ID: 1179080937

View in Genome Browser
Species Human (GRCh38)
Location 21:38170168-38170190
Sequence CCACTTCCACTCCCATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179080929_1179080937 2 Left 1179080929 21:38170143-38170165 CCCCCAGGCTGCAGCCCTGTTCT No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data
1179080928_1179080937 13 Left 1179080928 21:38170132-38170154 CCTGGTAGAAGCCCCCAGGCTGC No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data
1179080930_1179080937 1 Left 1179080930 21:38170144-38170166 CCCCAGGCTGCAGCCCTGTTCTG No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data
1179080931_1179080937 0 Left 1179080931 21:38170145-38170167 CCCAGGCTGCAGCCCTGTTCTGC No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data
1179080932_1179080937 -1 Left 1179080932 21:38170146-38170168 CCAGGCTGCAGCCCTGTTCTGCC No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data
1179080926_1179080937 21 Left 1179080926 21:38170124-38170146 CCAGCTGACCTGGTAGAAGCCCC No data
Right 1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179080937 Original CRISPR CCACTTCCACTCCCATGCAT AGG Intronic