ID: 1179078533

View in Genome Browser
Species Human (GRCh38)
Location 21:38147704-38147726
Sequence CTGCTGTCATAGAACAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179078533 Original CRISPR CTGCTGTCATAGAACAAAAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901117460 1:6859434-6859456 CTTCTGTCCTAGAACATAACTGG - Intronic
903646791 1:24901065-24901087 TTGCTTTCAGAGCACAAAACAGG + Exonic
904480217 1:30788621-30788643 GTGCTGGCATTGAACAAAAAAGG - Intergenic
905819364 1:40978128-40978150 CTGCTTCTAGAGAACAAAACAGG + Intergenic
907532661 1:55116834-55116856 CTGGTGTCATAGAATAAGTCAGG - Intronic
907592071 1:55684900-55684922 CAGATTTCATAAAACAAAACAGG + Intergenic
909095272 1:71278802-71278824 TTGCAGCCATAGAAGAAAACAGG - Intergenic
910503326 1:87919767-87919789 CAGCTCTCACAGAACTAAACAGG - Intergenic
914711539 1:150218478-150218500 CAGCAGTCACAGAAAAAAACAGG + Exonic
914717323 1:150263639-150263661 CTGCTGTAAGAGAAGAAAATGGG - Exonic
915035247 1:152918184-152918206 CTGATGGCATAGAAGAAAGCTGG + Intergenic
916680074 1:167095688-167095710 CTTCTGTCATAAATCATAACAGG + Intronic
919773619 1:201178977-201178999 CTGCTGTAACAGAACACCACAGG - Intergenic
920703565 1:208235680-208235702 CTGGTGTCAAAGAATCAAACAGG - Intronic
923445235 1:234064521-234064543 CGGCTGTCACATAACACAACTGG + Intronic
923721529 1:236471102-236471124 ATTTTGTCATAGAATAAAACTGG - Intronic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1064634976 10:17356341-17356363 TTGTTGTCATAGAAGAGAACAGG - Intronic
1065112174 10:22451293-22451315 CTGCTTCCTTAGAACAAAATTGG + Intronic
1065236507 10:23657909-23657931 CTGCTGTGGCAGAACAAAAATGG - Intergenic
1069072074 10:63999132-63999154 CTGCTGCCAGAGAACAAAGTTGG + Intergenic
1069246921 10:66218197-66218219 CTACTGTTCTAGAAAAAAACAGG - Intronic
1069326969 10:67243042-67243064 TTGCTGTCATCTAAGAAAACAGG - Intronic
1070732889 10:78843620-78843642 ACGCTGTCACTGAACAAAACAGG - Intergenic
1072135188 10:92538418-92538440 CTGCCGTCATAGGACAGCACCGG - Intronic
1072604091 10:96963906-96963928 CAAGTGTCATACAACAAAACAGG + Intronic
1072729926 10:97839031-97839053 CTTCTGTCACTGAAGAAAACAGG + Intergenic
1073791448 10:106944133-106944155 CACCTGGCAAAGAACAAAACTGG - Intronic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1075869826 10:125763017-125763039 CTCTTGACAGAGAACAAAACAGG - Intronic
1076142910 10:128093764-128093786 CTGCTGTTAAAGAACAGAAGCGG - Intergenic
1076809200 10:132878069-132878091 CTGCTGTCATCAAAGAAACCTGG + Exonic
1078952358 11:16148576-16148598 CTGCAGTCAGAAAACAAAAAAGG + Intronic
1079304426 11:19309834-19309856 CTGCTGTTATACAAAAATACAGG + Intergenic
1079386523 11:19984780-19984802 CTGCTGTCAGGGAAGAAAAGAGG + Intronic
1083127381 11:60584643-60584665 TTGCTGTAATAGAACATCACAGG + Intergenic
1086597901 11:88595844-88595866 CTGCTTTCAAAGTACAAAAAAGG - Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG + Intergenic
1093557894 12:20499086-20499108 CTGATGTCAGAGCACACAACAGG - Intronic
1093651484 12:21650822-21650844 CTGCTGCCATGGAACATATCAGG + Intronic
1093675660 12:21936986-21937008 ATGCTTTCAAAGAACAAAAATGG + Intronic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1102540567 12:113616330-113616352 CTGCTTTCCTAGAAAAGAACTGG + Intergenic
1102967844 12:117141736-117141758 CTCCTTTCCTAGAACACAACTGG + Intergenic
1105053155 12:133073264-133073286 ATGCTATGATAAAACAAAACAGG + Intergenic
1106011337 13:25826628-25826650 CTGCTGTGGTAGAACCTAACTGG - Intronic
1107284578 13:38776326-38776348 CTGCTATAATAGAACAAGAAAGG - Intronic
1110542220 13:76719374-76719396 CTGGTCTCGTAGAAAAAAACAGG + Intergenic
1110581196 13:77129568-77129590 TTTCTGTCATAAAACAAATCTGG - Intronic
1113491955 13:110699213-110699235 CTGCTGTAACAGAACACCACAGG - Intronic
1116046332 14:39747763-39747785 CTGAAATCATAGAAAAAAACAGG - Intergenic
1116064604 14:39967103-39967125 CTGCTGGCTTAGCACAAAATAGG - Intergenic
1119364132 14:74077278-74077300 CTGCTTTCAGAGGACAAAAAAGG - Intronic
1119626655 14:76182882-76182904 AAGCTGTCATAGAAGACAACAGG + Intronic
1120399816 14:84016472-84016494 CTGCTTTCATTGAACAACACCGG - Intergenic
1122509956 14:102258408-102258430 GTGCTGTCAGTGAATAAAACAGG - Intronic
1123167183 14:106337116-106337138 CTGCTGACAAAAACCAAAACTGG + Intergenic
1124854478 15:33374026-33374048 ATGCTGTCAGAAAACAAAATTGG + Intronic
1126427589 15:48546310-48546332 CTGCTGTCATAGAGAATAATTGG + Intronic
1126495762 15:49289064-49289086 CTGCTATAATAGAAAAATACAGG - Intronic
1127774262 15:62253227-62253249 CGTCTGTCACAGAACAAAGCAGG + Intergenic
1134048651 16:11121297-11121319 CTGCTGAAATAGCAGAAAACTGG - Intronic
1134847674 16:17454450-17454472 GTGCTGTCATAGCACAAAAGCGG + Intronic
1138192865 16:55030888-55030910 TTGCTATGAAAGAACAAAACTGG - Intergenic
1139046576 16:63067522-63067544 TTTCTGTCAAAGAAGAAAACAGG + Intergenic
1142704583 17:1686485-1686507 CTGGTTTCATAGAAAAAAAGTGG + Intergenic
1144287772 17:13795076-13795098 CTGCTGTTGTTGGACAAAACTGG - Intergenic
1146749084 17:35361309-35361331 CTGCTGGCATAGAGCATAATGGG + Intronic
1146841641 17:36160487-36160509 CTTCTCCCATAGCACAAAACAGG + Intergenic
1146853951 17:36248447-36248469 CTTCTCCCATAGCACAAAACTGG + Intronic
1146866275 17:36337680-36337702 CTTCTCCCATAGCACAAAACTGG + Intronic
1146869857 17:36372339-36372361 CTTCTCCCATAGCACAAAACTGG + Intronic
1146877212 17:36423420-36423442 CTTCTCCCATAGCACAAAACTGG + Intronic
1147069145 17:37938292-37938314 CTTCTCCCATAGCACAAAACTGG + Intergenic
1147072736 17:37972963-37972985 CTTCTCCCATAGCACAAAACTGG + Intergenic
1147080673 17:38017829-38017851 CTTCTCCCATAGCACAAAACTGG + Intronic
1147084258 17:38052501-38052523 CTTCTCCCATAGCACAAAACTGG + Intronic
1147096616 17:38141789-38141811 CTTCTCCCATAGCACAAAACTGG + Intergenic
1147100206 17:38176467-38176489 CTTCTCCCATAGCACAAAACTGG + Intergenic
1149098416 17:52872651-52872673 GTGCTGTCTGAGAACAAAAGAGG - Intronic
1149857665 17:60096875-60096897 CTTCTCTCGTAGCACAAAACAGG - Intergenic
1150083150 17:62259512-62259534 CTTCTCCCATAGCACAAAACAGG + Intergenic
1153577095 18:6533174-6533196 CTCCTGTCATAAAAGAAAGCAGG + Intronic
1153669002 18:7392536-7392558 CTGCTGTAACAAAAAAAAACAGG - Intergenic
1154498752 18:14982808-14982830 CTGCTTTCATAGAATGAATCAGG - Intergenic
1155591438 18:27432256-27432278 GTGGTGACATGGAACAAAACTGG + Intergenic
1157637108 18:49169518-49169540 CTGCTTTCATAGAACACGTCTGG - Intronic
1161052816 19:2173801-2173823 CTGGTTTCATAAAACACAACCGG - Intronic
1161728772 19:5946189-5946211 CCTATGTGATAGAACAAAACAGG - Intronic
1167952888 19:53041824-53041846 CTACTGTCAAAGAACAAATTTGG + Intergenic
1168650185 19:58087499-58087521 CTGCTGTCACAGAAGCACACTGG - Intronic
925155724 2:1647915-1647937 CTCCTCTCTTGGAACAAAACAGG + Intronic
925749711 2:7076840-7076862 CTGCTGTCATAAACCATGACTGG - Intergenic
928300359 2:30118833-30118855 CTGCCATGATAGAACAAAAATGG + Intergenic
928747227 2:34429518-34429540 CAGCTGTGATTAAACAAAACTGG + Intergenic
930000735 2:46859956-46859978 CTTCTGTCATAGGACACAGCCGG + Intergenic
931226313 2:60334905-60334927 CTGCTGTCATGGAACAGCCCAGG + Intergenic
931848324 2:66228053-66228075 CTGCTGTAATAGAGCAGCACAGG - Intergenic
933570099 2:84000466-84000488 CTTGTGTCAGAGATCAAAACTGG - Intergenic
936001304 2:108832876-108832898 CTGCTGTTCTAGAACTATACTGG + Intronic
941885061 2:170519519-170519541 CTGCTGTCACAGAGAAAAATGGG + Exonic
941931943 2:170950598-170950620 ATGCTGTCACTGAACAAAAAGGG - Intronic
944347185 2:198683650-198683672 CTGCTGTTATAGATCATAAATGG - Intergenic
946298658 2:218807945-218807967 TTGCTTTCATAGAAAAATACTGG - Intronic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
947762024 2:232610170-232610192 CTGCTGTGATATAAACAAACAGG - Intronic
1169841284 20:9940668-9940690 CAGCTGCCATAGAACAAACCTGG - Intergenic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1173211763 20:41039293-41039315 CTGCTGTCATACAACATGAATGG + Intronic
1175235204 20:57505023-57505045 CTCTTGTTATAGAACCAAACTGG - Intronic
1177623305 21:23625404-23625426 CTCCTGTCATTGAACAAATTGGG + Intergenic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
1179121245 21:38548145-38548167 TTGCTGTCATTGAACAGCACAGG - Intronic
1182102304 22:27666698-27666720 CTGCTGCCATGGAACAAGCCTGG - Intergenic
1184011858 22:41754807-41754829 CTGCTGTCATAAATTGAAACAGG + Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
950890711 3:16401430-16401452 CAGTTGTCATAGTATAAAACAGG - Intronic
952376715 3:32773663-32773685 CTGCTGTGATACAACTAAAATGG - Exonic
952499712 3:33949347-33949369 CTGCTCTCTTACAGCAAAACAGG + Intergenic
955664700 3:61337960-61337982 ATGTTGTTATAGAACCAAACTGG + Intergenic
956516325 3:70052413-70052435 CTGCAATCATAGAAAAAAATGGG + Intergenic
958815310 3:98907819-98907841 CTTCTTTCACAGAATAAAACTGG - Intergenic
959715906 3:109432288-109432310 CTGTTGTTATAGAACTGAACTGG + Intergenic
961952187 3:130761848-130761870 CTGCTGTGATAGGACAGCACTGG - Intergenic
962842756 3:139251008-139251030 CTGCTGTCTTGGAACAGATCTGG - Intronic
963219378 3:142790428-142790450 TTGCACTCACAGAACAAAACAGG + Intronic
963834281 3:150040687-150040709 CAGCTGTCTGAGAACAAAATGGG - Intronic
965604042 3:170482265-170482287 CTGCTGTCAAAGAAACTAACAGG - Intronic
966054249 3:175663371-175663393 CTGCTGTCAAAGAAATAAAAAGG - Intronic
966142713 3:176773921-176773943 AAGCTATCCTAGAACAAAACTGG + Intergenic
967028812 3:185586951-185586973 CAGCTGTTTTGGAACAAAACAGG - Intronic
967627540 3:191703396-191703418 CTGCTGCCAGGGACCAAAACAGG + Intergenic
970395167 4:15657882-15657904 CTGCTGTCATACATCCAAAAAGG - Intronic
970597949 4:17617027-17617049 CTGCTCTGATAGAAGAAACCTGG + Intronic
978889080 4:113800605-113800627 CTGCTGTAACAAAATAAAACAGG - Intergenic
980957178 4:139441131-139441153 CAGCTGCTATAGAACAAACCTGG - Intergenic
981189502 4:141844603-141844625 CAGCTGGCAAAGAACAATACTGG + Intergenic
981941599 4:150287281-150287303 CTGCTGTCAGAAAACTAACCCGG + Intronic
983057825 4:163119636-163119658 GTGCTGTCATAGAAGATAGCTGG - Intronic
983118092 4:163844717-163844739 CTGTTATCATGGAACAAAATAGG - Intronic
983206510 4:164915976-164915998 CTCCTATCATAGGAAAAAACTGG + Intergenic
983212113 4:164969570-164969592 CTCCTATCATAGGAAAAAACTGG - Exonic
984885699 4:184447318-184447340 TTTCTGTCATTGAACAAAATTGG + Intronic
985184402 4:187300248-187300270 CTGATGTCATAACAGAAAACCGG + Intergenic
989815240 5:45728809-45728831 CTGCTGTGCTAGATCAAATCCGG + Intergenic
990396973 5:55392030-55392052 CTACTGTTAGAGAACCAAACTGG - Intronic
992952474 5:81874060-81874082 CTGCTGTCCCAGAACAAACAAGG + Intergenic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
994571438 5:101519400-101519422 ATGCTGTATTAGAAAAAAACAGG + Intergenic
995655051 5:114416992-114417014 CTCCTGTTTTTGAACAAAACTGG + Intronic
999218654 5:149957259-149957281 CTGCTGGTATAGAATAAACCTGG + Intergenic
999549301 5:152667591-152667613 CTTCAGTAATAGAACAAAGCTGG + Intergenic
999706918 5:154281984-154282006 CTGTTATTATAGCACAAAACAGG - Intronic
1001831036 5:174789598-174789620 CTGCTGTCATAGCACAAAAGTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003746248 6:9005730-9005752 TTGCTGTCATAGCACAGAGCAGG + Intergenic
1004761898 6:18676631-18676653 CTGCTGTCATCGCACAAAGATGG - Intergenic
1005820461 6:29594229-29594251 TTTCTGTTATAGAACCAAACTGG - Intronic
1008120097 6:47604362-47604384 TTGGTGTCATAGTTCAAAACTGG + Intronic
1011014696 6:82742196-82742218 CAGCTGCCAAAGAACAAAGCAGG - Intergenic
1012007355 6:93730135-93730157 CTGCTGTAATACCACAAAAAAGG + Intergenic
1012506053 6:99947662-99947684 CTGCTGTTATAAACCAAAACTGG + Intronic
1013841786 6:114404790-114404812 CTGTTGTCATAGACCCAAACTGG - Intergenic
1014242020 6:119028266-119028288 CTGCTGTTAAAGAACAGAACTGG - Intronic
1016680962 6:146828910-146828932 TTGCTGTTATCGAACAAAACTGG - Intergenic
1017432544 6:154385286-154385308 TTGCTGTTATACCACAAAACTGG - Intronic
1018489136 6:164273656-164273678 CTGCTGTCGTAGCACAAAAGTGG - Intergenic
1018847391 6:167565089-167565111 CTGCAGTCATAGAAGCAGACAGG - Intergenic
1023653507 7:42395546-42395568 CTGTTCTCAGAGAACAAAAAGGG - Intergenic
1023978873 7:45054269-45054291 CTTCTGTCGTACAACAAAAGGGG + Intronic
1025752074 7:64302508-64302530 GGGCTGTCATGGAACATAACAGG - Intergenic
1026601283 7:71779391-71779413 AGGCTGTCATTGAACAGAACTGG + Intergenic
1026995191 7:74611305-74611327 CTGCTTTTAAAAAACAAAACAGG + Intergenic
1028278181 7:88885350-88885372 CTTTTCTCATAGAACAATACCGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1032617784 7:133493669-133493691 CTTCTGTCAGAGAAGAAAACAGG - Intronic
1034356288 7:150453010-150453032 CTGGGGACACAGAACAAAACAGG + Intronic
1034706249 7:153147769-153147791 CTGCTGTAGAAGCACAAAACGGG + Intergenic
1035065185 7:156099249-156099271 CTCCTGTCTTAGCACAAAGCCGG + Intergenic
1035642093 8:1191580-1191602 CTTCTTACATAGAACAAGACAGG + Intergenic
1037873806 8:22526621-22526643 CTGTGGTCATAAAATAAAACAGG - Intronic
1038851038 8:31276588-31276610 CAGCTGTGATAGAACTACACCGG + Intergenic
1039058539 8:33555502-33555524 CTGTGGTCAAAGAACAGAACAGG - Intronic
1041537110 8:58939023-58939045 GTGCTGTCATAGAGTCAAACCGG - Intronic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1044997072 8:97847527-97847549 AAGATGCCATAGAACAAAACTGG - Intronic
1051698878 9:19797752-19797774 CTGATGTCCTAGAACAACTCTGG + Intergenic
1053361608 9:37491330-37491352 CTGCTTTGAGAGAATAAAACTGG - Intronic
1054725004 9:68641385-68641407 ATGGTGTCATAGAACAAATCAGG + Intergenic
1054784603 9:69199009-69199031 CAGCTGTCTAATAACAAAACAGG - Intronic
1059887218 9:118759469-118759491 CTGCTATAGTAGCACAAAACAGG - Intergenic
1062109818 9:134776028-134776050 CTGCTGTCAGAAATCAAACCAGG + Intronic
1186205491 X:7195879-7195901 CTTCTGTTATAAAACAGAACAGG - Intergenic
1186871126 X:13774625-13774647 CTGGTGGAAGAGAACAAAACAGG + Intronic
1186939701 X:14492054-14492076 CTGCTGTCATAGAAAGTAACAGG - Intergenic
1187424948 X:19168899-19168921 CTGCTGTCACAAAACACCACAGG - Intergenic
1188987761 X:36783076-36783098 GTGCAGTCATAGAACTAGACAGG + Intergenic
1193338439 X:80318370-80318392 CCGCTGGGAAAGAACAAAACAGG + Intergenic
1194435644 X:93865925-93865947 ATGCTGTCAAAGGACAAAATTGG - Intergenic
1194573103 X:95576620-95576642 ATGCTGTCATAAAAAAAAAGAGG - Intergenic
1194642113 X:96414596-96414618 CTTCTGTAATAAAACAAAATGGG + Intergenic
1199565222 X:149208659-149208681 CCACTGTAATAGAACATAACAGG + Intergenic
1201578200 Y:15483253-15483275 CTGCTGTTATAAAACAGAACAGG - Intergenic
1202056632 Y:20840618-20840640 ATACTGTAATAGAATAAAACTGG - Intergenic
1202067453 Y:20954895-20954917 CTGCTCTCATATAACAGAAGAGG - Intergenic