ID: 1179085011

View in Genome Browser
Species Human (GRCh38)
Location 21:38208163-38208185
Sequence GTTAACATGCAGATTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179085003_1179085011 14 Left 1179085003 21:38208126-38208148 CCTTTTTAGCAGACAGCTCACAT 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179085011 Original CRISPR GTTAACATGCAGATTGTGCA GGG Intronic
900798235 1:4722466-4722488 GTTCACACGCATCTTGTGCATGG + Intronic
909558116 1:76978201-76978223 GTTAATATGCAGAATATGTAAGG - Intronic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910734434 1:90436949-90436971 GTTATAATGCAAATTGAGCATGG + Intergenic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
911015011 1:93323050-93323072 GTTTACATCCAGATTCTGCTTGG - Intergenic
911448701 1:98035645-98035667 GTTAATAACCACATTGTGCACGG + Intergenic
913176838 1:116281105-116281127 ATTAACATCCAGAATATGCAAGG - Intergenic
913382051 1:118223257-118223279 CTTAAGATCCAGATTGTTCAGGG - Intergenic
913708273 1:121450431-121450453 GAGAACATGCAAATTCTGCATGG + Intergenic
914996509 1:152547442-152547464 GTCAACATTCAGATTTTTCATGG - Intronic
916303971 1:163307993-163308015 ATTAGGATGCAGATTGTTCATGG - Intronic
917104327 1:171477302-171477324 GTTAACTTGCATATAGTGAAGGG - Intergenic
917906012 1:179587773-179587795 GATTACATGCAGAATGTCCATGG + Intergenic
920897577 1:210071838-210071860 GAGAATATGCAGATTGTTCAAGG - Intronic
922189456 1:223304488-223304510 GTTACCATGCAGGGTGTGTATGG - Intronic
924144952 1:241064288-241064310 TTTAAAATGCAGATTCTGCTGGG + Intronic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1068939180 10:62664177-62664199 GTTAAGAAGCAGACTGTGCAGGG + Intronic
1070524880 10:77287319-77287341 CTTAACATGAGGATTGTGTATGG - Intronic
1070624815 10:78043296-78043318 GTTAACATGCAGATTAGGCCGGG - Intronic
1074075337 10:110118391-110118413 GTTAACTTACAGATTGTTTATGG + Intronic
1074876473 10:117617498-117617520 TTTAACATGCACATTGGCCAAGG + Intergenic
1074948123 10:118300922-118300944 GTGAACATTAAGATAGTGCATGG - Exonic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1078179161 11:8996143-8996165 GTTAACATGCTGGTAGGGCAGGG - Intronic
1078904821 11:15673911-15673933 GTCAACATGCATATTTTACATGG - Intergenic
1078919466 11:15815853-15815875 GTTAAGATGCAGGTTGTTCCAGG - Intergenic
1079571326 11:21946766-21946788 TTTAACATGCAGATGATTCAAGG - Intergenic
1082864989 11:57890971-57890993 GTTAACATCCAGAATATGTAAGG - Intergenic
1083832710 11:65243054-65243076 TTAAACATGCAGCTTCTGCAAGG - Intergenic
1085921540 11:80963690-80963712 GTTGACCTGCAGATGGTGCAAGG - Intergenic
1087760707 11:102101763-102101785 GTTAAAACCCAGATTGTGCCGGG + Intergenic
1088992039 11:114962037-114962059 GTTAAAATGCAGATTTTCCTAGG - Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090134169 11:124178666-124178688 GATAACATTTAGATTGTGCCTGG - Intergenic
1095265515 12:40152451-40152473 GTTAACATACATATTGTGGAAGG + Intergenic
1095867417 12:46987755-46987777 TTTAACATCCAGATTCTACAAGG + Intergenic
1099054455 12:77821458-77821480 GTTAACATGTGGATTCTGAAGGG + Intergenic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1100086583 12:90918115-90918137 ATTAACATGCAGATTTTGGGTGG + Intronic
1109409367 13:61943324-61943346 ATTAACATGCAGTGTGTCCACGG - Intergenic
1110203796 13:72886044-72886066 GTTAACATACATATTGTAAAAGG - Intronic
1110656247 13:78003572-78003594 GCTAACATGCAGAATCTACAAGG + Intergenic
1110714971 13:78691368-78691390 GACAACATACAGATAGTGCAGGG + Intergenic
1111409341 13:87854035-87854057 GTTCCCATTCAGATTGTGGAAGG - Intergenic
1112330239 13:98471818-98471840 GTTCACACGCAGATTGTCAAAGG - Intronic
1112679583 13:101747737-101747759 ATTAACATGCAGAATCTACAAGG + Intronic
1115294891 14:31814413-31814435 GTTAATATCCAGAATGTACAAGG - Intronic
1117882493 14:60325957-60325979 GTTAAAATGCAGATTGTGGCCGG - Intergenic
1119587296 14:75848347-75848369 GTTAATGTGCAGATTGTCTAGGG - Intronic
1126396332 15:48222137-48222159 ATTAAGATGCAGATTTTCCATGG - Intronic
1127030535 15:54856685-54856707 GTTAATATGCAGAATCTACAAGG + Intergenic
1128672883 15:69587464-69587486 ATGAACATGCAGAATGTGCTTGG + Intergenic
1128734680 15:70046565-70046587 GTTAAAATGCAGATTCTGCTTGG + Intergenic
1131557009 15:93408457-93408479 GTTAAAATGCAGACTCTGCCAGG + Intergenic
1132162348 15:99554725-99554747 GTTAACATGCTGAGTTGGCAAGG - Intergenic
1132172372 15:99673597-99673619 GTTAACAAGCATATTGTAAATGG + Intronic
1132435362 15:101796578-101796600 GTTTACTAGCAGTTTGTGCATGG - Intergenic
1135540878 16:23329607-23329629 GATACCATGTAGCTTGTGCAGGG + Intronic
1137524655 16:49224227-49224249 GTTAACATGCAGATGTGGGAAGG - Intergenic
1137575094 16:49594168-49594190 GTTCCCTTCCAGATTGTGCAGGG + Intronic
1138628680 16:58275226-58275248 GTTAAAATGCAGATTCTGAGTGG + Intronic
1141094899 16:81156128-81156150 GTGAGCATGCAGAGTGTGCAGGG - Intergenic
1144213218 17:13032641-13032663 GTTAAAATGCAGATTGTGGCTGG + Intergenic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1148212953 17:45819219-45819241 GTTAACATGCACAAGGTGCTTGG - Intronic
1151391387 17:73789256-73789278 GTTAACTTGCAAATGGGGCAAGG + Intergenic
1152370150 17:79882590-79882612 GTTAAAATGAATATTGTTCAAGG - Intergenic
1153592288 18:6686329-6686351 TTGAACATGCACATTGTGCCAGG + Intergenic
1154207786 18:12352640-12352662 GTTAACATGCTGTTTGTGTCTGG - Intronic
1154299573 18:13181322-13181344 ATTGACATGCATATTGTGTATGG - Intergenic
1155856847 18:30845136-30845158 GCTAACATCCAGAATGTACAAGG - Intergenic
1156214844 18:34987378-34987400 GTTAACGTGAAGATTGTGATTGG - Intronic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1160618457 18:80151855-80151877 GTTATCATGAAAATTATGCATGG - Intronic
928029228 2:27764808-27764830 GTTAAAATGCAGATTCTGGCTGG + Intergenic
928148134 2:28800639-28800661 GTTAACATGAAGATTTTAGAAGG + Exonic
928215481 2:29357735-29357757 GTCAGCCTGCAGATTCTGCAGGG - Intronic
928319326 2:30270574-30270596 GTTAAAATGCAGATTCTGGCCGG + Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
928964648 2:36965417-36965439 TTTATCTTGCAGATTATGCAAGG + Intronic
931216433 2:60249197-60249219 GTAAACATACAAAGTGTGCATGG + Intergenic
931815371 2:65895510-65895532 GCTAATATCCAGAATGTGCAAGG + Intergenic
932654727 2:73600677-73600699 GGTAACTTGGAGATTGTGAACGG + Exonic
932662886 2:73672308-73672330 GGTAACTTGGAGATTGTGAACGG + Intergenic
934531470 2:95091942-95091964 GGTATCATGCAGATTCTGGAAGG + Intronic
937706208 2:124923574-124923596 GTTAACATGCTGGCTGAGCACGG - Intergenic
940306903 2:152236774-152236796 GTTGAGATGCTGATTATGCATGG + Intergenic
941338739 2:164278749-164278771 GTTAATATCCAGAATGTACAGGG - Intergenic
941841985 2:170095523-170095545 GATAATATGCAGTTTGTGCAAGG + Intergenic
942482781 2:176406993-176407015 GTAAACATGCAGATTCTGATTGG + Intergenic
943787187 2:191890799-191890821 GTTAACATGCAATTTATGGATGG - Intergenic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
946799355 2:223394022-223394044 ATTCACATACAGATTTTGCATGG + Intergenic
947108260 2:226690779-226690801 TTTAATATCCAGATTCTGCATGG - Intergenic
947108516 2:226693600-226693622 GTTAGCAGGCAAATTGGGCAAGG + Intergenic
948171696 2:235908738-235908760 GATTACATGCAGAATGTTCATGG + Exonic
1169231356 20:3890652-3890674 GTTTAAATGCAGATTGTGAGAGG + Intronic
1169351081 20:4868368-4868390 GTTAAAATGCAGATTCTGGCCGG - Intronic
1170138632 20:13103102-13103124 TTTATAAAGCAGATTGTGCAAGG - Intronic
1173270718 20:41532524-41532546 GTTAACATGCACAGGGTGTAAGG - Intronic
1175259874 20:57667607-57667629 GTTAACAAGCAGCCAGTGCATGG + Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1180989110 22:19923494-19923516 GTTAACAAGCAGACTGGGCGTGG + Intronic
1182480509 22:30605892-30605914 ATTGCAATGCAGATTGTGCATGG + Intronic
1184757324 22:46524426-46524448 GTTGTCATGGGGATTGTGCAGGG - Intronic
1184776764 22:46627271-46627293 GTTGACATGCGGATGGAGCAGGG + Intronic
950574385 3:13823025-13823047 CTCAAAATGCAGAGTGTGCAGGG - Intronic
951034526 3:17918543-17918565 GTTAACTTGGAGATTTTGTATGG + Intronic
952245728 3:31589705-31589727 TTTAACATGCAAATTTAGCAAGG - Intronic
953296183 3:41719742-41719764 GTTTAGATGTAGAGTGTGCAAGG - Intronic
954383521 3:50232386-50232408 TAAAACATGCAGAATGTGCATGG - Intronic
955107013 3:55908147-55908169 GTAAACATGCAGGTTCTACATGG + Intronic
956520046 3:70094086-70094108 TATAAAATTCAGATTGTGCACGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965875880 3:173319086-173319108 TATAACATGCAGATTTTTCATGG - Intergenic
967192325 3:186995548-186995570 GTTAAAATGCAGGCTGTGCATGG + Intronic
971906243 4:32729923-32729945 ATTAACATGCAGAATATACAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978862373 4:113465821-113465843 GTTAAAATGCAGATTCTGGCAGG - Intronic
983549698 4:169004049-169004071 ACTAACCTGCACATTGTGCACGG + Intronic
984893928 4:184518512-184518534 GTTAAGCTGCATATGGTGCAAGG + Intergenic
986350902 5:6878545-6878567 CATAACATGTAGACTGTGCAGGG + Intergenic
986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG + Intergenic
987332621 5:16870473-16870495 GTTAAAATGCAGATTCTGACAGG - Intronic
991344847 5:65653404-65653426 GTAAAAATTCAGATTGTGGATGG - Intronic
993809739 5:92461216-92461238 TGTAACAACCAGATTGTGCAAGG + Intergenic
994909844 5:105888706-105888728 GTGAACATGCAGATTTTGAAAGG + Intergenic
997813172 5:136991883-136991905 CATAACATGCAGATTGCTCAAGG - Intronic
998251711 5:140557811-140557833 GTGAATGTGGAGATTGTGCAGGG - Exonic
999629198 5:153552713-153552735 GTTAAAATGCAGATTCTGTGGGG + Intronic
1002828783 6:799739-799761 TTTATCATGCTGATTCTGCATGG + Intergenic
1006052216 6:31353859-31353881 GCGAACATGCAGATTCTGGAAGG + Exonic
1006684465 6:35821006-35821028 GTTAAAATGCAGATTCTGCTGGG + Intronic
1006808021 6:36801258-36801280 GGTAAAATACAGATTGTGGAGGG + Intronic
1007245560 6:40459627-40459649 GGGAACATGCAGATTTTTCAAGG - Intronic
1008654143 6:53594105-53594127 ATTAAAATGCAGGATGTGCAGGG + Intronic
1010128047 6:72457157-72457179 GTTAACATCCAGAATGTAAAAGG - Intergenic
1013835351 6:114328467-114328489 GAAAACAGGCAGATTGTACAAGG - Intronic
1014842047 6:126231268-126231290 GTTTAAATGCATATTGTTCAAGG - Intergenic
1016901123 6:149103410-149103432 GCTAACATCCAGAATCTGCAAGG + Intergenic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1020749485 7:12122638-12122660 GTTAACATCCAGAATCTACAAGG - Intergenic
1021945558 7:25723240-25723262 CTTTACAGGGAGATTGTGCAAGG + Intergenic
1021971269 7:25967946-25967968 GTTTTCATGCAGATTGTGAATGG - Intergenic
1022555633 7:31292437-31292459 GTTTAGGGGCAGATTGTGCAGGG + Intergenic
1023360780 7:39413293-39413315 GTAAAAATGCAGAACGTGCATGG - Intronic
1026493528 7:70883563-70883585 GTTCACATGCACATATTGCATGG + Intergenic
1028054588 7:86226241-86226263 GTTGACATGCAGATGGTGGCAGG - Intergenic
1036459556 8:8939787-8939809 GTTAAAATGCAGATTCTGGGTGG - Intergenic
1036919910 8:12842445-12842467 TTTAAAATGCAGACTGTGCCTGG + Intergenic
1037955420 8:23053360-23053382 GTTTACATGCAAGTTGTGTAAGG + Intronic
1039836443 8:41260030-41260052 GTTAAAATGCCGATTCTGAAGGG - Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040617644 8:49054603-49054625 GTTAACCTTCACATTGTTCAAGG + Intronic
1041910379 8:63082754-63082776 GCTAATATCCAGAATGTGCAAGG + Intronic
1042733290 8:71961018-71961040 GTTAAAATGCATATTAGGCAAGG + Intronic
1043126476 8:76402929-76402951 GCTAGCAGCCAGATTGTGCAGGG - Intergenic
1044552727 8:93530054-93530076 GTTAAGATGCAAAAAGTGCATGG + Intergenic
1044753540 8:95439077-95439099 ATTAAAATACTGATTGTGCATGG - Intergenic
1045054302 8:98356096-98356118 GATACCATGCAGATTGGGCTGGG + Intergenic
1046094617 8:109542122-109542144 GTTAACATTTTGATAGTGCATGG + Intronic
1046174771 8:110560937-110560959 GTTAATATCCAGAATCTGCAAGG - Intergenic
1046760460 8:118014859-118014881 GTTAACATTAATATTCTGCAAGG + Intronic
1047273595 8:123387708-123387730 GTTAACTTACTGATTCTGCAAGG - Intronic
1051346174 9:16153049-16153071 GGTAACAAGCAGAATGAGCAGGG + Intergenic
1051746926 9:20303851-20303873 GCTAACATGCAGACAGGGCAGGG + Intergenic
1054822295 9:69535228-69535250 GTTAAAATGCAGATTCTGGCTGG + Intronic
1186163852 X:6805961-6805983 ATTAACACGCAGATTGTGAAGGG + Intergenic
1188349722 X:29113099-29113121 GTTGACATGCTGACTGGGCACGG - Intronic
1190831445 X:54062666-54062688 GTTAAAATGCAGATTCTGGCCGG + Intergenic
1194315732 X:92375085-92375107 TTAAACATGCAGATTGTTAAGGG + Intronic
1194514864 X:94840079-94840101 GTTAACATCCAGAATCTACAAGG - Intergenic
1196966236 X:121058499-121058521 GCTAACATCCAGAATATGCAAGG - Intergenic