ID: 1179072885

View in Genome Browser
Species Human (GRCh38)
Location 21:38089482-38089504
Sequence TTGAAGATGAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 1, 2: 10, 3: 96, 4: 873}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179072885 Original CRISPR TTGAAGATGAAGATGGAGGA AGG Intronic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901248565 1:7754109-7754131 TCGAAGAGGAAAAGGGAGGAAGG - Intronic
901319597 1:8331534-8331556 TGGAGGCTGAAGAAGGAGGATGG + Intronic
901509191 1:9707277-9707299 TTGTTGATGAAGATGAAGGCTGG - Intronic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902729138 1:18357230-18357252 TTGGAGATGAAGATGGGGTTGGG + Intronic
902729148 1:18357278-18357300 ATGGAGATGAAGATGGAGTGGGG + Intronic
902731528 1:18373098-18373120 CTGAAAATGACAATGGAGGAGGG - Intronic
903319991 1:22537271-22537293 ACGAGGATGAAGATGCAGGAGGG - Intergenic
903389980 1:22956733-22956755 TGGAAGATGAAGCTGGGGCACGG - Intronic
903468856 1:23570900-23570922 TTGCAGAAGTAGATGGAGGTGGG + Intergenic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
904659631 1:32074796-32074818 ATGAAGCTGAAGATGTAAGAAGG + Intronic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
905949023 1:41930041-41930063 TTGAAGATGATGAGGAAGAAGGG - Intronic
906124154 1:43416345-43416367 TTCAAGAGGAAGAAGCAGGAGGG + Intronic
906152566 1:43596126-43596148 TGGAAGCTGAACATGGAGGGTGG + Intronic
906260859 1:44388662-44388684 TGGAACAAAAAGATGGAGGAAGG - Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908510774 1:64848468-64848490 GTGAAGATGAAGGTGGAGCCTGG + Intronic
908716716 1:67078583-67078605 TTGAACATGAAGATTGTTGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
908919453 1:69171536-69171558 TAGAACAAGAAGATGAAGGAAGG + Intergenic
908986448 1:70029364-70029386 TTAAAGAGGAAAAGGGAGGAGGG + Intronic
909033553 1:70570350-70570372 TGGAAGCTGACGATGGAGGATGG - Intergenic
909151526 1:72011920-72011942 TTGAAGGTGGAGATGGAGAGTGG + Intronic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912515512 1:110214192-110214214 TTGAAGTTTATGATGGAGCAAGG + Intronic
912596407 1:110881255-110881277 CTGAGGATGAAGGTGGGGGAGGG - Intronic
912838205 1:113015471-113015493 TAGTAGATGAAGACGGGGGATGG - Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913927054 1:124906991-124907013 TTGAAGATTTCGATGGAGAAGGG + Intergenic
915794537 1:158715011-158715033 TTGAAGAAGAGGATGGACCAGGG - Intergenic
915880096 1:159660659-159660681 TTGAAGATGAAGGCGAAGCAAGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
917635406 1:176930943-176930965 GTGAAGATTAAAATGGAGGAGGG + Intronic
917751384 1:178056661-178056683 TGGTAAATGGAGATGGAGGAAGG - Intergenic
918326220 1:183413228-183413250 TGGAAGATGTAAAGGGAGGAGGG + Intronic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918357577 1:183720053-183720075 TGGAAGATGAAGGTAAAGGATGG + Intronic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918420182 1:184356440-184356462 TAGAACATCAAGATGGGGGAAGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918863868 1:189869110-189869132 TTGAAGATGTAGTTGGAACAAGG - Intergenic
919839425 1:201598296-201598318 TTGAAGATAAAGAATGAGGCAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920437479 1:205956769-205956791 GTTAAGATGAAGATGGGGGCTGG - Intergenic
920521602 1:206631658-206631680 TTGGTCTTGAAGATGGAGGAGGG - Intergenic
920535758 1:206735642-206735664 TTGCGGTTGAAGATGGAGAAAGG - Intergenic
920666870 1:207969416-207969438 TGCAAGATGAAGTTTGAGGATGG + Intergenic
921781141 1:219165988-219166010 TTGAAGAAGTAAATAGAGGAGGG + Intergenic
922356660 1:224782773-224782795 TTGATGAAGAAACTGGAGGAGGG + Intergenic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
922929718 1:229379617-229379639 TTGAAGATGAATTTGGTGGCTGG + Intergenic
923339912 1:232998372-232998394 TTGAAGACGTGGACGGAGGAGGG - Exonic
923988418 1:239407879-239407901 TGGAAGAGGAAGATGGAGAAGGG + Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
1063193120 10:3716797-3716819 AGGAAGGTGAAGATGAAGGAAGG + Intergenic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1066088490 10:31994688-31994710 TTGAAGCTGAGAATTGAGGAAGG + Intergenic
1067014612 10:42748059-42748081 TGGAAGATGGAGATGGAGGTGGG + Intergenic
1067373603 10:45707290-45707312 TGGAATGTGAAGATGGATGAAGG + Intergenic
1067380086 10:45764937-45764959 TGGAATGTGAAGATGGATGAAGG - Intronic
1067412885 10:46079943-46079965 TTGGTGGGGAAGATGGAGGAAGG + Intergenic
1067881426 10:50049061-50049083 TGGAATGTGAAGATGGATGAAGG + Intergenic
1067887785 10:50105592-50105614 TGGAATGTGAAGATGGATGAAGG - Intronic
1067894145 10:50161548-50161570 TTGATTTTGAAGATGGATGAAGG - Intergenic
1067954700 10:50778713-50778735 TTGATTTTGAAGATGGATGAAGG + Intronic
1067984832 10:51131180-51131202 TTGAAGATCAAGAAGTATGAAGG - Intronic
1069116773 10:64516792-64516814 TTAAAGAGGAGGATGTAGGAAGG + Intergenic
1069180328 10:65351035-65351057 TTGCAGAAGAACATGAAGGATGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069617810 10:69817407-69817429 TTGACAATGAAGTTGGGGGAGGG + Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070394441 10:76000165-76000187 TTGGTGATGGAGGTGGAGGACGG + Intronic
1070430664 10:76334549-76334571 TGGAGGAGGAAGCTGGAGGACGG - Intronic
1070437210 10:76404921-76404943 TGTAAGTTGAAGATGAAGGAAGG + Intronic
1070529263 10:77322383-77322405 TTGATGATGAAGTTGGAGCATGG - Intronic
1071008493 10:80910946-80910968 TGTACGTTGAAGATGGAGGAAGG + Intergenic
1071016331 10:81001257-81001279 GTGAAGATGAGGATGGGGGTGGG + Intergenic
1071342477 10:84661616-84661638 TTGAAGAGGCAGTTGTAGGAAGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072489129 10:95886628-95886650 TTGACTTTGAAGATGAAGGAAGG + Intronic
1073139400 10:101237424-101237446 AGGAAGAAGAAGATGGGGGAGGG - Intergenic
1073617916 10:105016671-105016693 TAGAAGATGAAGATTGCTGAAGG + Intronic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074257933 10:111821920-111821942 CTGAAGATGAGGGTGGAAGATGG - Intergenic
1074318242 10:112378108-112378130 TGGAGGCTGGAGATGGAGGAAGG + Intronic
1074365756 10:112856280-112856302 TTGAAGTTGGAGATGGGTGAGGG - Intergenic
1075077468 10:119360746-119360768 TGGAAGAGGAGGAGGGAGGAGGG - Intronic
1075432266 10:122396864-122396886 TAGAAGAGGAAGATAGAGGTAGG - Intronic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075513779 10:123093528-123093550 TTGAGAAGGAAGATGGTGGAAGG + Intergenic
1075833943 10:125436996-125437018 TTGTAGATGATGATGATGGATGG - Intergenic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076557383 10:131336084-131336106 TTCAAGATGAAGATGCAAGCAGG - Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077167599 11:1150743-1150765 GGGAAGATGAAGATGGAAGCAGG + Intergenic
1077262802 11:1631993-1632015 GTGAAGATGAAGGTAGAGGTTGG + Intergenic
1077345211 11:2045077-2045099 TGGAGAATGAAGATGGAGAAAGG - Intergenic
1077345566 11:2049157-2049179 TGGAAAATAAAGATGGAGAATGG - Intergenic
1077346814 11:2063332-2063354 TTGAAGAAAAAAATGGAGTATGG - Intergenic
1077743567 11:4875567-4875589 TTGACATTGAAGATGAAGGAAGG - Intronic
1078479640 11:11664697-11664719 TTGAAGAGGTAGATGGGGGAGGG - Intergenic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1079304131 11:19307681-19307703 TTGTGGATGAAGATGAAGCATGG - Intergenic
1079518332 11:21294188-21294210 GTGAAGCTAAAGATGTAGGAGGG - Intronic
1079608957 11:22406596-22406618 TAGAAGAGAAAGAGGGAGGAGGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079927423 11:26511854-26511876 TTAAAGATCAAGATGGTGGTGGG + Intronic
1080785757 11:35473622-35473644 TTGAAGAGGAAGATTGAGAAGGG + Intronic
1080882687 11:36337398-36337420 TTGAAGATCAAGATGTTAGAGGG - Intronic
1081014054 11:37854062-37854084 ATGAAGATGAAGGCAGAGGAGGG + Intergenic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1082014979 11:47478617-47478639 TTGAAGAAGAATATGGAAAAGGG - Intronic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082797247 11:57387225-57387247 TTGAGGAGGAGGATGGAGGGTGG - Exonic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1083796537 11:65020152-65020174 TGGAAGAGGAAGCTGGAGCATGG + Intronic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1084543149 11:69799743-69799765 TAGGAGATGACGTTGGAGGAAGG + Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085171743 11:74455558-74455580 TTGAAGAGGAAAACGGATGAGGG + Exonic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086151500 11:83615693-83615715 TTGATTCTGAAGATGGAAGAAGG + Intronic
1086360532 11:86054373-86054395 TCTAAAATGAAGACGGAGGATGG + Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086890273 11:92249655-92249677 TTGCATATGAAGCTGAAGGAGGG - Intergenic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1086922868 11:92606982-92607004 GAGAAGATGAAGATGCAGGGAGG - Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1089339609 11:117748635-117748657 TTGGAGATGAGGATTAAGGAGGG + Intronic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1089995581 11:122903974-122903996 TGGAAGAGTAAGAAGGAGGAAGG + Exonic
1090959919 11:131547000-131547022 TGGAAGAGGAGGTTGGAGGAGGG - Intronic
1091003412 11:131930340-131930362 TTGAAAATAAGCATGGAGGAAGG - Intronic
1091163584 11:133449642-133449664 GTGAAGATGAAGATAGAGACTGG - Intronic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091531316 12:1358791-1358813 GTGGGGATGAAGTTGGAGGAGGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092955068 12:13542256-13542278 TTAAAGATGAACAAGGAGTAAGG + Exonic
1093518141 12:20015614-20015636 TTGAAGAGGATCATGGAGGCAGG + Intergenic
1094303771 12:28995220-28995242 ATGAAGATGAAGTTGGAGTGAGG - Intergenic
1094752727 12:33431146-33431168 TGGAAGAAGAAGATGGAAAAAGG + Intronic
1095795642 12:46216135-46216157 TGCAAGGTGAAGATGCAGGAGGG - Intronic
1096516138 12:52156629-52156651 TTGAATAGGAAGGTGGCGGATGG + Intergenic
1096814937 12:54196041-54196063 TTGAAGAGGGAGCTGGAGGGTGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097578862 12:61428794-61428816 TTGCAGTAGAAGATGAAGGAGGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098307751 12:69118460-69118482 TGGAGGATGAAGAGAGAGGAGGG - Intergenic
1098345601 12:69499772-69499794 TTGATGGTGAAGTTGGAGTAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098644547 12:72881954-72881976 ACGAAGGTGAAAATGGAGGAGGG + Intergenic
1099837596 12:87927011-87927033 TTTAAGAAGAAGAGGGAGCATGG - Intergenic
1100081724 12:90860692-90860714 TTAAAATTGAAGATGGAAGAAGG - Intergenic
1100190106 12:92181158-92181180 ATGAAGATGAAAATGGAGATTGG + Intergenic
1100855504 12:98753935-98753957 ATGGAGAGGAAGATGCAGGATGG + Intronic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1101398416 12:104367858-104367880 TAGAAGAAAAAGGTGGAGGAAGG + Intergenic
1101408899 12:104453241-104453263 GACAAGATGAAGAGGGAGGAAGG - Intergenic
1101680963 12:106965043-106965065 TTGAAGGTGATGATGGAGAGTGG - Intronic
1101793922 12:107955676-107955698 TTGAATATGAGGGTGGAGGATGG + Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102188632 12:110969040-110969062 GTGAAGAAGAAGATGGAGATCGG + Intergenic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1103938683 12:124490177-124490199 TTGGAGCTGAACCTGGAGGAAGG - Intronic
1103976093 12:124703712-124703734 TTGATGATTAAGATGGAAAAAGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400638 12:128473143-128473165 GTGAAGATGAAGATAGTGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400643 12:128473191-128473213 GTGAAGATGAAGATAGTGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400658 12:128473311-128473333 CTGAAGATGAAGATAGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400667 12:128473407-128473429 GCAAAGATGAAGATGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400686 12:128473569-128473591 GTGAAGATGAAAATAGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104439527 12:128783385-128783407 TGCATGATGAAGATGGAGGAGGG - Intergenic
1104715772 12:131015300-131015322 TGGAAGATGGAGATGGAGAGGGG + Intronic
1104715821 12:131015552-131015574 TTGGAGATGGAGATGGAGATGGG + Intronic
1104792138 12:131489996-131490018 GTGAGGATGCAGTTGGAGGAAGG + Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1106474130 13:30082767-30082789 TTGAAGATGGAGCTGGAGAGAGG + Intergenic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1107077979 13:36344437-36344459 TTTAAGATGGAGATGTAGCAAGG - Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1109391625 13:61702602-61702624 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1109643186 13:65218718-65218740 ATGAAGTTGAAGATGGACAATGG + Intergenic
1109722866 13:66298629-66298651 AGGAAGATGGAGATGGAGGGAGG + Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110999256 13:82157324-82157346 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111023839 13:82491972-82491994 TTGAAGTTGAAGGTCCAGGATGG + Intergenic
1112131256 13:96526180-96526202 GGGAAGATGAAGATGAAGGTGGG + Intronic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112407558 13:99134691-99134713 TGGAGGATGAAAATGGAGGATGG - Intergenic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112713007 13:102151792-102151814 TTGAAGGTAAAAATGGAGGTCGG - Intronic
1113270504 13:108668601-108668623 TTGATGTTGGAGACGGAGGAGGG - Intronic
1113274763 13:108716426-108716448 TGGAGGATGAATCTGGAGGACGG + Intronic
1113365738 13:109674165-109674187 TGGAAGATGAAGAGGAAGCAAGG - Intergenic
1113842989 13:113371010-113371032 TTGGAGATGGAGATGGAGTCTGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114556770 14:23566744-23566766 TTAAAGAGGAAGATGGAACAGGG - Intronic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116353641 14:43899166-43899188 TTAATGATGATGATGGAAGACGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1117966402 14:61211016-61211038 TGAAAGCTGAACATGGAGGAAGG + Intronic
1118381585 14:65221996-65222018 TAAAAGATCAAGATGGAGGCTGG + Intergenic
1118889522 14:69896398-69896420 TTGAAGAGGAAGCTGAAGCATGG - Intronic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1120543613 14:85782167-85782189 TTGGAGATGAAGCTGGAATATGG - Intergenic
1120691156 14:87594649-87594671 AGGAAGGTCAAGATGGAGGATGG - Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121045373 14:90784037-90784059 TTCAAGATGAAGTTGGGGGGCGG + Intronic
1121613128 14:95294669-95294691 AGGAAGATGAAGTAGGAGGAGGG - Intronic
1121654952 14:95588380-95588402 ATGAGGATGAAGACGGGGGAAGG + Intergenic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122856114 14:104561028-104561050 GGGAAGCTGATGATGGAGGAGGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122915957 14:104859101-104859123 TGGAAGATGGAGATGGAGGGTGG - Intergenic
1122916062 14:104859523-104859545 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916096 14:104859666-104859688 TGGACGGTGGAGATGGAGGATGG - Intergenic
1122916117 14:104859755-104859777 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916121 14:104859768-104859790 TGGATGGTGGAGATGGAGGATGG - Intergenic
1122916137 14:104859833-104859855 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916179 14:104860039-104860061 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916197 14:104860115-104860137 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916201 14:104860128-104860150 TGGACGATGGAGATGGAGGATGG - Intergenic
1122916213 14:104860193-104860215 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916258 14:104860399-104860421 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122916317 14:104860644-104860666 TGGAGGATGGAGATGGAGGGTGG - Intergenic
1122961317 14:105094726-105094748 TGGAAGATGAGGCTGGAGGGAGG + Intergenic
1123000977 14:105293971-105293993 TTCAAGATGAAGCTGGAGGAAGG + Intronic
1124060748 15:26291711-26291733 TTGAAGAAGAAGCTGGGTGAAGG - Intergenic
1124955149 15:34355588-34355610 TTGAGGATGAAGATGGGGATGGG + Exonic
1125830809 15:42716051-42716073 TTAAAGGTGATGATGGAGGTAGG + Intronic
1126112507 15:45183996-45184018 TTGCAGATGGAGATAGAGGGAGG - Intronic
1126482759 15:49144272-49144294 TTGAAGGTGAAAAAGGAGAATGG - Exonic
1126498551 15:49319594-49319616 TTGAAGATGAGCACTGAGGAAGG - Exonic
1126509961 15:49459535-49459557 ATTAAGATAAAGATAGAGGATGG - Intronic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126738433 15:51754125-51754147 TTGAAGTTGAAGCTAGAGGATGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1127469675 15:59279388-59279410 TTAATGATAAAGCTGGAGGAAGG + Intronic
1127469821 15:59280974-59280996 TTGGAGGTGAGGATGGGGGAGGG - Intronic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1127997489 15:64162113-64162135 TTGGAGATGAAGATGTAGGCCGG - Exonic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128266268 15:66269237-66269259 TTGGAGATGGAGGTGGAGGTGGG - Intergenic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1129087015 15:73104786-73104808 TGGAAGGTGAAGGTGGAGCAGGG + Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1130128709 15:81117789-81117811 ATGAAGACGAAGATGTAGAAGGG - Intronic
1130821713 15:87503016-87503038 TTAAGGATGAAGGTGGAGGTAGG - Intergenic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132180393 15:99748534-99748556 TTCAAGATGAAGGTGGTGGCAGG - Intergenic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132491151 16:232068-232090 TCGAAGCTGAGGTTGGAGGATGG + Intergenic
1132795492 16:1719441-1719463 TTGAAAAGGAAGATGTAAGAGGG + Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1134187349 16:12095024-12095046 ATGAAGATGATGATTTAGGAAGG + Intronic
1134230050 16:12421935-12421957 TTGATGATGGTGATGGATGATGG - Intronic
1134276156 16:12778208-12778230 TTTAAGTTGAAAATGGAGAAAGG - Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135714284 16:24747862-24747884 TTGAAAATGAAGTTTGAGAAAGG + Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135898481 16:26432451-26432473 TAGAAGTTGAATATGGAGGTCGG - Intergenic
1135967750 16:27050071-27050093 ATGAAGCTGAAGGTGGAGGCAGG + Intergenic
1136093482 16:27937320-27937342 TTGAACCTGGAGATGGAGGTTGG - Intronic
1136093670 16:27938301-27938323 TTGAACCTGGAGATGGAGGTTGG + Intronic
1136414569 16:30095689-30095711 TGGCAGCTGAAGCTGGAGGAAGG + Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136683323 16:31980352-31980374 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1136783955 16:32923908-32923930 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1136885827 16:33929898-33929920 GTGAAGATGAATTTGGAGAAAGG - Intergenic
1137237265 16:46626160-46626182 TGGAATGTGAAGATGGTGGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139087274 16:63602547-63602569 GTGAAGATGGGGATGGAGGTGGG + Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140561234 16:75984504-75984526 TTGAAAATGAGGATAGAAGAAGG - Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140735697 16:77895982-77896004 TTGGAGAGAAAGATGGAGGTTGG + Intronic
1140940603 16:79718438-79718460 AAGAAGAGGAATATGGAGGAGGG + Intergenic
1141107576 16:81246123-81246145 TTAAAGATAGAGATGGAGGCCGG - Intronic
1141126259 16:81403243-81403265 GTGAAGATGAAGCTGGGTGATGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1203086611 16_KI270728v1_random:1187910-1187932 GTGAAGATGAATTTGGAGAAAGG + Intergenic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1143364664 17:6398517-6398539 GTGAAGATGAAGGTGGAGATTGG + Intronic
1143610218 17:8013784-8013806 TTGAAGACCAAGATGTGGGAGGG - Intronic
1145048893 17:19643758-19643780 TTTAAGCTGAAAAAGGAGGATGG + Intergenic
1146130292 17:30267608-30267630 TTAATAATGAAGATGGAAGAAGG - Intronic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1147144232 17:38476063-38476085 GTGAAGATGAATTTGGAGAAAGG + Intronic
1147241060 17:39090817-39090839 TTGAACATGAGGAGGAAGGATGG + Intronic
1147429283 17:40361815-40361837 GGGAGGATGAAGATGGAGGAGGG + Intronic
1148879374 17:50714036-50714058 TAGCAGATGAAGTTGGAGAAGGG + Intergenic
1148943634 17:51238545-51238567 TAGAAAAAGAAGATGGATGATGG + Intronic
1149062328 17:52437565-52437587 TTGAGGATGAAGAAGAAGAATGG - Intergenic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150554522 17:66242042-66242064 TAGAAGGTGAAGAGGGAGCAGGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151013556 17:70529677-70529699 TTGAAGCTGAGGTGGGAGGAGGG + Intergenic
1151651096 17:75470164-75470186 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1153394426 18:4602438-4602460 TGGAAAATGAAGATGGAAAAGGG - Intergenic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153922823 18:9806429-9806451 TTGAGGATGCTGGTGGAGGAGGG + Intronic
1154031293 18:10756308-10756330 TGGAGGATGAAGAGGAAGGATGG + Intronic
1155337502 18:24779821-24779843 TTGACAATGAAGATGGAGACGGG - Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156297629 18:35807220-35807242 TTGAAGATTAAGAGGGGTGAGGG - Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1158218958 18:55129993-55130015 GTGAAGATGGAGGTGGAGGTTGG + Intergenic
1158274375 18:55750697-55750719 ATGAAGATGTAAATGGGGGAAGG + Intergenic
1158296000 18:55997510-55997532 GTGAACTTGAAGAGGGAGGAGGG - Intergenic
1158329666 18:56347596-56347618 TTGGAGAGGAGGATGGAGCATGG + Intergenic
1158634945 18:59148202-59148224 GTGAAGAGGAAGATTGAGGCAGG + Intronic
1158879948 18:61768511-61768533 TGGAAGATGAAGGAGGAGCAAGG - Intergenic
1159578984 18:70213768-70213790 TTGAAGATTAAGATGCTGGCAGG + Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160448695 18:78947190-78947212 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1161864912 19:6826694-6826716 GTGCAGATGAAGCTGGAGGTGGG + Exonic
1162404001 19:10462636-10462658 TGGAAAGTGAAGATGGAGAAGGG - Intronic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1162896278 19:13766346-13766368 TGGAACCTGAAGATGAAGGAGGG - Intronic
1162947123 19:14050860-14050882 TGGTAGATGAAGCCGGAGGATGG - Exonic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163347688 19:16754232-16754254 TGGAAGATGGAGATGATGGATGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1164190604 19:22913760-22913782 TTAAAGATGTAGAAGGTGGAAGG - Intergenic
1164231916 19:23296885-23296907 TTGCTGAGGATGATGGAGGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164850436 19:31478745-31478767 TGGAAGATGAAAATGGAAGTTGG + Intergenic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165570842 19:36773344-36773366 ATGAAGGTGAAGGTGGAGGTGGG + Intronic
1166158828 19:40936342-40936364 TTGCAGAAGAAGTTGGAAGAAGG - Intergenic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166429418 19:42711665-42711687 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166450832 19:42899406-42899428 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166462738 19:43003751-43003773 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166468880 19:43060209-43060231 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166480026 19:43163730-43163752 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166489847 19:43249261-43249283 TTGAAGGAGAAGATGGGTGAGGG + Intronic
1166600095 19:44085957-44085979 TTGTTGATGAAGATCAAGGATGG - Exonic
1166604770 19:44131096-44131118 TTGTTGATGAAGATCAAGGACGG - Exonic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166915313 19:46191435-46191457 GTGAGGATGAGGATGAAGGAAGG + Intergenic
1167297313 19:48659104-48659126 TTGGATATGAAGGTGGAGTATGG + Intergenic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167683630 19:50941742-50941764 ATGATGATGAAGGTGAAGGAAGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168301170 19:55406015-55406037 TTGTAGAGGAAGCTGGTGGAAGG - Intronic
925145826 2:1582741-1582763 TTAAAGATGAAACTGGAAGATGG - Intergenic
925197263 2:1936217-1936239 TTTAAGATGCAGGTAGAGGACGG - Intronic
926260664 2:11257391-11257413 TTGAAGATTACGTTGGAAGATGG + Intronic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926406026 2:12553843-12553865 TTGAAGATGAAGGTGAAGCAGGG + Intergenic
926783316 2:16495676-16495698 TTGAAGATGCAGATCAAGCATGG - Intergenic
927291428 2:21408540-21408562 TTGAAGATGAGGGTGGAGGAAGG + Intergenic
927450173 2:23202634-23202656 TTGAAGATCAAGATGTGGGCAGG + Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
929139546 2:38654982-38655004 TCGAAGATGAAGGTGCCGGAGGG + Intergenic
929256940 2:39821966-39821988 ATGAAGCTGAAGGTGGAGGGTGG - Intergenic
929411555 2:41702611-41702633 GTGAAGAAGAAGGTGGAGGTTGG - Intergenic
929537193 2:42791231-42791253 GTGAAGACGAAGGTGGAGGTGGG + Intronic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
929891786 2:45924368-45924390 TTGAATAGGAAAATGAAGGATGG + Intronic
930209239 2:48617566-48617588 TGAAAGATGAAAATCGAGGAGGG - Intronic
930345075 2:50169746-50169768 TGGATGAGGTAGATGGAGGACGG + Intronic
930513302 2:52373599-52373621 TTGAAGCTGAAGATGTAGGATGG + Intergenic
930593051 2:53353196-53353218 CTGAGGATTAAGATGGTGGATGG + Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
931415367 2:62075415-62075437 TTAAAGATCAAGTTGCAGGATGG - Intronic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932111312 2:69003708-69003730 ATCAAGGTGAAGATGGTGGATGG - Intergenic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932549057 2:72748019-72748041 TATAAGATGAAGATGGAAAAAGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933270959 2:80232440-80232462 TGGGAGATGAAGAAGGAGAAGGG - Intronic
933724521 2:85418941-85418963 TGGGAGATGAAGATGGTGGGTGG + Intronic
933835578 2:86242871-86242893 TTGAAGAGTAAGTGGGAGGAAGG + Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934678997 2:96269175-96269197 TTGAAGATGAGGGTGAGGGAAGG + Intronic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935355671 2:102197282-102197304 TTGCAGGTGAAGATGCTGGAAGG + Intronic
935738823 2:106128530-106128552 TAGAACACAAAGATGGAGGAAGG + Intronic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936052648 2:109236562-109236584 TTGAAGATGACAATGAATGAGGG + Intronic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
937065527 2:119013984-119014006 TTGAAGAAGAAGAGGAAGCAGGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937386330 2:121436774-121436796 TTTAAGAAGAAGAGGGAGAATGG - Intronic
938109667 2:128555406-128555428 TGGAAGATGAAGAAGGACCAAGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938404000 2:131017318-131017340 GTGAAGGTGAAGGTGGGGGAAGG - Intronic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938969011 2:136415177-136415199 TTGAGGATGAAGTTGGGGAATGG + Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
939514942 2:143154670-143154692 TTGAAGAGGATTATGGATGAGGG + Intronic
939603650 2:144225300-144225322 TTGAAGATGATAAGGGAGGCTGG - Intronic
939915272 2:148033730-148033752 TTGAAGTTGAAAATTGATGAAGG + Intronic
940268164 2:151862045-151862067 GTGAAGATGAGAATGGAGAAAGG - Intronic
940722954 2:157301610-157301632 ATGAAGGTGAAGAGGAAGGAAGG + Intronic
940806969 2:158198452-158198474 TTGAAGTTGAAGTTGAAGAATGG + Intronic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941059973 2:160836078-160836100 ATGATGGTGAAGATGGAGGTAGG + Intergenic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941216121 2:162711498-162711520 TGCAGGATGAAGATGGAGGTGGG - Intronic
941234748 2:162957128-162957150 TTGTAGCAGAAGCTGGAGGAGGG - Intergenic
941312854 2:163955693-163955715 TTAAAGCTGAAGAGGGAGGGAGG + Intergenic
941863600 2:170310583-170310605 TTGAACCTGGAGATGGAGGTTGG + Intronic
942432712 2:175931026-175931048 TTAAAGAACAGGATGGAGGAGGG + Intronic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942831801 2:180245333-180245355 TTTAAGAAGAAGCTGGAGAACGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943170577 2:184392885-184392907 TTAAAGTTGAAGAAGGAAGAGGG + Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943600901 2:189919855-189919877 TAGAGGAAGAGGATGGAGGAGGG - Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
945047634 2:205795930-205795952 TTTTAGAAGAACATGGAGGAGGG - Exonic
945450165 2:209985088-209985110 CTGAAGCTGAAAATGAAGGAGGG - Intronic
945547879 2:211180488-211180510 GTGGAGGTGAAGATGGATGAGGG + Intergenic
945922793 2:215772947-215772969 TGGAAGATGGAGATGGAGGTGGG - Intergenic
945947884 2:216012106-216012128 TAGAAGAGGAAGATGGATAAGGG + Intronic
946075710 2:217071941-217071963 TGGAGGATGAAGATGGAACAGGG + Intergenic
946669587 2:222088603-222088625 TTGAAATTGAAGGGGGAGGAGGG + Intergenic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946829343 2:223712141-223712163 TTGATCCTGAAGATGCAGGAAGG + Intergenic
947030044 2:225782988-225783010 AGGAAGGTGAAGAGGGAGGAGGG - Intergenic
947256575 2:228172438-228172460 ATGACGATGAAGTTGGAAGAAGG - Intronic
947370434 2:229440261-229440283 AACAAGATGAAGATGGAGAATGG + Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169930587 20:10828497-10828519 TGAAAGATGAAGATAAAGGAAGG + Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171014095 20:21524043-21524065 TTGAAGATGAAAAGGAAGGTAGG - Intergenic
1171504519 20:25623129-25623151 TTGAAGCTGAAGGTAGAGAAAGG + Intronic
1172261882 20:33574099-33574121 ATTATGATGAAGATTGAGGATGG + Exonic
1172430109 20:34883208-34883230 TTGTAGTTGAAGAGGGAGAAAGG + Intronic
1172507679 20:35475708-35475730 TTGAAGGTGAAGAATGAGGCAGG - Intronic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172601064 20:36183284-36183306 ATCAACATGAAGATGAAGGAGGG - Intronic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173222252 20:41139781-41139803 GTGAGGATGAAGGTGCAGGAAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173817264 20:45997804-45997826 ATGAATAGGAAGCTGGAGGAGGG + Intergenic
1174158635 20:48534433-48534455 GTGAAGATGAAGATGGGGACAGG + Intergenic
1174747244 20:53075667-53075689 ATGAGAATGAAGGTGGAGGAAGG + Intronic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175474204 20:59258175-59258197 TTAAAAAAAAAGATGGAGGAGGG + Exonic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1177357450 21:20027927-20027949 TAGAAGAAGACGATGGAGAAAGG + Intergenic
1177357622 21:20030315-20030337 TAGAAGAAGAAGATGGAGAAAGG + Intergenic
1177383901 21:20383213-20383235 TTGAAGGTGAAGAAGGGAGAAGG + Intergenic
1177410890 21:20729178-20729200 TTTAATATGAACATGGAGAAAGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177777445 21:25583974-25583996 TTGAAGATGTGGATGTAGGGAGG - Intergenic
1177953956 21:27573798-27573820 ATGGAGATGAAGATGGAGATGGG + Intergenic
1178173464 21:30069540-30069562 TGGAAGATGAAATTGGAGGGAGG + Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179082401 21:38183995-38184017 TTGTGGAGGAAGATGCAGGAAGG - Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179542935 21:42095393-42095415 TTGACCTTGAAGATGGAGTAGGG - Intronic
1179779446 21:43690020-43690042 TTGAAGATGAAGATAAAAGTGGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180614642 22:17119623-17119645 TTGAGCATGAAGATGGAGAGGGG + Exonic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181313540 22:21958129-21958151 ACGAGGATGAGGATGGAGGACGG + Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1181742952 22:24935921-24935943 TGGAAGATGAGGGTGGATGATGG - Intronic
1181954105 22:26575697-26575719 TTTAAAATGAAGATGCAGGCCGG + Intronic
1182086031 22:27561775-27561797 TGCAAGCTGGAGATGGAGGAGGG - Intergenic
1182779836 22:32858655-32858677 TTGAAGATGAAGTGAGAGAATGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1184135940 22:42549956-42549978 GTGAAGATGAGGATGGGGGCGGG + Intergenic
1184353128 22:43958126-43958148 TTGATGCTAAAGATGGATGATGG - Intronic
1184388027 22:44187310-44187332 TTGGACGTGAAGATGGAGGTGGG - Intronic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949510210 3:4760731-4760753 CTAAACCTGAAGATGGAGGAAGG - Intronic
949685905 3:6570474-6570496 TTGAAACTGAAAATGCAGGAAGG - Intergenic
949914310 3:8945764-8945786 TTAAAAATGAAGATGGAGGCCGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950828203 3:15847779-15847801 TTGAAGGTGAAGCTGGAGGCAGG - Intronic
951168538 3:19510959-19510981 CTGAAGATGATGGTGGAGAAGGG + Intronic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952962696 3:38602714-38602736 TTGACCAGGAAGGTGGAGGATGG - Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953597652 3:44333550-44333572 ATTAGGATGAAGATGCAGGAGGG + Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954211491 3:49100024-49100046 ATGAAGCTGGTGATGGAGGATGG - Exonic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
956317472 3:67954377-67954399 ATAAATATGAAAATGGAGGAAGG + Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957167209 3:76690504-76690526 TTCAAGATCAATATGGAGGCAGG - Intronic
957362380 3:79175975-79175997 TTGAGTATGAAAGTGGAGGAAGG - Intronic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958029130 3:88086261-88086283 TTGAAGATTATGCTGGAAGATGG + Exonic
958197667 3:90262779-90262801 ATGAGGTGGAAGATGGAGGAGGG + Intergenic
958779894 3:98528216-98528238 TTGAAGATGAAGACAGAGAAAGG - Intronic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
959831515 3:110868730-110868752 TGGGAGATGAGGATTGAGGAGGG + Intergenic
959871087 3:111329334-111329356 TTGAAGACCAAGAGGGATGAAGG - Intronic
960261983 3:115578624-115578646 TTGAAGTTGAAGGTGGAAAAAGG + Intergenic
960326683 3:116304846-116304868 TTGGTGGGGAAGATGGAGGATGG + Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961398235 3:126613350-126613372 GGGAAGATGGGGATGGAGGAGGG - Intronic
961750384 3:129090852-129090874 TGGAATGTGAAGATGGTGGAGGG + Exonic
962306276 3:134289427-134289449 TTTAAAATGAAGATTGAGTAGGG - Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964370062 3:155991011-155991033 TTGAAGAGGCAGATGGTGGTTGG + Intergenic
964815995 3:160718662-160718684 TTGAAGATGAAGATTAAAGATGG + Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
966154408 3:176900312-176900334 GGTAAGATGAAGATGGAGGTTGG - Intergenic
966462747 3:180195826-180195848 TTGAAGAGGAGGGTGGAGGTAGG + Intergenic
966463673 3:180204581-180204603 TGGAAGGTGAAGGTGAAGGAAGG - Intergenic
966906575 3:184530431-184530453 GGGAAGAGGAAGATGGAGCAGGG + Intronic
967143250 3:186582155-186582177 GTGAACATTAAGATGGAGTAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967612842 3:191528244-191528266 TAGAACAGAAAGATGGAGGAAGG + Intergenic
967708221 3:192677185-192677207 TGGAAGGTGAGGAAGGAGGAAGG - Intronic
967875617 3:194266534-194266556 TAGAAGATAAAGATGGAGGGAGG + Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969335963 4:6510425-6510447 TAGAAGGTGATGATGGAGAAAGG - Intronic
969425972 4:7124035-7124057 TTGGAGATGGGGATGGAGTACGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971256839 4:25022227-25022249 GGGAAGAGGAAGATGGAGAATGG + Intronic
971262737 4:25071670-25071692 AAGGAGATGAAGTTGGAGGAAGG - Intergenic
972231369 4:37076078-37076100 TTGAAGAAGGAGCTGAAGGATGG - Intergenic
972233275 4:37099849-37099871 CTGACTATGAAGGTGGAGGAAGG + Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
972683380 4:41328536-41328558 GTGAAGATGAATGTGGAGAAGGG + Intergenic
973243435 4:47983826-47983848 TTGAAGAAGAAAATGAAGGCTGG + Intronic
973329450 4:48897400-48897422 TTGGCCTTGAAGATGGAGGAAGG - Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973766887 4:54170862-54170884 TTGAAAATGAAGATGGAAATGGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974292090 4:59946147-59946169 TTGAATAAGAAGATGGAAGTAGG - Intergenic
974563707 4:63555487-63555509 TGGAAGATGAAGATGAAGCAAGG + Intergenic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976403494 4:84635711-84635733 ATGAAGATGAAAAGGGAGGGAGG - Intronic
976406966 4:84670856-84670878 TTGAAGATGGTGATGGGGGAGGG + Exonic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978465099 4:109000184-109000206 TTAAAGAGGAAACTGGAGGAAGG + Intronic
978538225 4:109785871-109785893 TGGAAGATGAAGAGGAAGCAAGG - Intronic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
979453070 4:120895514-120895536 TTGATGTGGAAGAGGGAGGAAGG - Intronic
979513665 4:121582752-121582774 TTGAAGATGATGATGGTGCAAGG + Intergenic
979552338 4:122005090-122005112 ATGAGGATCGAGATGGAGGAGGG - Intergenic
979600290 4:122580191-122580213 TGGCAGATGAAGAAAGAGGAAGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981151618 4:141385163-141385185 GTGAAGATGAAGATAGAGATTGG + Intergenic
981613957 4:146626551-146626573 TTCAAGATCAAAATGGAGGCTGG - Intergenic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
982118841 4:152119743-152119765 TTGATGATGAAGAGGCACGAGGG - Intergenic
982823004 4:159967454-159967476 TGGAACATGAAGATTCAGGATGG - Intergenic
982866960 4:160525353-160525375 TCGAAGGTGAAGGTGGAGCAAGG - Intergenic
984590778 4:181615210-181615232 TAGAAAATTAAGCTGGAGGATGG - Intergenic
984665328 4:182421189-182421211 GTGAAGATGAAGATGAAGAGGGG - Intronic
984775754 4:183480466-183480488 GGGAAGCTGAAGAGGGAGGATGG + Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985970892 5:3377574-3377596 ATGGAGATGAAGATGCAGGGAGG + Intergenic
986559163 5:9043619-9043641 ATTAAAATGAAGATGAAGGAGGG + Intronic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
986939519 5:12934450-12934472 TTGGCCTTGAAGATGGAGGAAGG + Intergenic
987243097 5:16021130-16021152 TTGAAGATGGAGGTGGGGGCAGG - Intergenic
987551060 5:19382212-19382234 ATAAAAATGAAGCTGGAGGAGGG + Intergenic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
989466794 5:41765867-41765889 TTGGGGATGAAGATGAGGGATGG - Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
989993306 5:50795381-50795403 ATGAAGATGAAGATGGTGTTAGG - Exonic
990267853 5:54097749-54097771 TTTAAGCTTAAGGTGGAGGAAGG + Intronic
990674953 5:58173490-58173512 TTGAAGATCAAGAAAGAGTAAGG - Intergenic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
991258418 5:64640544-64640566 AGGAAGCTGAAGAGGGAGGATGG + Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
991929181 5:71735250-71735272 TGGAAGAGGAAGTTGGAAGAGGG - Intergenic
992222534 5:74586984-74587006 TAGCTGATGAAGATTGAGGAGGG + Intergenic
994777417 5:104051597-104051619 CTGATGATGATGATGGAGGTGGG - Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995483347 5:112614627-112614649 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996945783 5:129065939-129065961 TTGGCCATGAAGATGGAGGCAGG + Intergenic
997046257 5:130321657-130321679 TTGAGGGTGGAGGTGGAGGAGGG + Intergenic
997236742 5:132276496-132276518 TTGAGGTTGAGGATGCAGGAGGG - Intronic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998064570 5:139147637-139147659 TTGAACATGGACTTGGAGGAGGG - Intronic
998101342 5:139437879-139437901 TAGAAGATCAAGAGGGCGGATGG + Intronic
998902239 5:146868523-146868545 ATGAGGTTGAAGATGGGGGAGGG - Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999371982 5:151061335-151061357 GGGAAAATGTAGATGGAGGAGGG - Intronic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1000302114 5:159965658-159965680 TGGCAGAGGAAGAAGGAGGAAGG + Intronic
1000703412 5:164481143-164481165 TGGAAGATGAAGAAAGAGCAAGG + Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001057071 5:168458452-168458474 GTGAAGATGAAGATCGAACAAGG - Intronic
1001104713 5:168843285-168843307 GTGAAGAGGAAGGTGGAGGGAGG + Intronic
1001132873 5:169079456-169079478 TTGAGGTGGAAGATGGAGAAAGG + Intronic
1002339415 5:178505189-178505211 GTGAAGATGAAGGTGGAGATGGG - Intronic
1002528444 5:179828883-179828905 TGGAAGATGGACATGGAGGGAGG + Intronic
1002650762 5:180691508-180691530 TTGATAATGAAGCTGGAGGTTGG - Intergenic
1002883302 6:1271896-1271918 TTCAAAATGAGGAAGGAGGAGGG - Intergenic
1003015237 6:2462676-2462698 TGGAAGAGGCAGATGGAGAAGGG - Intergenic
1003027672 6:2571333-2571355 TGGACTTTGAAGATGGAGGAAGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003846881 6:10183007-10183029 TTGAAGATGAGGATTGGGGGAGG + Intronic
1003980421 6:11384675-11384697 TGGAGGATGAGGATGGGGGAAGG + Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004308531 6:14523067-14523089 TAGAACAAGAAGATGAAGGAAGG - Intergenic
1004569164 6:16828542-16828564 TTCAAGATGTCAATGGAGGAAGG - Intergenic
1005211306 6:23467444-23467466 TTGAGGATGTAAAGGGAGGATGG + Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1006376904 6:33676751-33676773 CTGAACCTGAAGGTGGAGGATGG - Exonic
1006427887 6:33977575-33977597 TTGAGGATGAAGATGGTGAGAGG - Intergenic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006748642 6:36362920-36362942 TCCAAGATGAAGCAGGAGGATGG - Intronic
1007101532 6:39250903-39250925 TTGAAGCTCAACTTGGAGGAGGG - Intergenic
1007174026 6:39884179-39884201 GGGAAGGGGAAGATGGAGGAAGG - Intronic
1008478889 6:51963678-51963700 TGGAGGATGAAGATGTTGGAAGG - Intronic
1008664890 6:53706461-53706483 TTAATGAAGAAGATGGAGGTAGG + Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008923024 6:56862538-56862560 ATGAAGATGAAGATGAAGTCTGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009861852 6:69344848-69344870 TGGTAGAGGAAGATGGAGAAAGG + Intronic
1010314743 6:74434796-74434818 TTGCAGAAGACGATGGAGAATGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1013741955 6:113297833-113297855 TTGAGGATAAAGATGAGGGATGG - Intergenic
1014733915 6:125068945-125068967 GTGAAGATGAAGCTGAAGGAGGG + Intronic
1015134340 6:129850911-129850933 GAGAAGATGAGGCTGGAGGACGG - Intronic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015240927 6:131022423-131022445 TTGAATATAAAGCTGGTGGAGGG - Intronic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1015809738 6:137149797-137149819 TTGAAGAAGAGCATGCAGGAAGG - Intronic
1016615963 6:146048743-146048765 TTGAAGATGAAGACGGAGATTGG + Intronic
1017281164 6:152627575-152627597 TTGAACAGGGAGATGGAGGTTGG + Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1018709498 6:166487613-166487635 ATGAAGATGAATCTGCAGGAAGG + Intronic
1019459972 7:1152684-1152706 GTGAAGATGAAGGTGGAGACGGG + Intronic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1021152964 7:17174720-17174742 TGGAAAATGAAGATGCAGAAAGG - Intergenic
1021234451 7:18125095-18125117 TTGATGATGAGGAGGGAGAAAGG + Intronic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021626778 7:22601399-22601421 TGGAAGATGGGGAGGGAGGATGG + Intronic
1021774199 7:24035904-24035926 GTGAAGATGAAGATGGGACAAGG + Intergenic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022260869 7:28703698-28703720 TAGAAGAAAAAGGTGGAGGAAGG - Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022486433 7:30782158-30782180 TTTCAGATGAAGATGCAGGATGG + Exonic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023531643 7:41162759-41162781 TTGAAGGTCAAAGTGGAGGAGGG + Intergenic
1023792226 7:43762114-43762136 TTGAGGAGGAACAAGGAGGAAGG + Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1025503244 7:61384232-61384254 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025504529 7:61406106-61406128 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025504853 7:61411574-61411596 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025508908 7:61480112-61480134 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025509392 7:61488322-61488344 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025511333 7:61521134-61521156 TTGAAGGTTATGGTGGAGGAGGG + Intergenic
1025870510 7:65428183-65428205 TTGCTGAGGATGATGGAGGAAGG - Intergenic
1026450545 7:70525546-70525568 TTTAGGGTGAATATGGAGGAAGG + Intronic
1026845125 7:73694389-73694411 GTCAAGATGAGGATGCAGGAAGG - Intronic
1027196662 7:76035266-76035288 GTGAAGATGAAACTGGAGGGAGG - Intronic
1027711963 7:81615463-81615485 TTGATGGTGGATATGGAGGATGG - Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028827995 7:95296424-95296446 TTGAAGGTGAAAATGGAAGAGGG - Intergenic
1029089383 7:98036276-98036298 CTGAAGATGGAGGTGGATGACGG - Intergenic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029969337 7:104773732-104773754 GTGAAGATGAAGGTGGAGATCGG + Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030015439 7:105215386-105215408 TTGATGATGAAAATGGAAAATGG + Intronic
1030202049 7:106915608-106915630 ATGATGATGATGATGGTGGAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030902675 7:115143935-115143957 TAGAAGATGAAAATGCAGGCTGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032658839 7:133961170-133961192 TTGAAGATGAGGAAGGAGCCAGG + Intronic
1033052657 7:138020590-138020612 ATGGAGCTGAAGTTGGAGGATGG - Intronic
1033157918 7:138972238-138972260 TTGAAGTGGAACATGGAGGAAGG - Intronic
1033557442 7:142500981-142501003 CAGAAGATGATGATGGAGCAGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033933562 7:146554578-146554600 TTGTACATGGAGATGAAGGATGG + Intronic
1034187933 7:149193793-149193815 AAGCTGATGAAGATGGAGGAGGG - Intergenic
1034194808 7:149238517-149238539 TTGAGTATTGAGATGGAGGATGG + Intergenic
1034455722 7:151168531-151168553 GGGAAGTTGGAGATGGAGGAGGG - Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035972737 8:4269359-4269381 ATGAAGATGAAAATGGAGCCAGG - Intronic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1037195103 8:16179334-16179356 TGGAGGAAGAGGATGGAGGAAGG - Intronic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037660812 8:20925198-20925220 TTCAAGATCAAGGTGGAGGCAGG + Intergenic
1038072322 8:24030776-24030798 GAGAAGATGAAGATGGATGCAGG + Intergenic
1038104144 8:24414523-24414545 TTGAAGATGCAGTTGAAAGAAGG - Intergenic
1038273044 8:26092328-26092350 TTGGAGTTGAGGATGGGGGAAGG - Intergenic
1038281854 8:26172967-26172989 TTGAAAATGAAGATGGAGTGGGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1038421862 8:27438728-27438750 TTCAAGCTGGAGATGGATGAAGG + Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038918966 8:32060966-32060988 ATGAAGATGAAGATAGGTGATGG - Intronic
1038950128 8:32404879-32404901 TTTAAGATGAAGATGAAGGCTGG - Intronic
1039378923 8:37066820-37066842 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1039555258 8:38470531-38470553 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039830299 8:41208094-41208116 TTGAGGATGAAGAAGGAGACAGG - Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1041699118 8:60768186-60768208 TCGAAAATGAAAATGGAGTAAGG - Intronic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042261187 8:66861016-66861038 TGGAGGCTGAAGTTGGAGGATGG + Exonic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043328816 8:79087331-79087353 TTGAAGATGAAAAGGAAGAAAGG - Intergenic
1043331721 8:79124711-79124733 GTGAAGGTGGAGATGGAGAAAGG + Intergenic
1043510202 8:80943615-80943637 TTGGACATGAAGAGGGAGCAAGG - Intergenic
1043731820 8:83693485-83693507 TTGAAGAAGAGGATGGCAGAGGG + Intergenic
1043772995 8:84228223-84228245 TGGGAGATGAGGGTGGAGGAGGG + Intronic
1043810529 8:84733422-84733444 TTGATGAGGTAGATGGATGAGGG - Intronic
1044260231 8:90110959-90110981 TTGAAGTTGAATATGTAGAAAGG + Intergenic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044716407 8:95103789-95103811 TTGGAGAAGAAGTTGGAGTAGGG + Intronic
1044741261 8:95328739-95328761 GTGAAGAAGAAGTTGAAGGATGG + Intergenic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1045607923 8:103799001-103799023 TTGAGTTTGAAGATGGGGGAAGG + Intronic
1045872233 8:106940009-106940031 TGGAAGAGGAAGATGGGGGAAGG - Intergenic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046030439 8:108776750-108776772 ATGATGATGATGATGAAGGAAGG + Intronic
1046458046 8:114494404-114494426 TTGATGAAAAAGTTGGAGGATGG - Intergenic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047668067 8:127114337-127114359 TGGAAGATGAAGATAGACTATGG - Intergenic
1047965685 8:130044932-130044954 TAGAAGAGGACGCTGGAGGAAGG - Intergenic
1048323576 8:133421467-133421489 TTGACTTTGAGGATGGAGGAAGG + Intergenic
1048619080 8:136111682-136111704 TAGAAGATGAGGTGGGAGGAGGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048731686 8:137448991-137449013 TTGATAAAGAGGATGGAGGAAGG + Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1049019852 8:139948605-139948627 TTGAAGGTGGAGGTGGAGGTAGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049350631 8:142162638-142162660 AGGGAGATGGAGATGGAGGATGG + Intergenic
1049350914 8:142164170-142164192 AGAGAGATGAAGATGGAGGATGG + Intergenic
1049958778 9:718415-718437 GGGAAGCTGAAGAGGGAGGATGG - Intronic
1050125536 9:2353021-2353043 TGCACTATGAAGATGGAGGAAGG - Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050340432 9:4632297-4632319 TTCAAGATGAAGCTGAAGGCCGG + Intronic
1050397176 9:5211215-5211237 TTGACGATGAAGAGGGATCATGG + Intergenic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1050785064 9:9390192-9390214 TGAAAGAGGAAGATGGAGGTGGG + Intronic
1050826165 9:9949470-9949492 ATCCACATGAAGATGGAGGAAGG - Intronic
1050914148 9:11109827-11109849 TTAAACATGAAGATGGAATAAGG + Intergenic
1051669263 9:19493885-19493907 TTCAACATGGAGATGCAGGAAGG + Intergenic
1051711643 9:19936376-19936398 TGGAGGCTGAAGAAGGAGGATGG - Intergenic
1051730592 9:20138925-20138947 TTGAAGATGAAGTTGAAATAAGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054850739 9:69843986-69844008 TTAAAAATGTAGATGGAAGAAGG - Intronic
1054924424 9:70575182-70575204 TTTAAAATGAGGAGGGAGGATGG - Intronic
1054973622 9:71117449-71117471 TTGAATATTAAAATGGAAGAAGG - Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055097690 9:72430809-72430831 TTGAGGATGAAGAGGGAGATGGG - Intergenic
1055164842 9:73178627-73178649 CTGAAGCTGAAAATGGAGGATGG + Intergenic
1055314513 9:75020560-75020582 TTGAAAATGAAAATGAAGGCTGG - Intronic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055443908 9:76363878-76363900 TTGAAAAAGAGGATGGAGGCAGG + Intergenic
1055467066 9:76576410-76576432 ATGAGGATGAAGGTGGGGGAAGG + Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056719100 9:89058265-89058287 TGGAAGATGGTGGTGGAGGACGG + Intronic
1056719143 9:89058441-89058463 TGGAGGATGATGGTGGAGGATGG + Intronic
1056760333 9:89409964-89409986 TTAAGGATAAAAATGGAGGAGGG + Intronic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1057138227 9:92710130-92710152 CAGAAGATGAGGATGGGGGAGGG + Intergenic
1057472441 9:95369537-95369559 TAGAAATTGAAGGTGGAGGAAGG - Intergenic
1057521002 9:95760316-95760338 TTAAAAATGAAGATGCAGGTCGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1058242850 9:102587922-102587944 TTGAAGAAGAAAATAAAGGATGG - Intergenic
1058511579 9:105724336-105724358 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1058536951 9:105971273-105971295 CTGATGATGAAGATAGAGAAGGG + Intergenic
1058634242 9:107020929-107020951 TTAAGTATGAAGATGGAAGATGG + Intergenic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059678973 9:116567706-116567728 TTCACGAAGAAGATGAAGGAAGG + Intronic
1059799585 9:117736808-117736830 TAGAAAATGAATATGGAGCAAGG - Intergenic
1059803587 9:117774701-117774723 TTGCAGATGATGATGCAGTAAGG - Intergenic
1060679885 9:125553119-125553141 TGGAAGATGAGGAGTGAGGAGGG - Intronic
1060870352 9:127034928-127034950 TGGAAGTTGAACAGGGAGGAAGG - Intronic
1061511751 9:131065838-131065860 AAGATGATGATGATGGAGGAAGG + Intronic
1061980421 9:134100087-134100109 TTGAAGATATGGATGGAGGAAGG - Intergenic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1185596065 X:1307743-1307765 TTGAAGATCTAAATGGGGGAAGG - Intronic
1185815350 X:3150037-3150059 GTGAAGATGGAGATGGAGATTGG - Intergenic
1185856956 X:3544685-3544707 TTCAAGGTGATGATGGTGGAAGG + Intergenic
1186410714 X:9342603-9342625 TGGAAGACTAAGAGGGAGGAGGG - Intergenic
1187323300 X:18261613-18261635 TTGATGATGGGGATGGAGAAGGG - Intronic
1187683435 X:21792269-21792291 TTGCTGATGAAGATGGGGGTAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188095126 X:26011891-26011913 CTGGAGTTGAAAATGGAGGAAGG - Intergenic
1188222455 X:27557995-27558017 TTTAAGATGAAAGTGGAGGAGGG - Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189760919 X:44320736-44320758 TGAAACATGAAGATAGAGGATGG - Intronic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190246056 X:48691131-48691153 ATGAAGATGAAGATGATGAATGG + Exonic
1190485880 X:50924513-50924535 ATGCAGATGAACCTGGAGGATGG - Intergenic
1190487795 X:50945854-50945876 TTGAAGAGGATAATGGAGAAGGG - Intergenic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1192388480 X:70698846-70698868 TTGCATATCAAGATGGAGGTGGG + Intronic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193523469 X:82559682-82559704 TGGACAATGAAGATGGAGAAAGG - Intergenic
1193926375 X:87490735-87490757 ATGATGATGATGATGGAGGGAGG + Intergenic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1194776805 X:97975412-97975434 TTGAAGATGACGATGGAGTTTGG - Intergenic
1194807597 X:98348427-98348449 TTGAAGATGTGGGTGTAGGAAGG + Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195373572 X:104203373-104203395 TTGAACATGAAGGTAAAGGAGGG - Intergenic
1196765429 X:119237473-119237495 TGGAAGGTGAACAAGGAGGAAGG + Intronic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197423052 X:126262132-126262154 TTGAAGGTAAAGACGGGGGAGGG - Intergenic
1197734370 X:129839868-129839890 TTGAAGATAGGGCTGGAGGAGGG - Intronic
1197865103 X:131009190-131009212 TGGAAGATGAAGGGGGAGCAAGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1198530365 X:137546144-137546166 TTGAAGATATAGATGGGGCAGGG + Intergenic
1198952455 X:142087131-142087153 TTGGCGTTGAAGATGGAGGAGGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199550582 X:149057037-149057059 TTAAGGAAGTAGATGGAGGAGGG - Intergenic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199804381 X:151283291-151283313 ATGAGGATGAATATGCAGGAAGG - Intergenic
1199824445 X:151484480-151484502 GTGGAGTTGAAGGTGGAGGACGG - Intergenic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1199860924 X:151799996-151800018 TGGAAGAGGAAGGGGGAGGAAGG - Intergenic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200102436 X:153694713-153694735 TTGAAGATGAAGATGCCCTACGG - Exonic
1200807278 Y:7445777-7445799 TTCAACATGATGATGGTGGAAGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201265948 Y:12206689-12206711 GTGAAGATGGAGATGGAGATCGG + Intergenic
1201557845 Y:15283252-15283274 ATGACCATGAAGAGGGAGGAAGG + Intergenic