ID: 1179076481

View in Genome Browser
Species Human (GRCh38)
Location 21:38127028-38127050
Sequence GCTTATTACCTAGCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179076481 Original CRISPR GCTTATTACCTAGCAAAGAC AGG (reversed) Intronic
908832675 1:68194794-68194816 GCTTGGTACCTAGCAGAGAATGG + Intronic
909748311 1:79126885-79126907 GATTATTACCTATCAAAAAATGG - Intergenic
909805820 1:79873233-79873255 TCTTATTACATAGCAAAGAAGGG + Intergenic
912568071 1:110603059-110603081 GCTTATGAACTTCCAAAGACGGG - Exonic
914809690 1:151017887-151017909 GCTTTTTACCTAGCAAAGGTGGG + Exonic
916424427 1:164667242-164667264 GCTCATTGCCATGCAAAGACAGG - Intronic
921086517 1:211798924-211798946 GCTGACTACCTAGAAAAGAGAGG + Intronic
921337783 1:214105861-214105883 GCTTATTATGTAGGAAAAACTGG + Intergenic
922856932 1:228783495-228783517 GCTTATTACTTCCCAACGACGGG + Intergenic
923821849 1:237452643-237452665 TATTATTACCTAACAAATACAGG - Intronic
924018593 1:239755561-239755583 GCCTATAACCTAGCAAGGAAAGG + Intronic
1065131332 10:22623034-22623056 GCATATTACCTAGCAAACACCGG + Intronic
1065557727 10:26933348-26933370 GCATATTACCCAGCTAGGACAGG - Intergenic
1066633321 10:37478021-37478043 CCTTTTAACCTAGCAAAGAAAGG + Intergenic
1067679191 10:48416930-48416952 GCTTCTTACCTATAAAAGATTGG + Intronic
1069449931 10:68508836-68508858 AATGATTACCTAGCAGAGACAGG + Intronic
1072221776 10:93333212-93333234 GTATATTACCTGCCAAAGACTGG + Exonic
1077820425 11:5732798-5732820 GATTATTATTTAGCAAAGAGAGG - Intronic
1086320856 11:85646363-85646385 GCTTATTTTTTAGTAAAGACAGG - Intergenic
1087525331 11:99303495-99303517 GCTTGTGACCTACCAAAGATAGG + Intronic
1091007766 11:131968995-131969017 GTTTATTACAGAGCAAATACAGG + Intronic
1091503333 12:1040721-1040743 GCCTATTACGTAGAAAAGACTGG - Intronic
1102804183 12:115764735-115764757 GCTTAATACCTGGAAATGACAGG - Intergenic
1103177229 12:118875088-118875110 GCTGCTTAACTAGCAGAGACTGG + Intergenic
1108696068 13:52903602-52903624 GCATCGTACCTAGCACAGACAGG + Intergenic
1110346334 13:74451899-74451921 CCTAAGTACCTAGCAAAGACTGG + Intergenic
1113003669 13:105674447-105674469 GCTTATTTCATAGAAAAAACTGG - Intergenic
1113294624 13:108944912-108944934 TATTATGACCTAGCAAAAACTGG - Intronic
1116499542 14:45604096-45604118 TCTTTTTACCAAGCAGAGACAGG - Intergenic
1116863511 14:50013171-50013193 GTTTACTACCTAGCAAAGTATGG + Intergenic
1116866666 14:50037017-50037039 GCTATGTACCTAGCAAAAACTGG + Intergenic
1117390091 14:55254607-55254629 GCTTATTACCTATAAAAGAAAGG + Intergenic
1117999775 14:61511953-61511975 GTTTATTACCTAGATCAGACAGG + Intronic
1130577697 15:85106977-85106999 GCTGGTCACCTAGGAAAGACAGG + Intronic
1138761925 16:59554830-59554852 ACTTGTTCACTAGCAAAGACAGG - Intergenic
1139640156 16:68285775-68285797 GCTCATCACCAAGCAAAGAGGGG - Intronic
1142631115 17:1227484-1227506 ACTTATTCCTTAGCAAAGATTGG - Intronic
1144248839 17:13395453-13395475 CCTTAACATCTAGCAAAGACTGG + Intergenic
1153950041 18:10050801-10050823 GCTTATAAAATAGCAAAGCCTGG + Intergenic
1156856558 18:41789010-41789032 ACTTAAAACCAAGCAAAGACTGG + Intergenic
1156882054 18:42092558-42092580 GCTTGTAACCTAGCAAATTCAGG + Intergenic
1162597829 19:11642412-11642434 GCTTGTCACCTTGCAAAGATTGG + Intergenic
926161912 2:10495282-10495304 GCTTATGTCCATGCAAAGACTGG - Intergenic
927806156 2:26148623-26148645 GCTTCTATCCTAGCAGAGACAGG - Intergenic
929429735 2:41877179-41877201 TCTTATTACATAGCAAATGCTGG + Intergenic
929749009 2:44690636-44690658 ACTTACTACCTGGCAAACACTGG - Intronic
929789430 2:45012574-45012596 GCTTTTTATCCAGCAAAAACGGG + Intergenic
931012759 2:57936331-57936353 GCATTTTACCTAGCAAATAATGG + Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932143660 2:69300378-69300400 GCTTTATACCTTGCCAAGACGGG - Intergenic
932168816 2:69534822-69534844 GATTATTACCTACCAAAGGTTGG - Intronic
933797781 2:85934509-85934531 GATTATTACTTAACAATGACCGG + Intergenic
939703085 2:145419025-145419047 TCTTATTTCATAGGAAAGACTGG - Intergenic
940706395 2:157109707-157109729 TCTAATTATCTAGCAAGGACAGG - Intergenic
941549039 2:166890927-166890949 GCTGAGTACCTAGCACAAACAGG + Intronic
1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG + Intergenic
1177590116 21:23152931-23152953 TTTTATTACCTAGCAAATAAGGG - Intergenic
1179076481 21:38127028-38127050 GCTTATTACCTAGCAAAGACAGG - Intronic
951084965 3:18501568-18501590 ACTTATTAGCTGGCAAAGTCTGG + Intergenic
952161536 3:30698460-30698482 TCTTAGCACCTAGCAAAGAGTGG + Intergenic
954337380 3:49927533-49927555 GCTTCTGACCTTGCAAAGCCAGG + Intronic
959027681 3:101259529-101259551 GCTTGGTACCTAGCACAGAGAGG + Intronic
959113923 3:102153297-102153319 TCATATCACCTAGCAAAGTCTGG + Intronic
963517706 3:146329057-146329079 CCTTAGTACTTAGGAAAGACTGG + Intergenic
974029411 4:56762714-56762736 GCCTATCACCAAGCAAAGGCAGG + Intergenic
995552984 5:113298902-113298924 GCTTATTCCCTTGCATTGACAGG - Intronic
997132012 5:131286505-131286527 CCTTATTACCTAGTAAACAGAGG - Intronic
1002642621 5:180637499-180637521 GATGATTGCATAGCAAAGACTGG - Intronic
1008335007 6:50292693-50292715 TCTTACTACCTTGCAAAGGCTGG - Intergenic
1010975445 6:82307336-82307358 GCTTATTGCCCAGCAAGGACAGG - Intergenic
1011861044 6:91756956-91756978 GCCTATTAAATAGCTAAGACTGG + Intergenic
1014639987 6:123897697-123897719 GCTTACTACCAAGCAATGTCTGG + Intronic
1021000263 7:15320661-15320683 GCTTATATCCCAGGAAAGACAGG - Intronic
1029922987 7:104286287-104286309 GCTTTTTCCCAAGCAAACACAGG - Intergenic
1031114916 7:117656990-117657012 CCTTATTACCCAACAAACACAGG + Intronic
1036949359 8:13126217-13126239 ACTTATTACCCAGCAAAAAGAGG + Intronic
1040618977 8:49068086-49068108 CCTTATTACCAGGCAAAGAAGGG + Intronic
1059773987 9:117456238-117456260 GCTTTTGACATAGCAATGACTGG - Intergenic
1189249831 X:39592132-39592154 GCTTAATGCCTACCAAAGGCGGG - Intergenic
1194775077 X:97953188-97953210 GCTTGTTACCAAGCAAAAGCAGG + Intergenic
1198919943 X:141714302-141714324 GATGATTACCTAACAGAGACAGG + Intergenic