ID: 1179080937

View in Genome Browser
Species Human (GRCh38)
Location 21:38170168-38170190
Sequence CCACTTCCACTCCCATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179080928_1179080937 13 Left 1179080928 21:38170132-38170154 CCTGGTAGAAGCCCCCAGGCTGC 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177
1179080931_1179080937 0 Left 1179080931 21:38170145-38170167 CCCAGGCTGCAGCCCTGTTCTGC 0: 1
1: 0
2: 2
3: 66
4: 728
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177
1179080926_1179080937 21 Left 1179080926 21:38170124-38170146 CCAGCTGACCTGGTAGAAGCCCC 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177
1179080930_1179080937 1 Left 1179080930 21:38170144-38170166 CCCCAGGCTGCAGCCCTGTTCTG 0: 1
1: 1
2: 5
3: 46
4: 468
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177
1179080929_1179080937 2 Left 1179080929 21:38170143-38170165 CCCCCAGGCTGCAGCCCTGTTCT 0: 1
1: 0
2: 8
3: 47
4: 352
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177
1179080932_1179080937 -1 Left 1179080932 21:38170146-38170168 CCAGGCTGCAGCCCTGTTCTGCC 0: 1
1: 0
2: 1
3: 39
4: 429
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG 0: 1
1: 0
2: 0
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179080937 Original CRISPR CCACTTCCACTCCCATGCAT AGG Intronic
902258592 1:15207008-15207030 CAATTTCCAGTCCCATGCAGTGG - Intronic
902761128 1:18581423-18581445 CCACCTCCACTCCCAAGCTCTGG + Intergenic
904810325 1:33159616-33159638 CCACTCCCACTGCCCAGCATGGG + Intronic
905910289 1:41648745-41648767 TCACTTCCACTTCCATGCCTTGG - Intronic
907271933 1:53296396-53296418 CCACTTCCTCTCCCAGGCCTGGG + Intronic
907288511 1:53397421-53397443 CCTCCCCCACTCCCAGGCATTGG + Intergenic
907325624 1:53637105-53637127 CCACTTCCACTGCTGTGCACTGG + Intronic
908868234 1:68576472-68576494 CCACATTCATTCCCAGGCATCGG - Intergenic
910745733 1:90572405-90572427 CTATTTCCAATCCCATGCTTTGG - Intergenic
912576513 1:110676243-110676265 CCACCACCACTCCCAACCATGGG + Intergenic
913127784 1:115809248-115809270 CCTCTTCCACTACCATCTATAGG - Intergenic
916063961 1:161121217-161121239 CTACGCCCACTCCCATGCTTGGG - Exonic
916677254 1:167074426-167074448 CAACTTCAACTCCCAGACATGGG + Intronic
916875763 1:168966829-168966851 CCACTTCCACCCCCTTCTATTGG + Intergenic
917523204 1:175765002-175765024 TCACTTCCACTCATATTCATTGG + Intergenic
920992194 1:210950151-210950173 CCACTTGCCCTCCCCTGCCTGGG - Intronic
921215771 1:212935594-212935616 CCACTTCTACTTCCATCCCTTGG + Intergenic
921759073 1:218891147-218891169 CCACTTCCACGTACATGAATGGG - Intergenic
921888650 1:220331725-220331747 CATCTTCCATTCCCTTGCATTGG - Intergenic
922427692 1:225514777-225514799 CCTCCTCCACTCCCATCCACCGG - Exonic
924510751 1:244727607-244727629 CCACCTCCACCCCCAAGCTTAGG - Intergenic
924846933 1:247783661-247783683 CCACTTCCACTTCCACCCCTTGG + Intergenic
1064499889 10:15959445-15959467 CGACTTTAACTCCAATGCATTGG - Intergenic
1065995225 10:31053375-31053397 TCACATCCACTCACATTCATTGG + Intergenic
1069901807 10:71710752-71710774 CCACCTCCAGGCCCTTGCATGGG - Intronic
1072610386 10:97013937-97013959 CCCCTTCCACTCCCGAGCATGGG + Intronic
1073261953 10:102197161-102197183 CCACTTCCAATCCAATGACTTGG - Intergenic
1073440095 10:103547458-103547480 CCACTTCTGCTCCCATGCCCTGG - Intronic
1074932431 10:118142711-118142733 CCACTTCCTCTTCCATGTGTGGG + Intergenic
1077499187 11:2901664-2901686 CCACTTCCCCACCCTTGCAGGGG - Intronic
1078876526 11:15403943-15403965 TCACTCCCCCTCCCATGCACTGG + Intergenic
1079671155 11:23172977-23172999 TCATTTCCACTCTCATCCATAGG - Intergenic
1079728173 11:23903542-23903564 CCACTACCCTTCCCAGGCATTGG - Intergenic
1080004917 11:27396623-27396645 CCACTTCCCATTCCATGCCTGGG + Intronic
1080413772 11:32050795-32050817 CCCTTTCCACACCCATGGATAGG + Intronic
1080918896 11:36688830-36688852 CCACTTCTAATTCCCTGCATGGG - Intergenic
1084586758 11:70066910-70066932 CCACTCCCAGGCCCATGCAAAGG + Intergenic
1085309879 11:75510045-75510067 CCACTGCCACTCCCAGTCACGGG + Intronic
1088396550 11:109376207-109376229 ATGCTTCCATTCCCATGCATGGG - Intergenic
1090910399 11:131113651-131113673 CAACCTCCACTGCCCTGCATTGG + Intergenic
1091465650 12:681757-681779 ACACTTCCACTTACATGTATTGG - Intergenic
1096536173 12:52276454-52276476 CCACTCCCAATCCCATCCTTTGG + Intronic
1097346379 12:58498073-58498095 CAACATCCACTGCCATCCATAGG - Intergenic
1097584718 12:61501659-61501681 CAACTTCCACTTCCCTTCATGGG - Intergenic
1098766240 12:74493297-74493319 CTACTTCCACTCCAATCCTTAGG + Intergenic
1099084591 12:78229713-78229735 GCACTTACATTCACATGCATTGG - Intergenic
1101477091 12:105061232-105061254 TCACTTCCACTCCTGTTCATTGG - Intronic
1102407069 12:112682712-112682734 TCACTTCCACACACATGCGTTGG + Intronic
1102413252 12:112738581-112738603 CCCCTTCTACACCCATGCAGTGG - Intronic
1103959530 12:124600208-124600230 CCACTGCCATTCCCAAGCATGGG + Intergenic
1104147997 12:126054108-126054130 CCACTTCCACTTCCATCCCTTGG - Intergenic
1104397697 12:128448551-128448573 CCAGTTCCAATCCCGGGCATTGG - Intronic
1104612454 12:130240921-130240943 CCACTTCCACTTCCCTGCTCAGG + Intergenic
1104973425 12:132541526-132541548 CCACTTCCCTTCCCCTGCATGGG - Intronic
1105759157 13:23497556-23497578 CCCCTACCATTCCCATGAATTGG - Intergenic
1105844299 13:24281340-24281362 CCACCTCCACTCCCCTGCCTGGG - Intronic
1106620390 13:31366111-31366133 CTCCTTCCAGTCCCATGCAATGG - Intergenic
1107154153 13:37146725-37146747 CAACTTACACTACCATGCGTTGG - Intergenic
1110406861 13:75160588-75160610 CCTCTGACACTCCCATGCAGAGG + Intergenic
1110993677 13:82075876-82075898 CCACCTCCACTCCCAGCCCTTGG - Intergenic
1111225126 13:85260888-85260910 CCACTTCCACTCCCCAGAAATGG + Intergenic
1112765346 13:102735953-102735975 CCACTTGCACTTCTATGCAATGG - Exonic
1112987168 13:105465349-105465371 CAACTTCCATTCACATTCATGGG - Intergenic
1113350422 13:109524130-109524152 CCTCTTTCACTCCCAAGAATGGG + Intergenic
1118329622 14:64805184-64805206 CGACTTCCTCTGCCAAGCATGGG - Intronic
1118431303 14:65721005-65721027 CCCCTTCCACCCCCATGCAGTGG - Intronic
1123107808 14:105851116-105851138 CAACTTCCACTCCCCTGCCACGG + Intergenic
1125356549 15:38822425-38822447 CCACTTCCACTTCCAAGCCTAGG - Intergenic
1125911781 15:43446494-43446516 CCTTTTCCACTCCCAAGTATGGG + Exonic
1128983609 15:72203379-72203401 CCACTTCCCCTCCAATACAGGGG + Intronic
1130314621 15:82784600-82784622 ACCCTTCCACTGCCAAGCATAGG - Intronic
1130837054 15:87661658-87661680 CTACCTCCACACCCATGCCTAGG - Intergenic
1130921251 15:88346682-88346704 CCACTTCCACTTACATCCTTTGG - Intergenic
1134509037 16:14831550-14831572 CCAATCCCACCCCCATGAATTGG + Intronic
1134696738 16:16230384-16230406 CCAATCCCACCCCCATGAATTGG + Intergenic
1134975097 16:18564321-18564343 CCAATCCCACCCCCATGAATTGG - Intergenic
1135935589 16:26777164-26777186 CCACTCCCTTTCCCATTCATAGG - Intergenic
1136049485 16:27640343-27640365 CCACCTCCACGCCCTTGCAAGGG - Intronic
1137364368 16:47848097-47848119 CCACCTCCACTCCATTCCATAGG - Intergenic
1137620698 16:49874781-49874803 ACACAGCCACACCCATGCATGGG - Intergenic
1137725539 16:50654248-50654270 GCACTTCCACTCCCAGCCATAGG - Intergenic
1137930862 16:52586138-52586160 TCACTTCCACTGGAATGCATGGG - Intergenic
1138866275 16:60824233-60824255 CCACTTTCATGCCCATTCATAGG - Intergenic
1139422256 16:66856026-66856048 CCCCTCCCACTCCCATGCTTAGG + Intronic
1140474204 16:75230606-75230628 ACATTTCCACTCCCGTGCCTAGG + Intronic
1140879835 16:79187975-79187997 CCACTCTCTCTCCCATGCACGGG + Intronic
1143998727 17:11032672-11032694 CCACTTCCACTTACATTTATTGG + Intergenic
1146142806 17:30383152-30383174 CCACTTCCACTGCCAGTCCTTGG - Intronic
1149536954 17:57440701-57440723 TCACATCCACACCCATGCACAGG - Intronic
1149852794 17:60050621-60050643 CCACCTACACTCTCATGCACAGG + Intronic
1151320057 17:73347628-73347650 TCACTTCCTCTCCCAGGCCTGGG + Intronic
1154229310 18:12540103-12540125 CCACTGGCCCTCCCATGCCTGGG - Intronic
1155583770 18:27341758-27341780 CCATTTCCAATCCCCCGCATAGG + Intergenic
1158701684 18:59754228-59754250 CCATTCCCACTCCCATAAATAGG - Intergenic
1163719399 19:18891529-18891551 CCACATCCACTCCAATCAATTGG + Intronic
1165193961 19:34086738-34086760 CCACTTCCAAGTTCATGCATGGG + Intergenic
1165351149 19:35276738-35276760 CCACCCCCATTCCCATGCAGAGG + Intronic
1166122350 19:40693219-40693241 CCACCTCCACTCCCAGGCTCTGG - Intronic
1166149037 19:40857585-40857607 CCATTTCCACTCTCAGGGATGGG + Intronic
1168391687 19:56013689-56013711 CCACTTCCACTCCTAGGTATAGG - Intronic
926130572 2:10301506-10301528 TCACTTCCACCCACATCCATGGG - Intergenic
926757458 2:16247740-16247762 CCACATCTCCACCCATGCATTGG - Intergenic
927364088 2:22273980-22274002 TCACTTCCACTCACAGCCATTGG + Intergenic
928300663 2:30121369-30121391 CCCCTTCCATTCCCTTCCATAGG + Intergenic
930223806 2:48771574-48771596 TCAATTCCACTCCCATGGATAGG + Intronic
930291742 2:49502733-49502755 CCTCTGCCACACCCAGGCATTGG - Intergenic
934090108 2:88543786-88543808 CCACTTCCACTCCTTGGCAAGGG - Intergenic
934883440 2:98004209-98004231 TCACTTCCACTCACACTCATTGG + Intergenic
935172453 2:100620894-100620916 CCACTTCTACACCTCTGCATCGG + Intergenic
937434058 2:121865850-121865872 CCACTTTCACGCCCATTCATAGG - Intergenic
942397523 2:175567581-175567603 CCACCCCTCCTCCCATGCATTGG + Intergenic
945717638 2:213379211-213379233 CCACTTCCACTTCCACCCCTTGG + Intronic
946135008 2:217638328-217638350 ACACTTCCAGTCTCATGCAGTGG - Intronic
948692812 2:239717561-239717583 GCACTGCCACCCCCATCCATGGG - Intergenic
1169943338 20:10961853-10961875 GCACTGCCACTCCCATGCTGTGG + Intergenic
1173280659 20:41624194-41624216 CCACTCCCACCCCCAGGCCTGGG + Intergenic
1173863414 20:46298747-46298769 CCCCTGCCTCTCCCAAGCATAGG + Intronic
1176369106 21:6051965-6051987 CCACGTCCCCACCTATGCATGGG - Intergenic
1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG + Intronic
1179754413 21:43486576-43486598 CCACGTCCCCACCTATGCATGGG + Intergenic
1180011041 21:45051706-45051728 CCACTGCCCCTCACATGCAGAGG - Intergenic
1181077491 22:20391305-20391327 CAAGTTCCACTCCCATGTACAGG + Intergenic
1182919764 22:34068544-34068566 CCACTTCCACTCCATTCCTTTGG + Intergenic
1183767640 22:39893665-39893687 CCACCACCACTCCCAAGCAGAGG + Intronic
1184004936 22:41700692-41700714 CGAATTCCCCTCCCATGAATTGG - Intronic
949897857 3:8783243-8783265 CCACTCTCACTCCCATGCCCTGG - Intronic
950129847 3:10534426-10534448 CCCCTTTCACTAACATGCATCGG + Intronic
950411320 3:12839735-12839757 CCATTGCCACTCCCAAGCAATGG + Intronic
951638461 3:24806696-24806718 TGACTACCACTCCCAGGCATAGG + Intergenic
953444441 3:42950733-42950755 CCACTTCCAATCCTGAGCATGGG - Intronic
954237708 3:49269680-49269702 CCACTGCCACTGCCCTGCCTGGG - Exonic
954452283 3:50578226-50578248 CCACTTCCCCTGCCAGGCAGGGG - Intronic
962623420 3:137201224-137201246 TCACTTCCACTCACATCCACTGG - Intergenic
967284113 3:187851988-187852010 CCACTTGCACTCCTATCCATTGG - Intergenic
968982103 4:3855831-3855853 CCACCTCCACTCCCGTCCACCGG + Intergenic
969677902 4:8624918-8624940 CCACTTACACCCCCAGGCCTAGG - Intergenic
969678857 4:8630554-8630576 CCACTTACACCCCCAGGCCTAGG - Intergenic
969679813 4:8636204-8636226 CCACTTACACCCCCAGGCCTAGG - Intergenic
973553422 4:52057877-52057899 CCCATTCCTCTCCCATGCAATGG - Intronic
975272032 4:72447092-72447114 CCAGTTCCACTCCTATCAATAGG + Intronic
976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG + Intronic
981701618 4:147613660-147613682 CCATTTCCCCTCCCATGTGTTGG + Intergenic
982842485 4:160208704-160208726 CAACTTCCATTCCCCTGCTTTGG + Intergenic
983890542 4:173025391-173025413 CCACTTCCATCCCCAGTCATTGG + Intronic
986515675 5:8560828-8560850 CCATGTCCACTCACATCCATGGG + Intergenic
995759866 5:115551751-115551773 CCACCTCCTCTCCCAGGCCTGGG + Intergenic
996034769 5:118746328-118746350 CCACCTCCAGTTCCATGAATGGG - Intergenic
998343416 5:141439303-141439325 CCATTCCCACTTCCATGCCTGGG - Intronic
999430759 5:151523549-151523571 GTACTTCCACTTCCATGCACTGG - Intronic
999528107 5:152430598-152430620 CCACTTCCACACCAATGCTGTGG - Intronic
1000455732 5:161446483-161446505 CCACTTCCAACTGCATGCATGGG + Intronic
1000605025 5:163318731-163318753 ACACTTCCACTCCGATGGAGTGG + Intergenic
1000980259 5:167809377-167809399 CCATTTTCACTCTCATCCATGGG - Intronic
1001118832 5:168962134-168962156 CCACTCCCACCCCCACCCATGGG - Intronic
1007247580 6:40473432-40473454 CCGTTTCCACTCCCAGTCATTGG + Intronic
1007377904 6:41468978-41469000 CCAATTCCAGACCCATGCCTAGG - Intergenic
1007445481 6:41902274-41902296 ACATTTCCCCTACCATGCATTGG - Intergenic
1007996277 6:46311554-46311576 CCAGTCCCACTTCCATGCCTTGG - Intronic
1013170573 6:107634181-107634203 CCACTTCCAGCCCCATGCACCGG + Exonic
1023898066 7:44451611-44451633 CCACCTCCATTCCCATCCTTAGG - Intronic
1028482795 7:91326069-91326091 CTCCTTCCACTCCCACTCATGGG - Intergenic
1030158057 7:106476876-106476898 CCACTTCTACTTCCATGCCTTGG - Intergenic
1030506891 7:110436135-110436157 CCACTTCCACTTCCATCCGTTGG - Intergenic
1030931089 7:115524213-115524235 CCACTTTCACTTCCATCCCTTGG + Intergenic
1035164260 7:156975372-156975394 CCAGTTCCACTCTTTTGCATTGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035720523 8:1787992-1788014 CCACATCCACACTCAGGCATGGG + Intergenic
1046238279 8:111456664-111456686 CCACTTCCACTTCCATGAAGAGG + Intergenic
1046240039 8:111478177-111478199 CAACTTCCTCTACCATGCAAGGG + Intergenic
1046317015 8:112517168-112517190 CCATTTCGAGTCCCATTCATGGG + Exonic
1047499215 8:125429567-125429589 CCACATCCACTACCACGCACAGG + Intergenic
1047506350 8:125483707-125483729 CCACTTCCTCTCCCCTGCACAGG + Intergenic
1048441539 8:134462900-134462922 GCTCTTCCATTCCCATCCATGGG - Intergenic
1049000289 8:139821583-139821605 CCACCTCCATTCCCATCCTTCGG - Intronic
1049071013 8:140356137-140356159 CCACCACCACTCCCAGGCACGGG + Intronic
1049800597 8:144515873-144515895 CCACTTCTGCTTCCATGCCTGGG + Exonic
1050428382 9:5535990-5536012 CCTCTTCCCCTCCCACGCATTGG + Intronic
1050642413 9:7682405-7682427 CCCCCTTCATTCCCATGCATTGG + Intergenic
1056156881 9:83846660-83846682 CCACTTCCACTTCCACCCCTTGG - Intronic
1056353657 9:85776866-85776888 CCACTTCCACTTCCACCCCTTGG + Intergenic
1057352545 9:94311690-94311712 CCACTCCCACTCCCAGCCCTTGG - Intergenic
1057357088 9:94340739-94340761 GCCCTGCCCCTCCCATGCATGGG + Intergenic
1057357095 9:94340750-94340772 CTCCTGCTACTCCCATGCATGGG - Intergenic
1057490343 9:95515816-95515838 CCACCTCCCCTCCCATGCTGCGG - Intronic
1057650657 9:96916877-96916899 CTCCTGCTACTCCCATGCATGGG + Intronic
1057650664 9:96916888-96916910 GCCCTGCCCCTCCCATGCATGGG - Intronic
1057813946 9:98280123-98280145 CCACCTCCACTCCCATCGAGGGG + Intergenic
1060483748 9:124034027-124034049 CCACTACAACTGCCATGCAAGGG - Intergenic
1060965058 9:127707552-127707574 CCACTTCCACTTCCTGGCAGTGG + Intronic
1060992674 9:127857779-127857801 CCACTTCCCCACCCCTGCAGAGG + Intergenic
1061669793 9:132182393-132182415 CCAGTTCCCCTCCCCTGCACTGG + Intronic
1186524193 X:10233316-10233338 TCACTTCCACCCACAGGCATTGG + Intronic
1188113393 X:26217210-26217232 CCACTTCCTCTCCTATTCTTGGG + Exonic
1188262057 X:28034014-28034036 CCACTGTCCTTCCCATGCATTGG - Intergenic
1192783984 X:74320438-74320460 CCACCACCACCCCCATACATAGG + Intergenic
1193524616 X:82573619-82573641 CTACTCCCACCCCCATGCAATGG - Intergenic
1198740626 X:139838564-139838586 ACAATTCCACTCCTAAGCATAGG + Intronic
1199711730 X:150474294-150474316 ACACTCATACTCCCATGCATGGG + Intronic
1200116632 X:153772420-153772442 CCACCTCCACTCACATGCCATGG - Intronic