TGGTCCCTTCTTAGGGATTCTGG + Intronic
1148104538 17:45112370-45112392 TGGGGCCATCTCAGGGCCCCAGG + Exonic
1148109422 17:45136380-45136402 TGGGTCCCACCCAGGGCATCTGG - Intronic
1148789320 17:50164519-50164541 CGCCCCCTTCTCAGGGCACCTGG + Intronic
1149478941 17:56986080-56986102 TGGGCCCCACTCAGGGCTTGTGG + Intronic
1151516818 17:74601777-74601799 TGGGCACTGCCCAGGGCTTCCGG - Intergenic
1152205353 17:78971746-78971768 AGAGCCCTTCGCAGAGCATCAGG + Exonic
1152209580 17:78995975-78995997 TGGGCTGTACTCAGGTCATCCGG - Intronic
1152502657 17:80723084-80723106 TGGGTTATTCTCAGTGCATCAGG + Intronic
1154502787 18:15004891-15004913 TGGGCCCAGCTCAGGGCCACCGG + Intergenic
1157769627 18:50334462-50334484 TGGGCCCTCCAAAGGCCATCAGG - Intergenic
1158337195 18:56426024-56426046 TGGGTGCTTCCCAGGACATCAGG - Intergenic
1160501437 18:79403050-79403072 CAGCCCCTTCTCAGGGGATCCGG - Intronic
1160511835 18:79457265-79457287 TGAGCCATCCTCAGGGCATGAGG - Intronic
1160854809 19:1211987-1212009 TGTGCCCCTCTCTGGGCAGCGGG + Intronic
1160879320 19:1312431-1312453 TGGGGCCTTCCCAGGGCCCCTGG + Intergenic
1161095569 19:2388514-2388536 TGGGCCCTTCTGGGGGCTCCAGG - Intergenic
1161144907 19:2671642-2671664 TGGCCCATTCAAAGGGCATCAGG + Intronic
1161684284 19:5695408-5695430 TGGGGACCCCTCAGGGCATCAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163186235 19:15641362-15641384 TGGGCCCTTCCCTGGGCCTCAGG + Intronic
1163218475 19:15897643-15897665 TGGGCCGTTCTCTGGGCCTCAGG - Intronic
1163222853 19:15934440-15934462 TGGGCCCTTCCCTGGGCCTCAGG - Exonic
1163637754 19:18445339-18445361 TGCCCCCTTCTCAGAGCACCTGG - Intronic
1164204663 19:23048147-23048169 TGGGCCCTGCTAAGGGAATTAGG + Intergenic
1165352357 19:35282685-35282707 TGGGTCCTTAGCAGGGCAGCAGG + Intronic
1165485144 19:36090843-36090865 GGGGACCTTCTCAGAGCCTCTGG + Intronic
1165766539 19:38354936-38354958 GGGGCCCTCCTCAGGGCACATGG - Intronic
1167464387 19:49642411-49642433 GGGGGCCTTCTCAGGGCCCCGGG + Intronic
1168265980 19:55224366-55224388 TGGGCCCTCCCCAGGCCCTCGGG - Intergenic
925358893 2:3263453-3263475 TGGTCTCTGGTCAGGGCATCAGG - Intronic
925540508 2:4961380-4961402 TGGTCCCTCCTCTGGGCAACAGG - Intergenic
925717176 2:6795148-6795170 TGAGCTCTTCTCAGGCCATGAGG - Intergenic
926089663 2:10042184-10042206 TGCGCCCCTCTCAGAGCCTCCGG + Intergenic
926229569 2:10992411-10992433 TGGCCTCTACACAGGGCATCTGG - Intergenic
927339167 2:21961893-21961915 AGGTCCCTTCAAAGGGCATCTGG + Intergenic
931119507 2:59200137-59200159 TGGGCCCCTCCCATGGCATGTGG - Intergenic
931638933 2:64364367-64364389 TGGGTCCTTCTGAGGGCTTGGGG + Intergenic
931712747 2:65003244-65003266 TGGCCCCTTCGAAGGGCACCTGG - Intronic
933899735 2:86840844-86840866 TGTGACCTTCTCCTGGCATCTGG - Intronic
934048343 2:88190204-88190226 TGCCCCCTGCCCAGGGCATCTGG - Intergenic
934568616 2:95354238-95354260 TGGGCTCTTCTCAGAGCAGCAGG + Intronic
935780826 2:106508381-106508403 TGGGACCTTCTCCTGGCATCTGG + Intergenic
935820516 2:106887821-106887843 TGGGCCCATCTCAGGGGGACTGG + Intergenic
936243867 2:110809819-110809841 TGGGCCCTTCTCACCGCACATGG + Intronic
938158139 2:128958788-128958810 TGGCAACTTCTCAGGGCTTCAGG + Intergenic
941719739 2:168800468-168800490 TGGGCCGTTGTAAGGGCAGCAGG - Intronic
942461983 2:176175018-176175040 TGGGCCCTTCAGAGGGCGTTTGG - Intergenic
947169795 2:227299495-227299517 TGGGTCCTTCCCAGGACATGTGG + Intronic
948485717 2:238279587-238279609 TTGGCCCTTCCCAGGGCAGCTGG + Intronic
948780708 2:240320066-240320088 TGGGCCCTTCTCAGGCCTGTAGG - Intergenic
948914997 2:241030025-241030047 TGGGCACTCCACAGGGCATCGGG + Intronic
948916586 2:241037506-241037528 TGGGCCTTTCCCTGGGCATCTGG - Intronic
1168921057 20:1536847-1536869 TGGAACCTTCACAGGACATCAGG + Intronic
1169969249 20:11251307-11251329 TGGTCTCCTCCCAGGGCATCAGG - Intergenic
1170517919 20:17151099-17151121 TGTGCCCTTCTCTGAGCTTCTGG + Intergenic
1172438199 20:34945454-34945476 TGGGCCACACTCAGGGCATGAGG - Intronic
1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG + Intergenic
1172894617 20:38291768-38291790 TGGTCCCATCTCAGGGCATGTGG + Intronic
1172919437 20:38468923-38468945 CTGGAGCTTCTCAGGGCATCTGG + Intergenic
1173443350 20:43096667-43096689 TCTGGCCTTCTCAGTGCATCTGG - Intronic
1174128653 20:48326699-48326721 TGGGCCCTCACCTGGGCATCGGG + Intergenic
1175965336 20:62657456-62657478 TGGACCCTGCTCAGGGCTCCAGG + Intronic
1176241737 20:64078688-64078710 TGTACCCTTCTCAGGTCAACTGG + Intronic
1176255494 20:64150532-64150554 TTGGCTCTTCTCTGGGCCTCAGG + Intergenic
1178440225 21:32592582-32592604 TGGGACGATCTCACGGCATCCGG - Intronic
1179072524 21:38084950-38084972 TGGGCCCTTCTCAGGGCATCAGG + Intronic
1180002028 21:44999474-44999496 TGGCCACTTCTCAGGGCACCCGG + Intergenic
1180922110 22:19526247-19526269 TGCGGCCTCCTCAGGTCATCAGG + Intronic
1180955506 22:19739580-19739602 TGGGGCCTCCTCAGGGCCTGCGG + Intergenic
1185029394 22:48433709-48433731 TGGGTCCTTCCCAGCCCATCGGG - Intergenic
951113259 3:18831090-18831112 TGGGTCCTTCTCAGGACACATGG - Intergenic
952022326 3:29039096-29039118 TGGGTCCTTCTCATGACATGTGG - Intergenic
953568543 3:44053580-44053602 AGGGCCCTTCTCAGAGGTTCTGG - Intergenic
954395382 3:50290661-50290683 TGGGCACTGCTCCGGGCACCTGG + Exonic
956342471 3:68241339-68241361 TGGGCTAATCTCAGGGTATCTGG - Intronic
956438453 3:69257092-69257114 GGGGCCATTCTGAGGACATCTGG - Intronic
958473265 3:94548940-94548962 TGGGTGCTTCCCAGGGGATCAGG - Intergenic
959602459 3:108203134-108203156 TATGCCCTTCCCAGGGCAACTGG + Intronic
961637434 3:128342251-128342273 TGGGGCCTGATCAGGGCAGCAGG - Intronic
964823930 3:160804996-160805018 TGTGACCTTCTCCTGGCATCTGG + Intronic
966990669 3:185226989-185227011 TGGGCCCTTTTCTAGGCATTAGG - Intronic
969297763 4:6279745-6279767 TGGTCACTCTTCAGGGCATCAGG + Intronic
969607481 4:8209833-8209855 TGGGCCCTACACAGGGCTTCAGG + Intronic
969671070 4:8590719-8590741 TGGGGACTTCTCAGGGCTTCTGG - Intronic
977394576 4:96454786-96454808 TGGGTGTTTCTCAGGGCAACAGG + Intergenic
979496863 4:121393342-121393364 GTCGCCCTTCTCAGGGCATGTGG + Intergenic
981484536 4:145271362-145271384 TGGGCTCTTCTCTGGGTCTCCGG + Intergenic
983006594 4:162492254-162492276 TGGGTCCTTCTCATGACATGTGG - Intergenic
984213139 4:176875610-176875632 TGGCCCCTGCTCAGGGCCTCAGG + Intergenic
984585802 4:181562969-181562991 CGGGCCCTTCTTAGGGCCACTGG + Intergenic
984616420 4:181903748-181903770 GGGGCCCTCCTCAGGGCCCCAGG - Intergenic
985907657 5:2853419-2853441 TGGGCCCTTCTCAGGTATGCTGG + Intergenic
986405964 5:7425115-7425137 TGTGCAGCTCTCAGGGCATCTGG + Intronic
989229803 5:39073880-39073902 CGAGCCCTTCTCCGGGCCTCGGG - Intronic
997281512 5:132650790-132650812 TGGGGCCTTCTCACTGCATCAGG - Intergenic
997390319 5:133509830-133509852 TGGGCACTGCCCAGGGCAGCAGG - Intronic
998310463 5:141124182-141124204 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998311620 5:141137618-141137640 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998312902 5:141152438-141152460 GGGTCCCTTTCCAGGGCATCTGG + Exonic
998313595 5:141158187-141158209 GGGCCCCTTTCCAGGGCATCTGG + Intergenic
998315663 5:141180224-141180246 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998318067 5:141201961-141201983 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998320574 5:141225692-141225714 GGGTCCCTTTCCAGGGCATCTGG + Exonic
998322806 5:141247765-141247787 GGGCCCCTTTCCAGGGCATCTGG + Exonic
1001683001 5:173572555-173572577 TGGCCCATTCTCAGGGCATCTGG + Intergenic
1002377561 5:178799109-178799131 TGGGCCAGTCTCAGGGAGTCAGG - Intergenic
1003076612 6:2988571-2988593 TTGGCCCTTCCCAGGCCACCAGG - Intronic
1003171989 6:3727204-3727226 TGTCCCCATCTCAGGGAATCAGG + Intronic
1005832245 6:29680506-29680528 TGGTCTCTGCTCAGGGCTTCGGG + Intronic
1007612569 6:43160012-43160034 TGGGGCCTACTCAGGGCCCCAGG + Intronic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1009971283 6:70627976-70627998 TGGGCCCTGCACAGGGCGCCGGG - Intergenic
1010795783 6:80114942-80114964 TTGCCCCATCTCAGGGCACCTGG - Intronic
1012644749 6:101664975-101664997 TGGGCCCCTCGCATGGCATGTGG + Intronic
1013056208 6:106585359-106585381 TGGGACATTCTCAGTGCTTCTGG - Intronic
1013152957 6:107464205-107464227 TGGAGCCTTCTCAGGGTATGTGG - Intergenic
1013351687 6:109311645-109311667 TGGACTCTTCTCAGGGCATCTGG - Intergenic
1013923950 6:115445742-115445764 TGAGCCCTTTTAAGGGCTTCTGG - Intergenic
1014134129 6:117867754-117867776 TGGGTCCCTCTCATGGCATGTGG + Intergenic
1015768756 6:136747339-136747361 TGGTCCCTTCATAGGGCAGCAGG + Intronic
1015772152 6:136779910-136779932 TGGGACCCTCTCAGGGCAAACGG + Intronic
1015969453 6:138729801-138729823 TGTGCCATTCTCAGGGCACAGGG + Intergenic
1016597823 6:145821264-145821286 TGTGCCCTTATCAGGGTAGCTGG + Intergenic
1017635435 6:156438602-156438624 TGGGTCCTGCTCAGAGCATGGGG - Intergenic
1017745988 6:157447347-157447369 TGGGCCATGCTCTGGGCACCCGG + Intronic
1018341485 6:162855895-162855917 TGGCCCCTTCTCACGGAGTCCGG + Intronic
1018901732 6:168054945-168054967 TGGGCAAGTCTCAGGGCAGCGGG + Intergenic
1019288840 7:237227-237249 TGGTCCCTTTTCAGTGCAGCAGG + Intronic
1019525558 7:1478943-1478965 CGGGCCCTGCTCTGGGCCTCGGG - Intronic
1022497362 7:30861492-30861514 TGGGCCCCACCCAGGCCATCTGG + Intronic
1022803932 7:33802945-33802967 TGAACCCTTCTCAGTGCCTCAGG + Intergenic
1023423549 7:40010196-40010218 TGGTCCCATCTCAGGGCAATGGG + Intronic
1026131464 7:67624519-67624541 TGTCCCCTTCTCAGTGCATCAGG - Intergenic
1028234841 7:88347896-88347918 TGAGGCCTTCTCAGTGCACCTGG + Intergenic
1028234954 7:88349323-88349345 TGAGGCCTTCTCAGTGCACCTGG + Intergenic
1028263220 7:88688768-88688790 TGGCTCCTTCTGAGGGCTTCTGG - Intergenic
1031122865 7:117741101-117741123 TGGGCCCTCCACAAGGCATCTGG - Intronic
1034938662 7:155215967-155215989 TGGGGTCTTCTCAGGGCCTAGGG + Intergenic
1035129970 7:156642506-156642528 TGGGCCTTTCTTACTGCATCGGG + Intronic
1038580448 8:28744244-28744266 TTGACCCTTCTAAGGACATCAGG - Intronic
1039581722 8:38672180-38672202 TTGGCTTTTCTCAGAGCATCTGG + Intergenic
1045508419 8:102794771-102794793 CGGGCCCATTTCAGGGCATCAGG + Intergenic
1047248604 8:123165413-123165435 TAGGCCATTCTCGGGGCTTCCGG - Intergenic
1047632964 8:126728136-126728158 TTGGCCCTGCTAAGGGAATCTGG + Intergenic
1048164860 8:132053628-132053650 AGGTCCCTTCTCAGAGGATCTGG + Intronic
1048622845 8:136153597-136153619 TGGGCCCCTCTCAGGACATGTGG - Intergenic
1049432892 8:142573526-142573548 TGGGCCCTCCTCATGGCCTGGGG - Intergenic
1053084179 9:35204085-35204107 TGGGCCCTTCTGAGCCCAGCTGG - Intronic
1053458489 9:38250323-38250345 TGGGCCCTGCTCAGGGTCTGAGG + Intergenic
1055720981 9:79174613-79174635 TGGGCATTTCCCAGAGCATCCGG + Intergenic
1057444406 9:95103744-95103766 TGGGCTCTTCTCCAGGCACCTGG - Intronic
1060788085 9:126466175-126466197 TGGGGCCATCTCAGGCCATCCGG - Intronic
1061529583 9:131199956-131199978 TGGCCTCTTCACAGGGCATTGGG - Intronic
1061901220 9:133673062-133673084 TAGGCCCTGCTCAGTGCCTCTGG - Intronic
1061921060 9:133782860-133782882 TGTGCCCTGCTCAGGGCAGCTGG - Intronic
1062432439 9:136532112-136532134 TGGGCCCCTCCCAGGGCTGCAGG - Intronic
1062641189 9:137519455-137519477 TGGGCCTGTCTGAGGACATCCGG + Intronic
1062730162 9:138104139-138104161 TGGACCCTCCTCAGCTCATCTGG - Intronic
1197059044 X:122154679-122154701 TTGGTCCCTCTCATGGCATCTGG - Intergenic
1198715686 X:139555620-139555642 TGAGCCCATCGCTGGGCATCTGG - Intronic
1200940016 Y:8771466-8771488 TGCTCCAGTCTCAGGGCATCAGG - Intergenic
1202036461 Y:20641626-20641648 TGGCCCATTCTCAGTGCCTCTGG + Intergenic
1202196623 Y:22305158-22305180 AGGCCACTACTCAGGGCATCTGG - Intergenic