ID: 1179073761

View in Genome Browser
Species Human (GRCh38)
Location 21:38098700-38098722
Sequence CAGGAAAGGGAGTAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 1, 2: 3, 3: 86, 4: 852}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179073761_1179073767 5 Left 1179073761 21:38098700-38098722 CCTGCCTCCTACTCCCTTTCCTG 0: 1
1: 1
2: 3
3: 86
4: 852
Right 1179073767 21:38098728-38098750 AGCCTCCCCAACCCATTTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 202
1179073761_1179073772 14 Left 1179073761 21:38098700-38098722 CCTGCCTCCTACTCCCTTTCCTG 0: 1
1: 1
2: 3
3: 86
4: 852
Right 1179073772 21:38098737-38098759 AACCCATTTCCTGGAAGCCATGG 0: 1
1: 0
2: 0
3: 26
4: 218
1179073761_1179073776 30 Left 1179073761 21:38098700-38098722 CCTGCCTCCTACTCCCTTTCCTG 0: 1
1: 1
2: 3
3: 86
4: 852
Right 1179073776 21:38098753-38098775 GCCATGGTCCTTGTTGACTATGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179073761 Original CRISPR CAGGAAAGGGAGTAGGAGGC AGG (reversed) Intronic
900086679 1:901809-901831 TAGGAAAGGGAGGAGCAGGTGGG - Intergenic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900559175 1:3295222-3295244 CAGGAAAGGCATCAGGTGGCGGG + Intronic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901489987 1:9591770-9591792 CAGGAGAGTGAGTGGGAGGGGGG - Intronic
901508379 1:9700990-9701012 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
902222849 1:14977801-14977823 CAGGCAAGCGAGTGAGAGGCTGG - Intronic
902490849 1:16779403-16779425 GAGGAAGGGGAGGAGGAGGGGGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902803537 1:18846431-18846453 CAGGAACAGGAGTGGGAGACTGG - Intronic
902959950 1:19956232-19956254 GAGGAAAGGGAGTTGCAGGAGGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903610164 1:24605603-24605625 CAGGAAAATGAGGACGAGGCGGG + Exonic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903828884 1:26163192-26163214 CAGGAAAGGGAGGCAGTGGCAGG - Intergenic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903953737 1:27011285-27011307 AAGCCAAGGTAGTAGGAGGCAGG + Intronic
904135882 1:28312241-28312263 CAGGAAGGGGAGGCAGAGGCAGG - Intergenic
904560649 1:31395039-31395061 CAGGAAAAGAAGTAGCAGCCCGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905066701 1:35191065-35191087 GAAGAAAGGGAGTAGGAAGTAGG - Intronic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906179629 1:43807118-43807140 CAAGAAGTGAAGTAGGAGGCTGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192178 1:43905502-43905524 CAGGAAGGGGAACAGGAGGACGG - Intronic
906192237 1:43905718-43905740 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192357 1:43906153-43906175 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192369 1:43906189-43906211 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906306851 1:44724997-44725019 CAGGAAAGGGAACAGGAAGGTGG - Intronic
906478178 1:46183837-46183859 CCAGAAAGGAAATAGGAGGCTGG + Intronic
906487813 1:46245322-46245344 CAGGAAACAGAGTTTGAGGCAGG - Intergenic
906674950 1:47686925-47686947 CAGGACTGGGACTAGGAGGATGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907038777 1:51239155-51239177 TAAGAAAGGGGATAGGAGGCAGG - Intronic
907086104 1:51676155-51676177 CAGAAAAGGAATTAAGAGGCCGG + Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907391861 1:54163393-54163415 CAGCAAAGGGGGTAGGAAGAGGG - Intronic
907962582 1:59297052-59297074 GAGGAAGGGGAGGAGGAGGCAGG - Exonic
908682573 1:66678715-66678737 CGGGAAGGGGAGGAGGAGGGAGG + Intronic
908699794 1:66886778-66886800 CAGGGAAGGGAGTAGGGGCAGGG - Intronic
909798471 1:79774664-79774686 CAGGAAAGAGAGGAGGGGGGAGG + Intergenic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
911773551 1:101778504-101778526 CAGGAAGGGTAGTAGGGGCCTGG - Intergenic
911846708 1:102762058-102762080 CAGATAAGGGAGTATGAGTCAGG - Intergenic
912410950 1:109480420-109480442 AAGTAAGGGGATTAGGAGGCAGG - Exonic
912510533 1:110186911-110186933 CCAGAAAGTGAGTAGGAGGAAGG + Intronic
912601079 1:110933949-110933971 GAGGAAAGGGAATAGTAGGAGGG + Intergenic
912884630 1:113457300-113457322 CAGGAAAGGAATTTGGAGGAGGG + Intronic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
915013901 1:152715147-152715169 CAGGAATGGCAGGAGGAAGCAGG + Intergenic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
916044674 1:160990552-160990574 TAGGAAAGGGATTAGAATGCAGG - Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917448247 1:175124807-175124829 AAGGAAGGGGAGAAGGAGGTAGG - Intronic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
917730614 1:177871341-177871363 AAGGAAAGAGAGTAGGGGGGTGG + Intergenic
917914907 1:179691992-179692014 TAAGGAAGGGAGTAGGAGGGGGG + Intergenic
919515317 1:198515012-198515034 GAGGAAAGAGAGTAGGTGGCCGG + Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919853134 1:201687340-201687362 AAGGAAAGGAGGTGGGAGGCTGG - Intronic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920098660 1:203502882-203502904 AAGCAAAGAGTGTAGGAGGCTGG - Intronic
920307951 1:205031054-205031076 CAGGAAAGGGGGAAGGAGAGAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
922550897 1:226493687-226493709 AAGGAAGGGGAGTAAGAGGATGG - Intergenic
923529595 1:234803132-234803154 GAGGAAGGGGAGGAGGAGGGGGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063687520 10:8252305-8252327 CAGGGAAGGAAATAGAAGGCAGG - Intergenic
1064126597 10:12666904-12666926 CAGGTAAGGCAGTAGGGAGCAGG + Intronic
1064161448 10:12950088-12950110 CAGGAAAGGGAATGGGAGGCTGG - Intronic
1064217206 10:13410246-13410268 CAGGCATGTGCGTAGGAGGCAGG + Intergenic
1064883302 10:20081277-20081299 CAGGGAGGGGAATAGGAAGCAGG + Intronic
1064934914 10:20668881-20668903 CAGGAGAGGGAGTGTGAAGCGGG - Intergenic
1065000106 10:21330720-21330742 CAGGAAAGGGATCAGGATGAGGG + Intergenic
1065077714 10:22097841-22097863 TAGAAAAGGTAGTAAGAGGCTGG - Intergenic
1065334157 10:24638159-24638181 AAGGAAAGTGAGCAAGAGGCCGG - Intronic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1065550414 10:26863804-26863826 GAGGAACAGGAGTAGGAGGAAGG + Intergenic
1065813866 10:29467258-29467280 CTGGAAAGGGGATAAGAGGCCGG + Intronic
1066540283 10:36439019-36439041 CAGGAATGGGAGGCTGAGGCAGG + Intergenic
1068629216 10:59282942-59282964 CAGGAAAGGAAGTAGCAGTATGG + Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069663681 10:70140297-70140319 CAGGAAAGGGTGTGGGCAGCAGG - Intronic
1069818506 10:71213320-71213342 CTGGAAGGGGTGTAGGAGTCAGG + Intronic
1069819148 10:71216984-71217006 CAGGAAAGGGCAGAGGGGGCTGG + Intronic
1069940382 10:71951449-71951471 CAGGAAGGGAAGGAGGAGTCTGG + Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070557907 10:77543811-77543833 TAAGAAAGGGGGTAGGAGGTAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072578589 10:96720940-96720962 CAGGAAGGGGAAGAGGAGGAGGG + Intergenic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073680543 10:105698878-105698900 CAGGGAGGGGAGTGGGAGGCAGG - Intergenic
1073690912 10:105808627-105808649 CGGGAACGGGAGTAGGGGGATGG - Intergenic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074569341 10:114610519-114610541 AAAGAAAGGGAGTAGGAGGTGGG - Intronic
1074718206 10:116240227-116240249 CCATAATGGGAGTAGGAGGCTGG - Intronic
1074776800 10:116773136-116773158 GAGGAAAAGGAGTGGGAGGAAGG - Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1074827998 10:117228495-117228517 AAGGAAGGGGAGAAGGAGGGAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075351100 10:121725969-121725991 CAGGGAAGGGAGTAGCACCCAGG + Intergenic
1075444051 10:122501522-122501544 CAGGGAAGGAAGTTGGAGGGTGG - Intronic
1075670393 10:124260451-124260473 CAGGAAAGGGCTCAGGAAGCTGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076193402 10:128498534-128498556 CAGCAAAGGGAGTGGAAGGGAGG + Intergenic
1076991168 11:276010-276032 CAGGAAAGAGAGTAGGGGAACGG - Intergenic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077076199 11:703297-703319 CAGGAGTGGGAGCAGGAGCCAGG + Exonic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078339974 11:10491667-10491689 GAGGGAAGGGAGTAGTAGGAAGG + Intronic
1078786451 11:14499433-14499455 GAGGAAGGGGAGGAGGAAGCGGG - Intronic
1078809447 11:14743537-14743559 CTGGAAAGGGAGTTGAAGCCAGG - Intronic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079158310 11:17969489-17969511 CAGAAAAGCTAGTAGTAGGCTGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079334441 11:19558960-19558982 CAGGCAAGGCGGTAAGAGGCTGG - Intronic
1079645549 11:22860444-22860466 CAGGACAGGCAGTAGGCGTCAGG - Intergenic
1079861123 11:25672522-25672544 GGGGAAAGGGAGAAGGAAGCAGG + Intergenic
1079996946 11:27305019-27305041 CATGAATAGCAGTAGGAGGCAGG + Intergenic
1080393686 11:31871159-31871181 CAGGGAAGGGAGTGGGAGAAAGG - Intronic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1081569033 11:44278336-44278358 CAGGGGAGGGAGTAGAGGGCAGG - Intronic
1081979458 11:47257549-47257571 GAGGCAAGGGAGGAGGAGGGAGG + Intronic
1082821080 11:57545131-57545153 TAAGAAAGGGACAAGGAGGCCGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083339374 11:61949156-61949178 CAGGAAAGGGAGGATGAGAGTGG + Intergenic
1083883388 11:65558988-65559010 AAGGAAAGGGGGGAGGTGGCAGG - Intergenic
1084191412 11:67500612-67500634 CAGGAAAGGCAGTGGGCGGGGGG - Intronic
1084266897 11:68009826-68009848 CAGGCAAGGTGGTAGGAGGAGGG + Intronic
1084572634 11:69968762-69968784 CACGAAAGAGAGGTGGAGGCTGG - Intergenic
1084731709 11:71077794-71077816 CAGGAAAGGGAATGGGAGCTGGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085603404 11:77875909-77875931 TGGGACAGGGAGTATGAGGCTGG + Intronic
1086598658 11:88606149-88606171 CAGCACAGAGAGTAGGAGGTAGG + Intronic
1086694053 11:89823119-89823141 AAAGAAATGGAGTGGGAGGCAGG + Intergenic
1086744740 11:90410885-90410907 GGGGAAAAGGAGTAAGAGGCTGG + Intergenic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1087019685 11:93589642-93589664 CAGGCCAGGGAGTGGGAGGTGGG + Intergenic
1087313739 11:96581297-96581319 CAGAAAAGGGAGTGAGAGCCAGG + Intergenic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088423200 11:109671152-109671174 CTGCAAAGGGAGTACGAGGGAGG - Intergenic
1088969580 11:114761178-114761200 CAGGAAAGGCAGTAGGTGTCAGG - Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089470506 11:118716588-118716610 AAAAAAAGGGAGTAGAAGGCCGG - Intergenic
1089655631 11:119944667-119944689 AAGGGAGGGGAGTAGGAGGAAGG + Intergenic
1089667966 11:120032349-120032371 CAGGAAAGGGACGATGAGGGAGG - Intergenic
1089707705 11:120292482-120292504 AAGGAGAGGGTGTGGGAGGCGGG - Intronic
1090079510 11:123602587-123602609 GAGGAAGGGGAGAAGGTGGCAGG - Intronic
1090532899 11:127609614-127609636 CAGGAAAGGGCGTAGGTGAGAGG + Intergenic
1090537837 11:127664188-127664210 CAGGGAAGGGAGTAGCGGTCAGG + Intergenic
1090881030 11:130831497-130831519 CAGGAAAGGGACCCAGAGGCTGG + Intergenic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091145424 11:133275110-133275132 CAGCAAAGGGGGTGGGAGGCTGG + Intronic
1091271361 11:134313898-134313920 CAGGAAAGAGAATATGAGCCAGG - Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092139495 12:6173091-6173113 CAGGAAAGAGAGTGTGAGGGGGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092240238 12:6831637-6831659 CTGGAAAGGGTGTAGGGGGTGGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092703233 12:11256509-11256531 CTGGAAAGGGAGTTGAAGCCAGG + Intergenic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1095832358 12:46601553-46601575 CAGGAAAGGGGGCTGAAGGCAGG - Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096582181 12:52592731-52592753 CAGGCAAGGGACTTGGAGGGAGG + Intronic
1096602843 12:52742460-52742482 CATGAATGGCAGTGGGAGGCAGG + Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096813809 12:54188931-54188953 CAGGTGAGGAAGTAGGGGGCTGG - Exonic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1099315458 12:81078033-81078055 GAGGGAAGGGAGTAGGGGGCGGG - Exonic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1101847682 12:108375655-108375677 GAGCAAAGGGAGTGGAAGGCGGG + Intergenic
1102164646 12:110796676-110796698 CAAGAGAGGGAGTAGGGAGCAGG + Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102457943 12:113082371-113082393 GGGGAAGGGGAGTAGGAGGAAGG + Intronic
1102624054 12:114220409-114220431 AAGGAAAGAGAGTAGGAAGATGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103172309 12:118832232-118832254 CAGGAAAGTGTGTGGGAGGCAGG - Intergenic
1103316791 12:120062693-120062715 GAAGGAAGGGAATAGGAGGCAGG - Intronic
1103556273 12:121768617-121768639 CAGGACTGGGAGGTGGAGGCTGG - Intronic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1104092055 12:125525731-125525753 CTGGGAAGGAAGCAGGAGGCAGG - Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104327542 12:127813396-127813418 CATGAAAGGGAGCAGAGGGCAGG + Intergenic
1104870502 12:131991881-131991903 AATGAAAGGGAGTAATAGGCGGG - Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106917711 13:34532856-34532878 GTGGAAAGGGGGTAGGAGGAAGG - Intergenic
1106921560 13:34569787-34569809 AAAGAAAGGGAGTAGAAGGATGG + Intergenic
1107303359 13:38991299-38991321 CTGGAAAGGGAGGAAGGGGCAGG - Intergenic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1108597789 13:51964372-51964394 CTGGGAAGGGAGTAAGAGGCAGG + Intronic
1109062711 13:57638375-57638397 TAGGAAAGAGAGGAGGAGGCTGG + Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1110019934 13:70457468-70457490 CTGGAAAGGGGGCTGGAGGCAGG + Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110318571 13:74135476-74135498 CGGGAGAGGGAGGAGGCGGCCGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110619399 13:77578325-77578347 CAAGAAAGGGAGGAGGGGGAAGG + Intronic
1112785592 13:102947883-102947905 CAGGCAGGGAAGTAGGAGGATGG + Intergenic
1113425151 13:110201393-110201415 AAGGAGGGGGAGTAGGAGGAGGG + Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1114042115 14:18688557-18688579 CAGGAAAGCGGGTTAGAGGCAGG + Intergenic
1114744416 14:25132563-25132585 CAGGAAAGTGAATAGGAGGCTGG + Intergenic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1115655449 14:35439284-35439306 GAGGAAAGGGAGGAGGGGCCAGG - Intergenic
1115731698 14:36276236-36276258 CAGGAAAAGGACTAGGACGTGGG - Intergenic
1117089413 14:52235348-52235370 CAAGAAAGGGAAGAGCAGGCTGG - Intergenic
1117903049 14:60555194-60555216 TAGGAAGGGGAGTGGGGGGCTGG + Intergenic
1118470703 14:66072750-66072772 CAGGTAAGGGAGGCTGAGGCAGG + Intergenic
1118634967 14:67739974-67739996 CAGGAATGGGGGTGGGAGGGTGG + Intronic
1118774719 14:68966630-68966652 ACAGAAAGGGAGCAGGAGGCAGG + Intronic
1118979124 14:70701783-70701805 GAGGAAGGGGAGGAGGAGGAAGG + Intergenic
1118979130 14:70701798-70701820 GAGGAAGGGGAGGAGGAGGAAGG + Intergenic
1119536920 14:75410152-75410174 CAGGGGTGGGAGTAGGAAGCAGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119937248 14:78603202-78603224 CAGGAAAGAGAGCAGCAGGTGGG - Intronic
1120301644 14:82714942-82714964 CAGGAAAGGGAGGGGATGGCAGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121523766 14:94604196-94604218 CAGGAAGGGGAGTAGGAAGGAGG - Intronic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1121705797 14:95992722-95992744 CAGGACAGGAAGGAGTAGGCAGG + Intergenic
1121901296 14:97695633-97695655 CAAGAAAGTGAGTAGCAGCCTGG - Intergenic
1122219158 14:100224642-100224664 GAGGAAAGGAAGTAGGAAGCAGG + Intergenic
1122363406 14:101180758-101180780 CAGGGAAGGGAGGTGCAGGCAGG - Intergenic
1122415735 14:101548693-101548715 CTGGAGAGGGAAGAGGAGGCGGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1125591601 15:40857679-40857701 CAGGAGAGGGACTAGGTTGCTGG + Exonic
1125966741 15:43880891-43880913 CTGCAATGGGAGGAGGAGGCTGG + Intronic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1127291955 15:57579109-57579131 CTGGAAGGGGAGGAGGAGTCAGG - Intergenic
1127530369 15:59837717-59837739 CAGGAAACAGAGTAGCTGGCAGG - Intergenic
1127844952 15:62861792-62861814 CAGGAAAGAGCGGAGGAGTCAGG - Intergenic
1128055703 15:64698652-64698674 CAAGAAAGGGACAAGTAGGCAGG - Intronic
1128391156 15:67183536-67183558 CAGTAGTGGGAATAGGAGGCAGG + Intronic
1128441666 15:67715168-67715190 CAGAAAAGGGAGTAAGAGCAGGG - Intronic
1128568138 15:68714656-68714678 CTGGAAAGGTAGTAGGAGGTGGG + Exonic
1128634559 15:69294701-69294723 TAGGAAAGGGAGTTAGAGGGAGG + Intergenic
1129675892 15:77632397-77632419 GAGGAAACGGAGGAGGGGGCTGG - Exonic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129991754 15:79971271-79971293 CACGAAAGTGACTAGGAGGAAGG - Exonic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130403972 15:83581580-83581602 AAGGAAAGGCAGTAGGGGCCTGG - Intronic
1130461390 15:84160086-84160108 CAGGCAAGGCAGGAGGTGGCCGG - Intergenic
1130473784 15:84246618-84246640 CAGGAACGGGAGGAGGGGGATGG - Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130788848 15:87130234-87130256 GAGGAAAGGGAGATGGAGGGAGG - Intergenic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131246630 15:90799881-90799903 GAGGAAGGGGAGAAGGAGGGGGG + Intronic
1131359768 15:91780301-91780323 CAGGAAAGGTATTTGGGGGCAGG + Intergenic
1131701631 15:94942991-94943013 GAGGAAAGGGAGGAGGGGGTGGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132647945 16:1007702-1007724 CAGGAGTGGGAGAAGGATGCGGG - Intergenic
1132677143 16:1125509-1125531 CAGGACTGGGAGTGGGAGCCTGG + Intergenic
1134005941 16:10818788-10818810 GAGGAATGGGAGTCGGGGGCGGG + Intronic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1134341523 16:13351204-13351226 TAGGTAAGGGACTAGGAGACTGG - Intergenic
1134392718 16:13834297-13834319 CAGGAAAGGGAAGAGAAGACAGG - Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135589495 16:23694982-23695004 AAGGACAGGGAGCGGGAGGCAGG + Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1136026391 16:27471643-27471665 CATGAAAGCGTGTAGGAGCCAGG - Intronic
1136630106 16:31484997-31485019 CAGGAAAGGGGGAATGAGACTGG + Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137444116 16:48521675-48521697 CAGGAAAGGGAGTACTAGAGAGG + Intergenic
1137624362 16:49898407-49898429 CAGGTGAGGGAGTCTGAGGCAGG - Intergenic
1137628830 16:49927835-49927857 GAGGGAAGGGAGGAGGAGTCGGG + Intergenic
1139318568 16:66094345-66094367 AAGGAAGGGGAGCAGAAGGCCGG - Intergenic
1139379189 16:66519878-66519900 CATGGAAGGAAGTAAGAGGCTGG + Intronic
1139384285 16:66554646-66554668 CAGGTAAGGGAGTGTAAGGCGGG + Intronic
1139853503 16:69964078-69964100 CAGGAAAGGGAATAGGTGGGTGG - Exonic
1139882474 16:70186987-70187009 CAGGAAAGGGAATAGGTGGGTGG - Exonic
1139946345 16:70644971-70644993 AGAGAAAGGGAGTAGGAGGAAGG + Intronic
1140370035 16:74408517-74408539 CAGGAAAGGGAATAGGTGGGTGG + Intronic
1140596310 16:76419160-76419182 CAGGAAAGACAGTAGCTGGCAGG - Intronic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141891772 16:86930920-86930942 GAGGAAAGGGAGGGGGAGGAGGG - Intergenic
1142135495 16:88450145-88450167 CCGGAAAGGGGAGAGGAGGCTGG + Intergenic
1142224681 16:88871754-88871776 CAGGAAAGGGAATGGGAGCCTGG + Intergenic
1142496360 17:308247-308269 TTGGAAAGGGAGTAGGGGACAGG + Intronic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142750623 17:1985357-1985379 GGGGACAGAGAGTAGGAGGCAGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1143012807 17:3875577-3875599 CAGGAAAGAGGTCAGGAGGCCGG - Intronic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143137696 17:4720874-4720896 GAGGGCAGGGAGTGGGAGGCTGG + Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143547133 17:7604131-7604153 CAAGAAAGGGATGAGGAGGCCGG + Intronic
1143723912 17:8832710-8832732 CAGGACCGGGACTAAGAGGCGGG - Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144612859 17:16739400-16739422 CAAGAAAGTGAAAAGGAGGCTGG - Intronic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1144899926 17:18576187-18576209 CAAGAAAGTGAAAAGGAGGCTGG + Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145132518 17:20369478-20369500 CAAGAAAGTGAAAAGGAGGCTGG - Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146162257 17:30566284-30566306 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146518460 17:33508070-33508092 GAGGAGAGGGAGGAGGAGTCAGG - Intronic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1146912697 17:36658504-36658526 CTGGAAGGGGTGGAGGAGGCTGG + Intergenic
1146942668 17:36854815-36854837 CAGCAAAGGGCATGGGAGGCAGG - Intergenic
1147051367 17:37797121-37797143 CAGGCAAGGGAAGGGGAGGCGGG + Intergenic
1147217537 17:38909309-38909331 CTGGAAAGTGAAGAGGAGGCTGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147366506 17:39962904-39962926 CAGGAAGTGGAGTGGGAGGGGGG + Intergenic
1147498764 17:40942347-40942369 GAGGAGGGGGAGGAGGAGGCGGG - Intergenic
1147578654 17:41616698-41616720 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148809373 17:50280329-50280351 CAGGAAGGTGAGGAGGTGGCAGG + Exonic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149347186 17:55750965-55750987 CAGGAAACTGAGGAGAAGGCGGG - Exonic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1149630535 17:58118472-58118494 CAGGAAGGGAACTAGGTGGCAGG + Intergenic
1149639993 17:58196496-58196518 CAGGAAAGGTTGCAGGAAGCTGG - Intronic
1150142534 17:62742434-62742456 CACAAAATGGAGTAGGAGCCAGG - Intronic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150479640 17:65499396-65499418 CGGGTTAGGGAGCAGGAGGCTGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152336712 17:79703097-79703119 GAGGAGAGGGAGGAGGAGGGGGG - Intergenic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152943332 17:83184268-83184290 AGGGAAAGGGGGTATGAGGCTGG - Intergenic
1153267703 18:3287178-3287200 TAGGAAGGGTAGTCGGAGGCAGG - Intergenic
1153507806 18:5820279-5820301 GAGGAAAGGGAGTAGAAGACTGG - Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155066648 18:22274109-22274131 GAGGAAGGGGAGGAGGAGGAAGG - Intergenic
1155527893 18:26735833-26735855 CAGGCAAGAGAGTAGGAGCAGGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156701862 18:39835503-39835525 TAGGAAAAGGAGTTGTAGGCAGG - Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1158217124 18:55111775-55111797 CAGGAGAGGGAGTAGGAAAGAGG + Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158416941 18:57256965-57256987 AGGGAAAGGGAGCAGGAGGCTGG + Intergenic
1158596689 18:58822859-58822881 CAGGGACTTGAGTAGGAGGCAGG + Intergenic
1159055548 18:63459657-63459679 CAGGCATGGGGGTAGGAGGATGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159330351 18:66986255-66986277 GAGGAAAGAGGGTAGGAGGAGGG + Intergenic
1159414357 18:68124972-68124994 AAGGAAATGCGGTAGGAGGCAGG + Intergenic
1159536237 18:69718500-69718522 CATGAAAGGAATTATGAGGCAGG + Intronic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160053383 18:75456936-75456958 CAGGAAAGGGGTCAGGAGCCAGG - Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160529237 18:79553879-79553901 CGGGAACGGGAGCGGGAGGCCGG - Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162096383 19:8312259-8312281 CAAGAAAGGAAGCAGGAGGGTGG + Intronic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162516155 19:11149081-11149103 CAGAAAAGGATATAGGAGGCTGG + Exonic
1162560954 19:11418192-11418214 CGGGAGAGGGAGTAGGGGACAGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1163114306 19:15180033-15180055 CAGGAGAGGGAAGAGGAGGTGGG - Intronic
1163160884 19:15463669-15463691 AAGGTAGGAGAGTAGGAGGCAGG + Intronic
1163162357 19:15472104-15472126 CAGGCAAGGGGGTTGAAGGCTGG + Intronic
1163190392 19:15673036-15673058 TAGGGAAGGCCGTAGGAGGCGGG - Exonic
1163520618 19:17789411-17789433 GAAGGAAGGAAGTAGGAGGCAGG + Intergenic
1163684027 19:18700437-18700459 CAGGAAAGGGAAGAGAAGGGCGG - Intronic
1164680398 19:30130738-30130760 GAGGAAAGGGAGAAGGAAGGGGG - Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1166356491 19:42230434-42230456 CAGGGAAGGGAAGAGGAGACGGG + Exonic
1166672423 19:44718931-44718953 AAGAGAAGGGAGTAGGAGGAGGG + Intergenic
1166747390 19:45147765-45147787 TAGGAAAGGGGGGAGCAGGCCGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167235054 19:48309200-48309222 CATGAATGGCAGCAGGAGGCAGG + Intronic
1167270187 19:48501971-48501993 CAGGAGAGGGAAGAGGAGCCAGG - Intronic
1167380684 19:49136298-49136320 CAAGAGAGGAAGTTGGAGGCCGG + Intronic
1167394476 19:49219008-49219030 GAGGAAAGGAGGCAGGAGGCTGG + Intergenic
1167444302 19:49528353-49528375 CAGGACAGGGAGTTGGAAGTTGG - Intronic
1167552487 19:50170482-50170504 TCGGACAGTGAGTAGGAGGCAGG + Intergenic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1168115540 19:54219926-54219948 CAGGACAGGGAGGTGAAGGCTGG + Intronic
1168201313 19:54817717-54817739 CAGGAAAGGGAATGAAAGGCCGG - Intronic
1168501151 19:56894632-56894654 CAGGAAAGGGAAAAGGACCCAGG - Intergenic
1168692522 19:58385694-58385716 CAGGGATGGGAGTAGGGGGCAGG + Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925203561 2:1988263-1988285 CAGGAATGGGAGGTGCAGGCGGG - Intronic
925449557 2:3957075-3957097 CGGGTAAGGGCGCAGGAGGCCGG - Intergenic
925828313 2:7872553-7872575 CAGGAAAAGGGGTAGAAGGGAGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
927510437 2:23641008-23641030 GAGGAAGGGGAGTAGGGGGCAGG - Intronic
927971511 2:27308444-27308466 CAGGAAAGCGAGAAGCCGGCTGG + Exonic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929345923 2:40884656-40884678 CAGGCAAGAGAGCATGAGGCAGG - Intergenic
929489576 2:42384349-42384371 GAGGAAAGGGGCTAGGAGGATGG - Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
930364641 2:50424152-50424174 GAGGAAGGGGAGGAGGAGGAGGG + Intronic
930473023 2:51844962-51844984 CATGGAAGGGTGTTGGAGGCTGG - Intergenic
930576203 2:53152149-53152171 TAGGGAAGGGAATAGGAGGGTGG - Intergenic
932742905 2:74305696-74305718 AAGAAAAGGGAGTTGGAGGGAGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933704076 2:85276984-85277006 CAGTAAAGGCCGTAGCAGGCCGG + Intronic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934768811 2:96895112-96895134 CGGGAAGGGGAGTGGAAGGCAGG - Intronic
935098579 2:99970673-99970695 TAGGAAAGGGAGGAGAAGGAGGG - Intronic
935244238 2:101204537-101204559 CAGGAATGGGAGGCTGAGGCAGG - Intronic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
936089028 2:109489089-109489111 CAGGCAGTGGAGTTGGAGGCTGG + Intronic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936477001 2:112848126-112848148 AAGGAAAGGAAGGAGGAGGGAGG - Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
938985558 2:136571982-136572004 CTGGAAAGGGAGGAAGGGGCCGG - Intergenic
939006433 2:136792789-136792811 CAGGATAGGCAGTAGGAGATAGG - Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939610024 2:144298706-144298728 CAGGAAAGGGAGGAGAGGTCAGG + Intronic
939619011 2:144395292-144395314 CAGAAAAGGGAATATGAGCCAGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942775119 2:179572050-179572072 CAGGAAATGTAGTTGGAGGTTGG + Intronic
943023512 2:182602048-182602070 CATGAATGGCAGCAGGAGGCAGG - Intergenic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
945040353 2:205738771-205738793 GAGGAGAGGGAGCAGCAGGCTGG + Intronic
945582603 2:211614270-211614292 TGGGAAAGGTAGTAGGGGGCTGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
947779160 2:232741962-232741984 CTGGAAAGAGAGTCGGAGGAAGG - Intronic
948124999 2:235558077-235558099 CGGGATGGCGAGTAGGAGGCTGG + Intronic
948332446 2:237180384-237180406 CAGGAAAGGGAATAGGACCCGGG - Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948502398 2:238405126-238405148 CTGGGAAGGGAGTAGGAGACAGG + Intergenic
948857183 2:240735619-240735641 CAGGAATTGGAGTAGGGGGTGGG - Intronic
1169000884 20:2167215-2167237 TAGGAAGGGGAGTAGGATACTGG + Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169060759 20:2658961-2658983 CAGGAATGGAAGGAGGAGCCAGG + Intronic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170614444 20:17937611-17937633 AAGGAAATGGAGCAGGAGACTGG - Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171016253 20:21544559-21544581 CAAGAGAGAGAGTAGGAGGGAGG + Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172334472 20:34102856-34102878 CAGGAAGGTGAATAGGAGGGAGG - Intronic
1172620616 20:36316177-36316199 CAGGAAATCAGGTAGGAGGCGGG - Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1174085385 20:48004427-48004449 CAGGAAAAGGAGTTCCAGGCAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174562163 20:51439156-51439178 CAGGAATGAGGGTAGGAGCCAGG - Intronic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1177354899 21:19995820-19995842 CAAGCAAGGGAGTAGCAGGCAGG + Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178096835 21:29224068-29224090 CAGGAAAGAGAGGAGCACGCAGG - Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178624181 21:34201931-34201953 CAGGGAGGGGAGTAGAGGGCGGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178885159 21:36479324-36479346 CAGGAAAGGAAGCTGCAGGCTGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179150651 21:38805879-38805901 CAGGAGCGGGAGGAGGAGGGAGG - Intronic
1179265319 21:39797814-39797836 CAGCAAAGGAAGTAGGGGTCAGG - Intronic
1179477769 21:41658887-41658909 GGGGAAAGGGAGAAGGAGACAGG + Intergenic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179831541 21:44000254-44000276 CAGGCATGGGAGAAAGAGGCAGG - Intergenic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180102376 21:45594901-45594923 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102408 21:45594998-45595020 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102421 21:45595031-45595053 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181130441 22:20728463-20728485 TAGGAAAAGGAGTAAGAGGCAGG - Intronic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182366249 22:29781347-29781369 AAGGGAAGAGAGTAGGAAGCTGG - Intergenic
1182691642 22:32168177-32168199 AAGGAAAGAGGGTATGAGGCTGG + Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183091662 22:35526397-35526419 CAGGAGGGGGAGTTGGATGCAGG - Intergenic
1183261964 22:36800936-36800958 AAGGAAAGTGAGTCAGAGGCGGG + Intronic
1183281667 22:36935751-36935773 CAGGAAGGGAAGGAGGAGGTGGG - Intronic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1183638932 22:39081768-39081790 CAGGAAAGCAGGTGGGAGGCAGG - Intronic
1184246968 22:43240748-43240770 CTGGATTGGGAGTGGGAGGCAGG - Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184281939 22:43442366-43442388 CAGGAAAGGGAGGAAGAGCGAGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184665662 22:45987624-45987646 CATGAATGGCAGCAGGAGGCAGG + Intergenic
1184682596 22:46080147-46080169 CGGGAGAGGGAGGAGGAAGCCGG - Intronic
1184882293 22:47316219-47316241 GAGGAGAGGGAGGGGGAGGCTGG - Intergenic
1184953670 22:47864754-47864776 CAGGAAAGGAAATAGAAGGCTGG + Intergenic
1185098545 22:48825252-48825274 CAGAGAAGGGAGTGAGAGGCAGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1185416126 22:50711575-50711597 GAGTAAAGGGAGTAAGAGGCAGG - Intergenic
949935016 3:9109857-9109879 CAGGAGAGGGAGGAGCAGGTAGG + Intronic
950706261 3:14784371-14784393 TAGGGAAGGGAGAAAGAGGCAGG - Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
952161096 3:30694111-30694133 TAGGAATGGGAACAGGAGGCAGG - Exonic
952314685 3:32222357-32222379 TAGGCAAGGGGGCAGGAGGCAGG - Intergenic
952883686 3:38000409-38000431 GAGGGAAGGGAGGAGGAGGTGGG + Intronic
952902363 3:38118690-38118712 CAGGAGGGGAAGTAGGAGACAGG - Intronic
952962975 3:38604358-38604380 TGGGCAAGGGAGAAGGAGGCAGG + Intronic
953121275 3:40045119-40045141 AAGGAAAAGGTGTGGGAGGCAGG - Intronic
953782952 3:45887615-45887637 CAGGAAAGGGAGTAAGGAGATGG - Intronic
954004587 3:47580628-47580650 CAGGAAGGGAAGGAGGAGGTAGG - Exonic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
954666077 3:52253165-52253187 TAGGAAAGGGGGTCTGAGGCTGG - Intergenic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
955011561 3:55021370-55021392 GAGGAAAGGGAGCAAGAGGGAGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955833578 3:63029787-63029809 AAGGAAGGAGAGTAGGAGGAGGG - Intergenic
955975186 3:64473445-64473467 TAGGAAAGGGATTAGGAAGGAGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
957467071 3:80608065-80608087 AAGGAAGGGGAGTGGGAGGGAGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958851655 3:99333759-99333781 CAGGACAGGATGTAGAAGGCTGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959588187 3:108046151-108046173 GGGGAAGGGGAGTACGAGGCAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960681924 3:120257523-120257545 TTGGAAAGGGAGTGGGAGGTGGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961030581 3:123600054-123600076 TAGGAAGGGGAGGAGGAGGAAGG - Intergenic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961602974 3:128075381-128075403 CCGGAAAGGGAACAGGAGGCAGG + Intronic
962056473 3:131877029-131877051 AAGGCAAGGGAGAAGGATGCCGG - Intronic
962090889 3:132243003-132243025 CAGGATACGGGGTAGGAGGAGGG - Intronic
962263403 3:133928797-133928819 CAGGAGAGGCAGTCGGATGCAGG - Exonic
962433058 3:135338287-135338309 CAAGAATGGGAGTCGGAGCCGGG - Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
962674362 3:137743509-137743531 AAGGAAAGGGAGTAGATGCCTGG + Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
963112101 3:141696399-141696421 CAGTAAAGGGAGTTAGAGGTGGG + Intergenic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963199894 3:142575370-142575392 CAGGAAAGGGAGGCTGAGACAGG + Intronic
963234952 3:142947366-142947388 GAGGAGAGGGAGTAGGCGCCGGG - Intergenic
963353698 3:144183759-144183781 CAGGAGAGGGAGTAGGCTGAAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
964675121 3:159269528-159269550 TTGGAAAGGGAGTGGGAGCCTGG + Intronic
965409028 3:168306488-168306510 CAGGAAGGGGAGTAAGGGGATGG + Intergenic
965505374 3:169509504-169509526 GAGGAAATGGGGGAGGAGGCAGG - Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968889174 4:3358922-3358944 GAGGAAGGGGAGGAGGAGGGGGG - Intronic
968938902 4:3627876-3627898 CAGGAAAGGAGCTGGGAGGCAGG - Intergenic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969480398 4:7443889-7443911 CAGGCCAGGGAGGTGGAGGCTGG - Intronic
969756304 4:9152778-9152800 CAGGGAAGGGCTCAGGAGGCGGG - Intergenic
969936517 4:10687517-10687539 CAGGAAAGGGAAGAGGAGGGAGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970001193 4:11367760-11367782 CAGGAAGGGGAAGAGGAGGGAGG - Intergenic
970436093 4:16036978-16037000 AAGGAAAGAGAGCAGGAGCCAGG + Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971625955 4:28920470-28920492 GAGGAAAGCAAGTAGGAGTCAGG + Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
973870139 4:55158028-55158050 CAGGAAAGGCGGTGGGAGACGGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
975546726 4:75568032-75568054 CAGGAAACAAAGTAGGAAGCAGG - Intergenic
975649304 4:76576498-76576520 TGGGAAGGGTAGTAGGAGGCTGG + Intronic
975826612 4:78326435-78326457 CAGGTAGGGGAGTAGGATGTGGG + Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976081130 4:81356126-81356148 AAGGAAAGGGTGGAGGAGACAGG + Intergenic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
978420134 4:108523454-108523476 CAGGAAAGAGACTCGGAAGCAGG + Intergenic
978823852 4:112996893-112996915 TGGGAAAGGTAGTAGGGGGCTGG - Intronic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980774108 4:137417013-137417035 CAAAAAAGTGCGTAGGAGGCTGG + Intergenic
981027863 4:140094764-140094786 CAGGAAAGGAGGAAGGAAGCGGG - Intronic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
983022251 4:162692261-162692283 AAGGAAAGAGAGTAAGAGGGGGG - Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
985425802 4:189828906-189828928 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425809 4:189828951-189828973 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985748089 5:1658991-1659013 CAGGCAAGAGAGCAGGTGGCTGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
987920577 5:24274872-24274894 CTGGGAAGGGGGTAGGGGGCTGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988485566 5:31665641-31665663 CAGGAAAGGGAGGGGGGGGAGGG - Intronic
990312221 5:54550949-54550971 CAGGAATGGGAATGGGGGGCAGG + Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990503359 5:56419743-56419765 CAGAAAAGAGAATAGGAAGCAGG - Intergenic
990557883 5:56952724-56952746 CAGGAATGGGAGATGGAGACCGG + Intronic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
992390562 5:76327136-76327158 TAGGAAGGGGAGGGGGAGGCAGG - Exonic
992790211 5:80206768-80206790 TAGGAAAGGGTTCAGGAGGCAGG - Intronic
993196757 5:84758344-84758366 CAGGATAGGGACTAGGTGGGAGG + Intergenic
993495666 5:88605898-88605920 CAGAAAAGGGAGTACTGGGCAGG - Intergenic
994868662 5:105315445-105315467 CAGAAAAGGGAGTTAGAGGGAGG - Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995438161 5:112160685-112160707 CACCAAAGGGAGGAGGAGCCTGG - Intronic
995542719 5:113200435-113200457 CAGGAAGGGGATCAGCAGGCAGG - Intronic
995760437 5:115556248-115556270 CAGGAATGGGAGAAGAAAGCAGG - Intergenic
995825987 5:116300001-116300023 CATGAAAGAGAGTAAGAAGCTGG - Intronic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
998002203 5:138634250-138634272 TAGGAAAGAGGGGAGGAGGCCGG + Intronic
998058739 5:139102625-139102647 AAGGAATGGGAGGAGGGGGCTGG - Intronic
998192758 5:140041850-140041872 CAGGAGAGGAAGGAGGGGGCGGG + Intronic
998359607 5:141573725-141573747 CAGGCAAGGGAGGAGGTGGGGGG + Exonic
998407861 5:141883944-141883966 AAGGAAAGAGAGGAGGAGGGAGG - Intergenic
998660131 5:144227402-144227424 CTGGTAAGGGAGGAAGAGGCTGG + Intronic
998765983 5:145487827-145487849 CAAGAAATGGAATTGGAGGCCGG + Intronic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
999386307 5:151156661-151156683 AGGGAAAGGAAGGAGGAGGCAGG + Intronic
999409734 5:151340225-151340247 GAGGAAGGGGAGGAGGAGGAGGG + Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999649108 5:153748270-153748292 CCTGAAGGGTAGTAGGAGGCAGG + Intronic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999881021 5:155864001-155864023 GAGGAATGGGAGTGGGAGGCTGG + Intergenic
1000872917 5:166599749-166599771 CATGAAAGGAAGTTGGATGCTGG + Intergenic
1001612978 5:173018424-173018446 GTGGAAAGGGAGGTGGAGGCAGG + Intronic
1002010016 5:176271570-176271592 TAGGAAGGGGAGTAGGGGGTTGG + Intronic
1002135730 5:177106307-177106329 CAGGAGGGGAAGTAGGTGGCTGG + Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002209499 5:177588678-177588700 AAGGCCAGCGAGTAGGAGGCGGG - Intergenic
1002216718 5:177640734-177640756 TAGGAAGGGGAGTAGGGGGTTGG - Intergenic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002434884 5:179225154-179225176 CATGAGAGGGAGGAGGAGCCTGG - Intronic
1002460773 5:179372506-179372528 GGGGAAGGGGAGCAGGAGGCCGG + Intergenic
1002978421 6:2109930-2109952 CAGGAAAGTAAGGAGCAGGCAGG - Intronic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005641241 6:27798512-27798534 CAGGAAAGGGGATAGGGAGCTGG - Intergenic
1005656878 6:27947670-27947692 CATGAAAGAGAGTTGGAAGCAGG - Intergenic
1005819074 6:29582329-29582351 CAGGAATGGGAGTGGCTGGCAGG - Intronic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1006151598 6:31992935-31992957 AAGGAAGGGGAGTGGGTGGCGGG + Intronic
1006157899 6:32025673-32025695 AAGGAAGGGGAGTGGGTGGCGGG + Intronic
1006362183 6:33592868-33592890 GAGGAAAGGCTGTAGGGGGCGGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006413741 6:33891352-33891374 CAGGAAAGAGGGTATCAGGCTGG - Intergenic
1006442358 6:34060438-34060460 CGGGAAGTGGGGTAGGAGGCGGG - Intronic
1006902564 6:37512642-37512664 GAGGAAAGGCGGGAGGAGGCTGG - Intergenic
1007546527 6:42698711-42698733 CTGGAAAGGGAGGAGGAGAGGGG - Intronic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1007766613 6:44164327-44164349 CAGGATAGGGAGTAGGGGAGGGG + Intronic
1008042527 6:46816881-46816903 CAGGAAGGTGAGCAGGAGCCTGG + Intronic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008525691 6:52404636-52404658 CTGGAAAGTAAGTAGGTGGCTGG + Exonic
1009589760 6:65652400-65652422 GAGGATAGGGAGGAGGAGACAGG + Intronic
1010371630 6:75116577-75116599 GATGAAAGTGAGTAGGGGGCTGG - Intronic
1010766609 6:79782414-79782436 CAGGTGTGGGAGTTGGAGGCTGG + Intergenic
1011104915 6:83768826-83768848 CAGTGATGGGAGTAGGAGGTTGG - Intergenic
1011890161 6:92148873-92148895 CATGAAAGGGAGTATGAGAGAGG + Intergenic
1012345379 6:98179290-98179312 CAGGAAGGGGAACAGGAGACAGG + Intergenic
1012642487 6:101636876-101636898 AAGGAAAGGCTGTAGGGGGCAGG - Intronic
1012889906 6:104885888-104885910 CATGAACGGCAGCAGGAGGCAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013940996 6:115662443-115662465 CAGGCACTGGAGTAGGAGCCAGG + Intergenic
1014168638 6:118253501-118253523 CAGGAAAGGAAGTAAGAGGTGGG + Intronic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1015149646 6:130022374-130022396 CAGGAAGGAGAGTATGAGACTGG + Intronic
1015189523 6:130457672-130457694 CAGGAAGGGGAGTATGCTGCAGG + Intergenic
1015366454 6:132401764-132401786 AAAGAAAGGGAGGAGGAGGCAGG + Intergenic
1015552997 6:134431551-134431573 CAGGAAAGGGAATGGGGGGTGGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1016724638 6:147348360-147348382 GGGGACAGGGAGTAGGAGGAAGG - Intronic
1017332344 6:153214534-153214556 CAGGAATGAGAGCAGCAGGCTGG + Intergenic
1017364979 6:153625286-153625308 CAGGGAAGGGAGTCGTGGGCAGG - Intergenic
1017770057 6:157638087-157638109 GAGGAGAGGGAGGTGGAGGCAGG + Intronic
1018381342 6:163260732-163260754 CAGGAGAGGAAGTTGGAGACAGG - Intronic
1018894485 6:168004204-168004226 CAGGAAAGGAAGTGGGTGGGAGG + Intronic
1018955991 6:168410916-168410938 CAGGAAAGGAGGTGGGGGGCCGG - Intergenic
1018989563 6:168663157-168663179 TAGGAAAGGGATGAGGATGCTGG + Intronic
1019290302 7:247009-247031 AAGGAAAGAGGGAAGGAGGCAGG + Intronic
1019316225 7:388212-388234 CAGGAAAGGAAGTCGGTGGCTGG - Intergenic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019404883 7:877857-877879 GAGGAAGGGGAGGGGGAGGCCGG - Intronic
1020152852 7:5696897-5696919 CTTGAAAGGGAGTGGGAGGGAGG - Intronic
1022093351 7:27122682-27122704 GAGGGAAGGGAGTTGGAGGCCGG + Intronic
1022253208 7:28629321-28629343 AAGGAAAGGGAGGAGGTGGAAGG - Intronic
1022319422 7:29274923-29274945 GAGGAAAGGGTGTGGGAGGAGGG + Intronic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1024340254 7:48250383-48250405 CAGGTAAGGGAATGGGAGGAGGG + Intronic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025207911 7:57004082-57004104 GAGGAGGGGGAGGAGGAGGCCGG - Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026363495 7:69624931-69624953 CAAGAAAGGGGGTGGGGGGCGGG - Intronic
1026792856 7:73346102-73346124 GAGGAAAGGAAGTAGCAGGAGGG + Intronic
1027591821 7:80127881-80127903 GAGGACTGGGAGTAGGAGGCAGG - Intergenic
1028339543 7:89701632-89701654 CGGGAAGTGTAGTAGGAGGCTGG + Intergenic
1028812684 7:95105964-95105986 TATGAAAGAGAGTATGAGGCTGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1030229687 7:107194722-107194744 CAGGGAAGGAAGTAGGAGCTAGG + Intronic
1030266472 7:107627032-107627054 AAGGAAAGAGAGTAGAAGGATGG - Intronic
1030272356 7:107684356-107684378 CAGGAAAGGGAGTGGAGGGGAGG + Intronic
1030272512 7:107685613-107685635 CAGGAAAGGGAGTAGAGGGAAGG - Intronic
1030605072 7:111632137-111632159 AATGAAAGGAAATAGGAGGCTGG - Intergenic
1031106499 7:117549824-117549846 GAAGAAAGGAAGTAGGAGGAAGG + Intronic
1031515525 7:122693657-122693679 TATAAAAGGGAGTAAGAGGCTGG + Intronic
1032066338 7:128774359-128774381 CAGCAAAGGAAGTAGGAGGAGGG - Intronic
1032208771 7:129892546-129892568 CAAGAAAGGGTGTAGTTGGCTGG - Intronic
1032504546 7:132425498-132425520 GAGGAAGGGGAGGAGGAGCCAGG - Intronic
1032505150 7:132428737-132428759 CAGGGAATGGAGTGGGAGGTAGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033251788 7:139766968-139766990 GAGGAGAGGAAGTCGGAGGCTGG + Intronic
1033485208 7:141782274-141782296 CAGGAAAGGGAGGGGTATGCGGG - Intronic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1033862997 7:145652314-145652336 CAGGAAAAAGAGTACGAGACAGG - Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034835717 7:154350214-154350236 TAGGAAGGGGAGAAGGAAGCAGG + Intronic
1035099648 7:156385966-156385988 CAAGAAAAGGAGTAAAAGGCAGG + Intergenic
1035374647 7:158399878-158399900 CAGCAAGGGGAGTGGGAAGCGGG + Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035970744 8:4245409-4245431 ATGCAAAGGGAGGAGGAGGCAGG + Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1037552064 8:19984437-19984459 CAGGTAAGGAAGGAGCAGGCTGG + Intergenic
1037642523 8:20760382-20760404 GGGGTAAGGGAGTAGGCGGCCGG - Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1038428601 8:27481754-27481776 CAGGAATTAGAGCAGGAGGCTGG - Intergenic
1038528645 8:28298276-28298298 CAGATAAGGCAGTAAGAGGCTGG - Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039600035 8:38828703-38828725 CAGGAAAGGGGGCAGGAGAGGGG + Intronic
1039846504 8:41329559-41329581 CAGGAAGGGGAGTGAGAGGCTGG + Intergenic
1041762817 8:61385086-61385108 GAGGAAAGGGAGCAGGAGCATGG + Intronic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042922810 8:73936395-73936417 CAGGAATGAGAGTAGGAGTGGGG - Intergenic
1043166971 8:76915340-76915362 CAGGAAGGAGAGTGGGATGCTGG - Intergenic
1043269300 8:78309822-78309844 CAGGTAAGGGAGTGGGAGGAGGG - Intergenic
1043519263 8:81026664-81026686 CAGGAAAGGAACAAGCAGGCAGG + Intronic
1043950250 8:86300856-86300878 AAGGAAAGGGAGGAGGAAGAAGG + Intronic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1044776334 8:95692919-95692941 GAGGGAAGGGAATGGGAGGCAGG + Intergenic
1045343028 8:101271087-101271109 CAGGAAAGGGACGAGCAGGGAGG + Intergenic
1045439917 8:102199001-102199023 CAGGAAAGGATGTAGGAGCAGGG + Intergenic
1046388830 8:113541008-113541030 AAGGATAGGGAGTGGGAGGTTGG - Intergenic
1047026192 8:120827047-120827069 TAGGAAAGGAAGAAAGAGGCAGG - Intergenic
1047499372 8:125430123-125430145 GGGGAGAGGGAGTAGGAGGTGGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047835783 8:128689149-128689171 GAGGAAATGGAGTAGGAAGCTGG + Intergenic
1047887664 8:129270453-129270475 CAGGTATGAAAGTAGGAGGCAGG - Intergenic
1048007582 8:130431856-130431878 GAGGAAAGGGAGGAGTAGGAGGG + Intronic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048391030 8:133964658-133964680 GAGGAAAGGGAGAAGGAAGGAGG - Intergenic
1048515735 8:135108974-135108996 TAGGAAGGGTAGTAGGGGGCTGG - Intergenic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049122033 8:140747676-140747698 AAGGAAGGGGAGGAGGAGGAGGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049672578 8:143876522-143876544 AAGGGAAGGGAGGAGGAAGCAGG - Intronic
1050042532 9:1511143-1511165 TAGGAAAGGGAACTGGAGGCTGG - Intergenic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1051759021 9:20439586-20439608 CAGGAAGGGGAGTGGGGGGATGG + Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1054451841 9:65407444-65407466 CAGGAAAGGAGCTGGGAGGCAGG + Intergenic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055094515 9:72398045-72398067 CTGAAAAGTGAGTAAGAGGCTGG + Intergenic
1055204876 9:73716753-73716775 CAAGAAAGGGAATAGGAAACAGG - Intergenic
1055861618 9:80756980-80757002 AAGGTAAGGGAGAAGCAGGCAGG + Intergenic
1056221421 9:84453759-84453781 CAGGAAAGGGAGACTGAGACAGG - Intergenic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1057004714 9:91547060-91547082 CAGGAAAAGGAGTCAGGGGCAGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058881879 9:109292515-109292537 CATGAATGGGAATGGGAGGCAGG + Intronic
1059324755 9:113497441-113497463 CAGGAAAGGAGGGAGGGGGCAGG - Intronic
1059740660 9:117146307-117146329 CAGGAAAGGGAGGGAGAGGAGGG + Intronic
1060047822 9:120354419-120354441 CAGGAAATGGAGTGGGACCCAGG + Intergenic
1060190453 9:121589057-121589079 CTGGGGAGTGAGTAGGAGGCAGG - Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060442683 9:123656223-123656245 CAGGGAAGAGAGTGAGAGGCAGG + Intronic
1060484662 9:124039572-124039594 AAGGCAGGGGAGGAGGAGGCAGG + Intergenic
1060515222 9:124261384-124261406 CAAGCAAGGGAGTTGGAGGGTGG + Intronic
1060801772 9:126549589-126549611 CAAGAGAGGGACTGGGAGGCTGG - Intergenic
1061038218 9:128125203-128125225 CAGGAAAGGAGGAAGGATGCAGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061498406 9:130989001-130989023 CAGGAAGGGCAGGAGGTGGCTGG - Intergenic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061936606 9:133861195-133861217 CAGGAAGGGGTGTGGGGGGCGGG - Intronic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062342219 9:136098828-136098850 CAGAAAGGGAAGTAGCAGGCGGG + Intergenic
1062432288 9:136531596-136531618 AAGGAAGGGGAGCGGGAGGCTGG - Intronic
1062585523 9:137247753-137247775 CAGGGAAGGGAGCTGGATGCCGG - Exonic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1186386596 X:9116283-9116305 CAGGAATTGGAGGAGTAGGCTGG - Intronic
1186473776 X:9841467-9841489 TAGGAAGGGAAGGAGGAGGCAGG + Intronic
1187048854 X:15675961-15675983 GAGGAATGGGAGTGGGAGGCTGG + Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187637628 X:21249320-21249342 CAGGACAGGGATGAGGAGGGAGG + Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187827574 X:23347200-23347222 CAGGGAAGGGAATAGAAGACAGG + Intronic
1187865223 X:23717585-23717607 TGGGAAAGGAAGCAGGAGGCTGG + Intronic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188666234 X:32824590-32824612 CAGGAATGGGAGTAAGATGTGGG + Intronic
1188681539 X:33014193-33014215 CTGTAAAGGGAGTAGGATGTTGG - Intronic
1189084047 X:38001440-38001462 CAGGAAGGGTAGTAGGGTGCTGG - Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189716716 X:43874593-43874615 AAGGAAAGTTAGTAGGAGGGGGG - Intronic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190758936 X:53423777-53423799 CAGGAAAGTGAGGAAGTGGCTGG + Intronic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192299135 X:69881839-69881861 CAAGAAAGGGAGTAAGAGAGAGG + Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192848107 X:74925912-74925934 CAGGAACGCGAGTGGGGGGCGGG - Intergenic
1194068388 X:89289258-89289280 AAGGGAAGGAATTAGGAGGCAGG + Intergenic
1195068002 X:101254792-101254814 CAGGAGAGGGAGGAGGAAACAGG + Intronic
1195266520 X:103186123-103186145 GAGGGGAGGGAGTCGGAGGCTGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1195747822 X:108136359-108136381 AAGGAAAGGGAGAAATAGGCAGG + Intronic
1195909164 X:109872076-109872098 TGGGAGAGGGAGGAGGAGGCAGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196407710 X:115382435-115382457 CAGGAAGGGTAGTGGGAGGTTGG + Intergenic
1197190609 X:123643244-123643266 CAGGAAAGGAGGTTGGATGCAGG + Intronic
1197366644 X:125572132-125572154 CAGGAAAGGGAGAATGAAGGGGG + Intergenic
1197611331 X:128642355-128642377 GAGGATAGGGAGTAGAAAGCAGG + Intergenic
1197655702 X:129114001-129114023 CAGGGAGGTGAGTGGGAGGCTGG - Intergenic
1198112407 X:133513514-133513536 CTGGAAAGGGAGGAGGAAGGAGG + Intergenic
1198185461 X:134250040-134250062 AAAGCATGGGAGTAGGAGGCAGG + Intergenic
1198691981 X:139294369-139294391 AGGCAAAGGCAGTAGGAGGCAGG + Intergenic
1199218402 X:145288497-145288519 CAGGAAGGGGAGGCTGAGGCAGG - Intergenic
1199882534 X:151986022-151986044 GAGCAAAGGGAGGAGAAGGCTGG - Intergenic
1200019180 X:153187858-153187880 AAGGAAGGGGAGTCTGAGGCAGG - Intergenic
1200093471 X:153646761-153646783 CACGGAGGGGAGGAGGAGGCAGG - Intronic
1200259336 X:154603868-154603890 GAGGAAAGGGAGGAGGAGAACGG - Intergenic
1200722531 Y:6623427-6623449 AAGGGAAGGAATTAGGAGGCAGG + Intergenic