ID: 1179085106

View in Genome Browser
Species Human (GRCh38)
Location 21:38209182-38209204
Sequence CTGGAGCAGCAGGAGCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 3, 3: 86, 4: 578}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179085093_1179085106 27 Left 1179085093 21:38209132-38209154 CCTGATGACCCAGGGGGCCCCTA 0: 1
1: 0
2: 4
3: 7
4: 133
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085101_1179085106 -7 Left 1179085101 21:38209166-38209188 CCTCTGTGAGCTGCGCCTGGAGC 0: 1
1: 0
2: 2
3: 29
4: 253
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085094_1179085106 19 Left 1179085094 21:38209140-38209162 CCCAGGGGGCCCCTAGTACTTCC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085099_1179085106 -2 Left 1179085099 21:38209161-38209183 CCACTCCTCTGTGAGCTGCGCCT 0: 1
1: 0
2: 3
3: 28
4: 264
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085096_1179085106 10 Left 1179085096 21:38209149-38209171 CCCCTAGTACTTCCACTCCTCTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085095_1179085106 18 Left 1179085095 21:38209141-38209163 CCAGGGGGCCCCTAGTACTTCCA 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085098_1179085106 8 Left 1179085098 21:38209151-38209173 CCTAGTACTTCCACTCCTCTGTG 0: 1
1: 1
2: 2
3: 45
4: 439
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578
1179085097_1179085106 9 Left 1179085097 21:38209150-38209172 CCCTAGTACTTCCACTCCTCTGT 0: 1
1: 0
2: 1
3: 24
4: 159
Right 1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG 0: 1
1: 0
2: 3
3: 86
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179085106 Original CRISPR CTGGAGCAGCAGGAGCAAAG GGG Intronic
900149448 1:1171738-1171760 CTTGAGCACCAGGCGCAAGGTGG + Intergenic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900550066 1:3250182-3250204 CTGGAGCCTCAGGAGCAATGCGG - Intronic
900936279 1:5768221-5768243 CTGGAGCTGCAGGAGCCCGGAGG - Intergenic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901145847 1:7064202-7064224 GAGGAGGAGCAGGAGGAAAGGGG - Intronic
901332547 1:8422668-8422690 GAGAGGCAGCAGGAGCAAAGAGG + Intronic
901944871 1:12693619-12693641 CCGGAGCAGGAGGAAGAAAGAGG - Intergenic
902091935 1:13910536-13910558 ATGGTGAAGCAGGAGCAAGGTGG - Intergenic
902225998 1:14996794-14996816 CTGGAGCACCAGGAGCGGGGAGG - Intronic
902504374 1:16929879-16929901 CTGGAGACGCAGGAGCCCAGGGG + Exonic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902742152 1:18446089-18446111 CTGGAACAGAAGGTGCAAGGAGG - Intergenic
903137826 1:21320932-21320954 CTGCAGCAGCAGGATCCTAGAGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
903857315 1:26344830-26344852 ATGAGGCAGCAGGAGCACAGGGG + Exonic
904268741 1:29334371-29334393 CTGGAGCTGCAGAGGCTAAGTGG + Intergenic
905108343 1:35577139-35577161 CCCGCGCAGCAGCAGCAAAGGGG + Intronic
905526416 1:38643410-38643432 TAGGAGCAGCAGAAGCCAAGAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906286575 1:44591765-44591787 CTGGAGGAGGAGGAGGACAGAGG - Intronic
906693762 1:47810535-47810557 CTGGAGATGCATGAGCAAGGGGG + Intronic
907694244 1:56705699-56705721 ATGGAGTAGAAGGAACAAAGAGG - Intronic
907908308 1:58805112-58805134 CTGGAGCAGACTGAGCTAAGAGG - Intergenic
907974263 1:59415623-59415645 CAGGAGCTGCAGGAGCTCAGAGG - Intronic
908776468 1:67645787-67645809 CTGCAGAAGCTGGAGCAAAGTGG + Intergenic
908909020 1:69050940-69050962 TTGGAGCACCAGAAGCAAAAGGG - Intergenic
910368985 1:86496342-86496364 CCTGAGCAGGAGGAGAAAAGAGG - Intronic
910555115 1:88523021-88523043 CTAGAGCAGAGGGAGCAAAGTGG - Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
911735991 1:101337169-101337191 CTGGTGTAGCAGGAGCTAAATGG + Intergenic
912228970 1:107770078-107770100 CTGGAGCAGAATGAGGGAAGGGG - Intronic
912469688 1:109898027-109898049 AGGGAGCAGCAAAAGCAAAGTGG - Intergenic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
912664304 1:111565193-111565215 CTGGAGCAGAATGAACAAAGGGG + Intronic
912871583 1:113311516-113311538 CTGGGGCAGCAGTAGCCATGGGG + Intergenic
912876383 1:113364201-113364223 CTGGAGCTCAGGGAGCAAAGGGG + Intergenic
912972141 1:114293630-114293652 AAGGAGCAGCAGGATCCAAGGGG + Intergenic
913185277 1:116365017-116365039 CTGGAGGAACAGGAGTAAACTGG + Intergenic
915524237 1:156466461-156466483 CAGGAGCAGAAGGAGCTAACAGG + Exonic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916220599 1:162440948-162440970 CTGTAGCAGCAGGAGGGATGTGG - Intergenic
916291082 1:163166963-163166985 GTGGAGCAGCAGGCACCAAGCGG - Intronic
918210640 1:182348129-182348151 CTAGAGCAGAGGAAGCAAAGAGG - Intergenic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918632937 1:186740433-186740455 CTGGAGCAGAGTGAGCAAAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919110533 1:193213962-193213984 CTGGAGCAGGGGAAGAAAAGGGG - Intronic
920567048 1:206982389-206982411 CTGGGGCAGCAGGTGTAAATCGG + Intergenic
920641920 1:207760788-207760810 CAGGAGCAGGAGGAGCAAGGTGG + Intronic
921194307 1:212739048-212739070 CTGGATCAGCAAGGGCACAGTGG - Intronic
921342139 1:214144925-214144947 AAGGAAGAGCAGGAGCAAAGGGG + Intergenic
922336585 1:224623297-224623319 GAGCAGCAGCAGGAGCTAAGTGG - Intronic
922695245 1:227728220-227728242 CTGCAGGTGCAGGAGCAATGAGG - Intergenic
923321802 1:232841790-232841812 TGGGAGGAGCAGGAGCAAAGGGG + Intergenic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924650014 1:245917478-245917500 CTGGTGGAGCAGCAGCAATGAGG - Intronic
924690342 1:246343467-246343489 CTGCAGAAGCAGGGTCAAAGAGG + Intronic
924694676 1:246386458-246386480 AGGGAGCAGGAGGAACAAAGAGG + Intronic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063159283 10:3408133-3408155 CTGGAGCAGGAGGAGGTAAGAGG + Intergenic
1064936382 10:20683294-20683316 CTGGAGAAGAAGGAGCAACCAGG + Intergenic
1064999737 10:21327665-21327687 CAGAAGCAACAGGAGGAAAGAGG - Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1067546668 10:47196851-47196873 CTGGAGCAGCAGCAACCACGTGG - Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068894899 10:62188559-62188581 CAGGAACAGAATGAGCAAAGGGG - Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069571991 10:69499893-69499915 CTGGAGCAGAGGGAGCACAGCGG + Intronic
1070115588 10:73525810-73525832 CTGCAGCAGCAGTAGTAAAAAGG - Intronic
1070493055 10:76995396-76995418 CTGGTGCAGGTGGAGGAAAGAGG + Intronic
1072750249 10:97973698-97973720 CTGCAGCAGCAGGCCAAAAGGGG - Intronic
1072782684 10:98261154-98261176 CTGGAGGAGCAGGAGCCCCGAGG - Intronic
1073579887 10:104655782-104655804 CGGAAGAAGCAGGAGCAAGGCGG - Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1073957906 10:108893428-108893450 CTGGGGTGGCAGGAGCCAAGTGG - Intergenic
1074253272 10:111775252-111775274 ATGGAGTAGAAGGAGCATAGGGG + Intergenic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1075035594 10:119064525-119064547 CTGGAGCAGGAGGAAGACAGAGG - Intronic
1077011043 11:379494-379516 CTGGAGCTGCAGGAGCGCGGGGG + Exonic
1077112264 11:867008-867030 CTGGAGCACCAGGACCAGTGGGG - Exonic
1079128435 11:17734591-17734613 CGGGAGCAGCAGGAGCCGCGCGG + Intergenic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081212541 11:40354601-40354623 CTGGAGCAGCAGTGGCCATGAGG - Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081763388 11:45592593-45592615 CTGGGGCAGCCAGGGCAAAGAGG - Intergenic
1081833596 11:46135589-46135611 CTGGAGCTGCCTGAGCAAAGAGG + Intergenic
1082705692 11:56491884-56491906 CTGGAGAAGCCTGAGCAAACAGG + Intergenic
1082719113 11:56651619-56651641 CAGGTGCAGTAGGACCAAAGCGG + Intergenic
1083733736 11:64667901-64667923 CTGGCCCAGCAGGAGCATGGTGG + Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084511649 11:69609186-69609208 CTGGCACAGCAGCAGCAACGAGG + Intergenic
1084539554 11:69777275-69777297 AGGGAGCACCCGGAGCAAAGTGG - Intergenic
1084970372 11:72768248-72768270 CAGGAGCAGAAAGAGCAGAGGGG - Intronic
1085416162 11:76320453-76320475 CAGGAAGAGCAGGAACAAAGTGG - Intergenic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086074846 11:82839683-82839705 CTGGAGCAAAGGCAGCAAAGAGG - Intronic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087951480 11:104225709-104225731 CTGTATTAGCAGGAGCAAAAAGG - Intergenic
1087959240 11:104327040-104327062 CGGGGGGAGGAGGAGCAAAGTGG + Intergenic
1088259298 11:107928939-107928961 CTGGAAGAGGAGGGGCAAAGGGG - Intronic
1088852967 11:113720473-113720495 AGGGAACAGCATGAGCAAAGGGG - Intergenic
1088999383 11:115038445-115038467 CTGGAGCAGAGTGAGCAAAGGGG - Intergenic
1089138142 11:116265843-116265865 ATGGAGAAGCAAGAGCAAAGGGG + Intergenic
1089298385 11:117483121-117483143 CGGCAGCAGCAGGAGGCAAGGGG + Intronic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089650253 11:119908304-119908326 GTGGGGGAGCAGGAGCACAGGGG + Intergenic
1089847854 11:121472383-121472405 CTGGACAAACAGGAGCCAAGAGG + Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1090657219 11:128855347-128855369 CTGGAGCAGATGGAGAAAAGAGG + Intronic
1090845662 11:130527979-130528001 CTGCAGCAGGAGGATAAAAGAGG + Intergenic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091174127 11:133544739-133544761 CTGGGGCTGCAGTAGCACAGAGG - Intergenic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG + Intergenic
1092231805 12:6779937-6779959 CTGGAGCAGGAGGGGCATGGTGG + Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1094522888 12:31211432-31211454 CTAGAGCAGACGGAGCAAAGAGG - Intergenic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1095633867 12:44408465-44408487 GTGGTGGAGCAGGAGCAAAAGGG + Intergenic
1095968321 12:47884033-47884055 CTTGGGCAGTAGGAGCAGAGGGG - Intronic
1096222829 12:49842812-49842834 TTGGAGCATCCGGAGCCAAGTGG - Intronic
1096665487 12:53161194-53161216 GTGGAGCAGGAGGAACAACGTGG + Intronic
1096803870 12:54128406-54128428 TTGGAGAGGCAGGAGCAAAAAGG - Intergenic
1097155651 12:57010372-57010394 CTGTGGCAGCAGGAGAGAAGGGG + Intronic
1097626431 12:62007104-62007126 CTGGAGCAGAAGGAGCATGGGGG - Intronic
1099187488 12:79531778-79531800 CTTGAGCAACAGGAGCATGGGGG - Intergenic
1100089494 12:90953682-90953704 CTGGAGGAGAACGAGCAGAGAGG - Exonic
1100105926 12:91171900-91171922 CTGTAGTAACAGGAGCATAGTGG + Intronic
1100298591 12:93285829-93285851 GTGGAGCAGCCAGAGCAAAGTGG + Intergenic
1100347827 12:93749318-93749340 TTGGAGCTTCATGAGCAAAGGGG + Intronic
1100549348 12:95632672-95632694 CTGCAGCAGAGCGAGCAAAGTGG - Intergenic
1100752677 12:97716499-97716521 TTCAAGCAGGAGGAGCAAAGGGG - Intergenic
1101502874 12:105320343-105320365 GAGGAGGAGCAGGAGCAAATTGG + Intronic
1101766822 12:107708666-107708688 CTAGAGCAGTAGAAGAAAAGAGG - Intronic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1102544335 12:113643741-113643763 CTAGAGGTGCAGGAGCAAGGTGG - Intergenic
1102843973 12:116157903-116157925 CAGCAACAGTAGGAGCAAAGAGG + Intronic
1103201657 12:119092912-119092934 CTGGAGCTGAGGGAGCAAAGGGG - Intronic
1104221289 12:126787218-126787240 ATGGAGGAGGAGGAGCACAGAGG + Intergenic
1104641765 12:130471710-130471732 CAGGAGCAGCAGGAGCATCTGGG - Intronic
1105254762 13:18736521-18736543 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1105480640 13:20772716-20772738 ATGGAACAGCATGAGCAAAGGGG + Intronic
1105704830 13:22962356-22962378 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105857791 13:24387514-24387536 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1106036700 13:26050910-26050932 CAGCAGCTGCAGGAGCGAAGCGG + Exonic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106489926 13:30211768-30211790 CTGGAAGAGCAACAGCAAAGTGG + Intronic
1106708001 13:32301976-32301998 TTGGAGCAGCAGGAACTTAGTGG - Intergenic
1107350604 13:39510470-39510492 CTGCAGCAGCTGGAGAAAATTGG - Intronic
1107488412 13:40855053-40855075 TTAGAGCAGCAGGAGCAACTTGG - Intergenic
1107920617 13:45202911-45202933 CTGGAGTAGCTGGAGTACAGTGG - Intronic
1108557008 13:51603371-51603393 CTGGAGCAGCAGGAGCCTCAGGG + Intronic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109460022 13:62644294-62644316 CTGGGGCAGCAGGGGCCAGGTGG + Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111452846 13:88441543-88441565 CTGCAGCTGCAGGAGATAAGGGG - Intergenic
1111873795 13:93867673-93867695 GTGGAGCAGGAGAAGCAAATAGG - Intronic
1112609935 13:100946174-100946196 CTGGAGTAGCCTGAGCAAGGTGG - Intergenic
1113932514 13:113975795-113975817 CTGGAGCAACAAGGGCAAATGGG + Intergenic
1114056075 14:18967815-18967837 GGGGAGCGGCAAGAGCAAAGTGG + Exonic
1114106475 14:19433938-19433960 GGGGAGCGGCAAGAGCAAAGTGG - Exonic
1114106492 14:19434049-19434071 GGGGAGCAGCAAGAGCAACGTGG - Exonic
1114183226 14:20382306-20382328 CTGCAGCAGCAGGGGGACAGTGG + Exonic
1114614402 14:24060614-24060636 CTGCAGCATCTGGAGCACAGTGG - Exonic
1114755578 14:25255926-25255948 CTGGGTCAGCAGGATTAAAGAGG - Intergenic
1114773524 14:25455713-25455735 CTGGAGCAGGAGGAAGAAACAGG - Intergenic
1114968487 14:27995925-27995947 GTGGATCAGCAGGTGCAATGTGG + Intergenic
1115992223 14:39162084-39162106 CTTGGGCAGCAGAAGCAATGTGG - Intronic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116928343 14:50665040-50665062 CTTAAGCAGGATGAGCAAAGTGG + Intronic
1118297312 14:64582249-64582271 CTAGAGCAGCAGGGGGCAAGTGG + Intronic
1118395764 14:65335135-65335157 CTTGAACAGGAGGAGCAAGGCGG - Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1118891842 14:69916554-69916576 GTGGAGCAGCTGGGGCAAAGAGG - Intronic
1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG + Intronic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121643091 14:95499444-95499466 AGGGACCAGCAGGAGCAAAGGGG - Intergenic
1121776298 14:96593190-96593212 GTGGAGCAGAAAGAGCAGAGGGG + Intergenic
1121862609 14:97332484-97332506 GAGGAGCAGCAGTAGTAAAGAGG - Intergenic
1122100182 14:99402281-99402303 GTGAACCAGCAGGAGCAATGTGG + Intronic
1122454886 14:101842434-101842456 CTGGAGCATCCTGAGGAAAGGGG + Intronic
1123681800 15:22769096-22769118 GGGGAGCAGGAGGAGCAAATGGG - Intergenic
1123681806 15:22769117-22769139 CGGAAGCAGGAGGAGCAAATGGG - Intergenic
1123681814 15:22769159-22769181 CAGAAGCAGGAGGAGCAAATGGG - Intergenic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1123681840 15:22769306-22769328 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681878 15:22769516-22769538 GGGGAGCAGGAGGAGCAAATGGG - Intergenic
1123681884 15:22769537-22769559 GGGGAGCAGGAGGAGCAAATGGG - Intergenic
1123681890 15:22769558-22769580 CGGAAGCAGGAGGAGCAAATGGG - Intergenic
1123681916 15:22769726-22769748 CGGAAGCAGGAGGAGCAAATGGG - Intergenic
1123681930 15:22769810-22769832 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681974 15:22770059-22770081 CGGAAGCAGGAGGAGCAAATGGG - Intergenic
1123681982 15:22770101-22770123 CAGGAGCAGGAGGAGCAGATGGG - Intergenic
1124781132 15:32635153-32635175 CTGGAGCAGAGTGAGCAAGGGGG - Intronic
1125472335 15:40016405-40016427 CTGCAGGAGCAGGAGCACATGGG - Intronic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1126697132 15:51335888-51335910 ATGGAGCGTCAGGAGCAAGGAGG - Intronic
1127625092 15:60772657-60772679 GTAGAGCAACAGGAGCAAAAAGG - Intronic
1127983838 15:64053052-64053074 CTGGAGCAGCAGGAACCAAAGGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128414263 15:67429750-67429772 CTGACGCAGGAGGGGCAAAGGGG + Intronic
1128581636 15:68814519-68814541 GTGCAGCAGCAGCAGGAAAGAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1128795752 15:70465369-70465391 CAGGAGCATTAGGAGCACAGTGG - Intergenic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1130004817 15:80085063-80085085 CTTGAGGACCAGGAGGAAAGTGG - Intronic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1130550773 15:84888816-84888838 CAGGAGCAGCTGGAGCGAGGCGG + Exonic
1130711509 15:86286462-86286484 CTGGAGGAGCGGGAACAAGGGGG - Intronic
1130939715 15:88497407-88497429 TGGGAGAAGCAGGAACAAAGTGG + Intergenic
1131509257 15:93040424-93040446 CTAGAGCAGCAGCAGCAAAGGGG - Intronic
1132177153 15:99724919-99724941 CTGGCGGTGCAGGAGCAAGGAGG + Intronic
1132256832 15:100383538-100383560 CTGGTGCAGAAGGAGCCCAGGGG + Intergenic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133258699 16:4534644-4534666 CTGGGGAAGCAGGAGGAAATGGG - Intronic
1134083651 16:11341708-11341730 CTGGTGTAGCAGGGGCAAACTGG - Intronic
1134344755 16:13379453-13379475 CTGGAGCAGGAGGAGGGAAGTGG - Intergenic
1134809632 16:17156500-17156522 CCATAGCTGCAGGAGCAAAGTGG - Intronic
1135141939 16:19929404-19929426 TTGGAGCAGCTGGATCATAGAGG + Intergenic
1135297853 16:21298993-21299015 CTGGTGGAGTAGGAGGAAAGAGG - Intronic
1135467644 16:22701069-22701091 CTGGAGCAGCGCAAGCGAAGGGG + Intergenic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136390837 16:29963211-29963233 AAGGAGCAGCAGGATCAAAGTGG - Exonic
1137712240 16:50574488-50574510 CAGCAGCAGGAGGAGCAAAATGG - Intronic
1137783339 16:51115972-51115994 CAGGAGCAGCAGCAGCATACTGG - Intergenic
1137953916 16:52809815-52809837 GAGCAACAGCAGGAGCAAAGGGG + Intergenic
1137977196 16:53041952-53041974 CTGGAGGAGCAGGAGGGATGGGG - Intergenic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1140457283 16:75112755-75112777 CTGGGGCAGCAGGAGGCAAGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141873985 16:86809014-86809036 CCGGAGCAGCAGGAGGTGAGCGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142194977 16:88735208-88735230 CTGGCGCAGCAGGAGCCAGAAGG + Exonic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1142711712 17:1727150-1727172 CTGGAGGAGCTGGAGAAAACGGG + Exonic
1142756426 17:2019062-2019084 CTAGGGCTGCAGGAGCAGAGGGG - Intronic
1142919051 17:3168551-3168573 CTGGAAAAGCAGGTGCCAAGAGG + Intergenic
1142971514 17:3615022-3615044 AAGGAGCAGGAGGAGAAAAGAGG + Intronic
1144346500 17:14354460-14354482 CTGGAGCAGGGGGACCAAGGAGG - Intergenic
1144464641 17:15487570-15487592 CTGGGGCAGGAGGAGCCAGGAGG - Intronic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1145063748 17:19748292-19748314 CTGGAACGGCAAGAGCCAAGAGG + Intronic
1145769191 17:27480131-27480153 CTGGAGCAGGATGAGCAATGGGG - Intronic
1145889543 17:28405316-28405338 CTGGAGCAGCAGGCCCAGCGAGG + Exonic
1146791436 17:35752902-35752924 CAGCAGCAGCGGGAGGAAAGAGG - Intronic
1147727728 17:42577265-42577287 CTGGAGCAGCTGGCGCAACAAGG - Exonic
1147888267 17:43698997-43699019 CTGGAGCAGAAGGAGCCAGCAGG - Intergenic
1148062829 17:44848476-44848498 CTGGAGCACCAACACCAAAGTGG + Intronic
1150266877 17:63837747-63837769 CTGGAGCCCCAGGAACAAAGGGG + Intronic
1150590540 17:66558495-66558517 CTAGAGCACCCGGGGCAAAGGGG + Intronic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151675871 17:75597041-75597063 CTGGGACAGCAGCAGCGAAGGGG + Intergenic
1151765303 17:76130663-76130685 CAGGAGCAAGAGGAGCAGAGAGG - Intergenic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152743847 17:82030370-82030392 GTGGAGCTGCAGGAGCAGAACGG + Exonic
1152914442 17:83026151-83026173 CTGGCTGAGCAGGAGCAAAGGGG - Intronic
1203173685 17_GL000205v2_random:175307-175329 CTGGAGCAGCTGGAGCTAGGGGG + Intergenic
1153646183 18:7198105-7198127 CCGCAGCAGCAGGAGGAAATGGG + Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154027324 18:10720831-10720853 GTGGAGCAGCAGTAGTAAAGAGG - Intronic
1154239400 18:12638812-12638834 CTGGAGCAGGAGGAAGAAAGAGG - Intronic
1154436265 18:14344082-14344104 CTGAATCAGGAGGAGAAAAGAGG - Intergenic
1155135273 18:22985566-22985588 CTGGAGCAGAGTGAGTAAAGGGG + Intronic
1155449077 18:25944493-25944515 CTGGACCAGCATGGGCAAAATGG + Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1155925016 18:31646706-31646728 ATAGAATAGCAGGAGCAAAGAGG - Intronic
1156039360 18:32803015-32803037 CTGGAGGAGAAGAAACAAAGTGG - Intergenic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1157061005 18:44290406-44290428 CTGGAGCAGAAGGAGAACACTGG + Intergenic
1157556686 18:48617565-48617587 GTGGAGCAGGAGGAGTAAGGTGG + Intronic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159586657 18:70288983-70289005 CTGGAGGAGGAGGAGGAAGGAGG + Exonic
1159758573 18:72395983-72396005 CTGGAGCTGGAAGTGCAAAGAGG - Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160105870 18:75975657-75975679 ATGGAGCAGAATGAGCAAAGGGG + Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160631670 18:80250789-80250811 CTGAACCATCAGGAGCAAAAAGG + Intergenic
1160801803 19:973850-973872 CTGGAGCTGCTGGAGCAGAAAGG + Exonic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161267898 19:3373439-3373461 CTGGAGCAGAATGAGCAAGGGGG - Intronic
1161302226 19:3548204-3548226 CAGGTGCAGCAGGAGCCAGGCGG + Exonic
1161451115 19:4345929-4345951 CTGGTGCAGCCGGAGCCAGGTGG - Exonic
1161469131 19:4447677-4447699 CTGGAGCAGGAGGCACAGAGGGG - Intronic
1161644509 19:5444740-5444762 CTGCAGCAGAGGGAGCAAGGGGG - Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162589810 19:11584118-11584140 CTGGAGCAGAGTGAGCAAGGGGG + Intronic
1162779659 19:13000418-13000440 CTGGAGGAGGAGGAGGCAAGAGG + Intronic
1164767085 19:30780489-30780511 CAGAAGCAGAAGGAGCAAAGAGG - Intergenic
1165862670 19:38917460-38917482 GGGGAGCAGCAGGAGGAAAGGGG + Intronic
1166980292 19:46627935-46627957 CTGAAGCAGCAGGGAAAAAGAGG + Intergenic
1167259188 19:48448777-48448799 CTGGAGCAGAATGAACAAAAGGG + Intronic
1167687256 19:50964090-50964112 CTGGAGCAGAGGGAGAGAAGGGG - Intronic
1167932195 19:52874935-52874957 CTGGAGCAGAGGGAGCGAGGAGG + Intronic
1167963188 19:53123603-53123625 CTGGAGCAGAGGGAGCGAGGAGG + Intronic
1167970099 19:53183846-53183868 CTGGAGCAGAGGGAGCAAGGAGG + Intronic
1168274534 19:55270006-55270028 CTCGGGCAGCAGGAGCTGAGGGG + Intronic
1168635745 19:57995320-57995342 CTGGAGCAGCAAAAACAATGGGG + Intronic
1168719071 19:58544932-58544954 CTGGAGCTGCTGGAGCACTGCGG + Exonic
925695855 2:6577542-6577564 GTGGAGAAGCAGGGGCACAGTGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926167050 2:10527760-10527782 GTGAAGCAGCAGGAGAGAAGGGG - Intergenic
926402379 2:12511083-12511105 CTGCTGCATCAGGACCAAAGTGG + Intergenic
926610314 2:14940341-14940363 CTGGAGCAGGAGGAAAAGAGAGG - Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927715907 2:25352723-25352745 CTGGAGAAGCAGCAGAAATGGGG - Intergenic
927871001 2:26623712-26623734 CCGGAGCAGGAGGAGGGAAGAGG + Intronic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928493913 2:31812546-31812568 CAGGAGCAGAAGGAGTAAAGAGG + Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929803867 2:45127765-45127787 CTCCATCAGCAGGAGTAAAGAGG + Intergenic
932476194 2:72007647-72007669 GGGCAGCAGCAGGGGCAAAGTGG + Intergenic
932558524 2:72846832-72846854 CTGGTGTAGCAGGAGCAGAGAGG + Intergenic
933576384 2:84073477-84073499 TTGGAGCAGCCAGAGCAATGTGG - Intergenic
933699443 2:85244092-85244114 AGGGAACAGCAGGTGCAAAGGGG + Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933852885 2:86385271-86385293 CCAGAGCAGCAGGAGCCAAGGGG - Intergenic
935434272 2:103011761-103011783 CTGAGGCTGCAGGAGTAAAGGGG - Intergenic
936471400 2:112801910-112801932 CAGGACCACCAGGAGCAAACTGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937287905 2:120764631-120764653 CTGCAGCAGCCTGCGCAAAGGGG - Intronic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938286241 2:130120164-130120186 GGGGAGCAGCAAGAGCAAGGTGG - Exonic
938402492 2:131005022-131005044 CTGGAACAGCTGCAGCAAAGGGG + Intronic
939329424 2:140738180-140738202 ATGGATCAGCAGGTGAAAAGAGG + Intronic
940449962 2:153824834-153824856 CTGGAGCAGGAGGGACAGAGAGG - Intergenic
941283989 2:163586182-163586204 GTTGAGCAGAAGGAGTAAAGGGG + Intergenic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
943611893 2:190044516-190044538 CTGCAGAGGCAGTAGCAAAGAGG + Intronic
944202228 2:197119960-197119982 ATAGAACAGCATGAGCAAAGAGG - Intronic
944305410 2:198173426-198173448 CAAGAGCAGCAGGAGGAACGTGG - Intronic
944417443 2:199492973-199492995 CTGGAGTAGCATGAGCAGGGAGG + Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945923451 2:215779644-215779666 TTGAAGCAGCAGCAGCAATGAGG - Intergenic
946220462 2:218221531-218221553 CTGGGGCTTCAGGACCAAAGTGG - Intronic
946790695 2:223297949-223297971 CTGGGGTGGCAGGAGCCAAGTGG + Intergenic
947988536 2:234468679-234468701 CTGGAGCAGCAGGAGCTCTGCGG - Intergenic
948154867 2:235773133-235773155 TGGGAGCAGCCGGAGCATAGGGG + Intronic
948283811 2:236769017-236769039 CTGGAGAGGAAGGAGCCAAGGGG + Intergenic
948631731 2:239306976-239306998 CAGGAGCCGCAGGACCATAGGGG + Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1169172140 20:3473422-3473444 CAGGAGCAGAGAGAGCAAAGGGG + Intronic
1169515301 20:6310460-6310482 CCAGAGCAGCATGAACAAAGTGG + Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1171119747 20:22558104-22558126 CTAGACAAGAAGGAGCAAAGAGG - Intergenic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1171993601 20:31715412-31715434 CTGGAGAAGAAACAGCAAAGGGG - Intronic
1172112743 20:32556876-32556898 CTGGTGCAGAAGGAGCAAGGTGG - Intronic
1172327184 20:34045434-34045456 CTGGAGTAGCAGCAGTAAAGAGG + Intronic
1172657072 20:36543822-36543844 CTGGAGAAGAAAGAGCACAGGGG + Intronic
1172784068 20:37454455-37454477 CTGGAGCAACATGAGCAAGGGGG - Intergenic
1173466085 20:43282497-43282519 CTGGAGCAGAAGAAACAAAGAGG + Intergenic
1173669355 20:44787177-44787199 CTGGAGCAGACAGAGCAAGGGGG + Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174080961 20:47970496-47970518 CTGGAGCAGCAAGACCAACAGGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175496332 20:59417050-59417072 CAGGAGCAGCCTGAGCACAGGGG - Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1175732790 20:61365455-61365477 CTGGGGTATGAGGAGCAAAGGGG + Intronic
1176625516 21:9088205-9088227 CGGGAGCCGCAGGAGCCAAACGG + Intergenic
1176840775 21:13841557-13841579 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1177731379 21:25031071-25031093 GTGGAGCAGCAGAAACAAAAGGG + Intergenic
1178418479 21:32423921-32423943 CTGGGGCTGGAGGAGCAGAGAGG + Intronic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1178518570 21:33268180-33268202 CTGGAGGGGCAGGAGTAAAATGG - Intronic
1178756290 21:35353292-35353314 CTGGTGAAGCAGGCCCAAAGGGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179713299 21:43275156-43275178 CTGGAGCTCTGGGAGCAAAGTGG + Intergenic
1179772902 21:43636999-43637021 CTGGAACAGGACGAGCGAAGTGG + Intronic
1180839446 22:18952310-18952332 CTGGAGGGGCAGGAGCAAGGAGG + Intergenic
1181409527 22:22709226-22709248 ATGAAGAACCAGGAGCAAAGAGG + Intergenic
1181433304 22:22895725-22895747 CTGGAGCTGCAGGATCCCAGGGG + Exonic
1181540972 22:23573213-23573235 CTGGAGCTGCAGGATCCCAGGGG - Exonic
1181549273 22:23627700-23627722 TCAGAGCAGCAGGAGCCAAGGGG + Intronic
1181550879 22:23638572-23638594 CTGGAGCTGCAGGATCCCAGGGG - Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181797407 22:25320117-25320139 CTGGAGCTGCAGGATCCCAGGGG + Intergenic
1181886238 22:26024438-26024460 CTGGAGCAGCATGAGCAAGAGGG + Intronic
1182474550 22:30569564-30569586 GAAGAGCAGTAGGAGCAAAGAGG + Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183579683 22:38716499-38716521 CTTGAGCCGGAGGAGCACAGTGG - Intronic
1184041993 22:41949762-41949784 CAGGAGCAGCAGGAACCCAGGGG + Intergenic
1184404622 22:44292881-44292903 CTGCAGGAGCAGGAGCCATGAGG - Intronic
1184451532 22:44585635-44585657 CTCCAGCAGCAGGAGCCAGGGGG + Intergenic
1184487957 22:44792515-44792537 CTGGAGGAGCAGGAGGGCAGGGG - Intronic
1184513023 22:44944050-44944072 GTGGAGCAGCAGGAGGGTAGAGG - Intronic
1184537078 22:45094546-45094568 CAGGAGGAGGAGGAGGAAAGTGG - Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
950247819 3:11438141-11438163 CTGGAGCAGCAGGACCTCAGGGG - Intronic
951808637 3:26675415-26675437 CTGGAGCACCAGGAAGACAGTGG - Intronic
952076785 3:29706477-29706499 CTGGAGCAGGAGGTGAAGAGGGG + Intronic
953487673 3:43317626-43317648 CTGGAGCCGAAGGAGCAACCAGG - Intronic
953799502 3:46011487-46011509 CTGGAGTTGCAGGAGGAAACTGG + Intergenic
953875978 3:46667144-46667166 CTGGAGCTGCAGTAGGCAAGGGG + Intergenic
954257732 3:49418074-49418096 CTGGAGTAGCCCAAGCAAAGGGG - Intronic
954379085 3:50210170-50210192 CTGGAGGAGCAGGTGGACAGAGG + Intronic
954820311 3:53320921-53320943 GTGGAGCAGGAATAGCAAAGAGG - Intronic
955915952 3:63908351-63908373 CTGGAGAAGAACGAGGAAAGGGG + Intronic
956017726 3:64901706-64901728 CTGAATCAGCAGGAGCAACCAGG - Intergenic
956491108 3:69773225-69773247 CTGGACCAGGCTGAGCAAAGTGG + Intronic
956502131 3:69898340-69898362 CTGGAGGAGCAACAGCAAAGGGG + Intronic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
957198645 3:77103086-77103108 ATGGAGCAGAAGGAGCACAGGGG + Intronic
959037333 3:101383312-101383334 CTGGAGCAGCTGCTGCAAAGAGG + Intronic
959664682 3:108907610-108907632 CAGATGCAACAGGAGCAAAGAGG + Intergenic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960054213 3:113265082-113265104 AGGGTGCAGCAGGAGCCAAGAGG + Intronic
960333631 3:116391712-116391734 CTGGAGCGGCTGGAGCATGGGGG + Intronic
960620512 3:119632420-119632442 CTGCAGCAGAGTGAGCAAAGTGG - Intergenic
960864732 3:122187816-122187838 CTGAAGCATAAGGAGCCAAGAGG + Intronic
961819849 3:129570456-129570478 GGGGAGCAGGAGGAGCAGAGAGG - Intronic
962412236 3:135151357-135151379 CTGGAGCAGCCAGGACAAAGGGG - Intronic
963199863 3:142575177-142575199 CTGGAGCACAGGGAGTAAAGAGG - Intronic
963346600 3:144102405-144102427 CAGGAGAAGCAGTAGAAAAGTGG - Intergenic
963839522 3:150091277-150091299 GTGGAGAAGCAGCAGCAAACTGG + Intergenic
963900444 3:150727934-150727956 CTGGAGCAGCAGGTTCTTAGGGG - Intergenic
963921184 3:150907510-150907532 GTGGAACAGCGGGAGCACAGGGG + Intronic
966964208 3:184972712-184972734 GTTGAGCAGCAGGTGCAAGGTGG + Intronic
967811272 3:193762966-193762988 CTGGAGCAGCTGGAGTGATGAGG - Intergenic
968265987 3:197363813-197363835 CTGGAAGAGCAGAATCAAAGTGG + Intergenic
968333227 3:197889709-197889731 CTGGAGCTGGAAGAGAAAAGGGG + Exonic
968522699 4:1041215-1041237 CGGGAGCAGCAGGAGGGGAGCGG - Intergenic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
969937448 4:10696329-10696351 ATGGAGCAGATGCAGCAAAGGGG - Intergenic
970368429 4:15384554-15384576 CTGGAGCCTCACCAGCAAAGAGG + Intronic
970539152 4:17060019-17060041 CTGGAGCAGCAGTGGCATACAGG + Intergenic
971345436 4:25807787-25807809 CTGGAGAAGAAGGAACAAAAAGG + Intronic
971405034 4:26314604-26314626 TGGGAGCAGCAGGACCAAGGCGG - Intronic
972122534 4:35723367-35723389 TTGGGGGAGCAGGATCAAAGAGG - Intergenic
973177881 4:47230456-47230478 CTAGAGCAGCAGGAAGAGAGAGG + Intronic
973182467 4:47286508-47286530 CTGGCGTAGCAGGAGCACAGGGG - Intronic
975309920 4:72892223-72892245 CTGGAGCATTAGTAGCAATGTGG - Intergenic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
976392011 4:84515570-84515592 CTTGAGCAGAAGGAACAAGGTGG + Intergenic
976855456 4:89599707-89599729 CTGGTGCACTAGAAGCAAAGAGG - Intergenic
977831284 4:101596594-101596616 ATGGAGCAGAAGTAGCAAATAGG - Intronic
979074988 4:116259923-116259945 CTGGAGCTACAGGGGCCAAGTGG + Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
981069787 4:140523181-140523203 CTGGAGGAGAAAGAGCAAGGGGG - Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981366585 4:143911377-143911399 CTTAAGCAGGACGAGCAAAGTGG + Intergenic
981747194 4:148063256-148063278 CAGTAGCAGGAGGAGAAAAGGGG - Exonic
982615349 4:157633998-157634020 CTGGAGCAGCAGTGGCTATGAGG + Intergenic
984019964 4:174473741-174473763 CTGGACCCGGAGGAGCAAAGGGG + Intergenic
984347181 4:178543441-178543463 CTGGAGCATGAGCAGCAAAATGG + Intergenic
984591124 4:181618930-181618952 GTGGATCTGCAGGGGCAAAGTGG - Intergenic
984934935 4:184881824-184881846 CTGGAGCAGAGGGAGCAAGTGGG + Intergenic
984951335 4:185009973-185009995 CTGGACCAGGAGGGGCACAGGGG - Intergenic
985705305 5:1397117-1397139 CTGGAGGACCTGGGGCAAAGTGG + Intronic
986018518 5:3779378-3779400 GTGAACCACCAGGAGCAAAGAGG - Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986456718 5:7927398-7927420 CTGGGGGGACAGGAGCAAAGTGG - Intergenic
987246472 5:16054195-16054217 CTGGTGCAGCAGATGCAATGAGG + Intergenic
988581571 5:32473282-32473304 CTGGAGGAGAAGGAGCCAACAGG - Intergenic
989377008 5:40774575-40774597 AAGGAGAAGCAGGAGTAAAGGGG + Intronic
989668228 5:43882062-43882084 CTGGGGCAGAATAAGCAAAGAGG + Intergenic
990184379 5:53197753-53197775 CTGGAGAAGTAGCAGGAAAGAGG - Intergenic
990900814 5:60747020-60747042 CTGGAGCAGAGGGAACAAAGTGG + Intergenic
991117949 5:62976018-62976040 GAAGAGCAGCAGGAGCAAAGAGG - Intergenic
991172582 5:63646018-63646040 CTGGAGCAGGAGGAAGACAGAGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992460445 5:76954625-76954647 GTGGACCAGCAGGAGCGAGGCGG - Intronic
992622989 5:78611578-78611600 CTGGGGCAGAAGGAGCCCAGAGG + Intronic
992635920 5:78725970-78725992 ATGGAGCAGAAGGGGCACAGAGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993344827 5:86769840-86769862 CTGGAGCAGGAGGAAAAGAGAGG + Intergenic
994026483 5:95090429-95090451 CTGGAGCAGCAGCATTTAAGCGG - Intronic
994093145 5:95826083-95826105 CTAGAGCAGCAGGAGCAGTCAGG - Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
994146479 5:96401322-96401344 CTGGAGCAAAAGCACCAAAGTGG + Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994558725 5:101339066-101339088 CTGGACCAGGAGGAAGAAAGAGG + Intergenic
994828075 5:104742415-104742437 CTGGAAAAACAGTAGCAAAGAGG - Intergenic
995838534 5:116421801-116421823 CTAGAGCAGAAGGAGGGAAGGGG + Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997766172 5:136505921-136505943 CTGCAGCTGCAGGAGCAACATGG + Intergenic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
999138202 5:149337965-149337987 CCAGAGCAGCTGGAGCAAAGAGG + Intronic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
999452463 5:151688615-151688637 CTGGAGCAGCGTGGGCACAGAGG - Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001483669 5:172105143-172105165 GTGGGGGAGCAGGAGCACAGGGG - Intronic
1002301890 5:178262040-178262062 CTGGAGGGGCAGGTGCACAGGGG + Intronic
1003330424 6:5124278-5124300 GGGCAGCAGCAGGAGAAAAGTGG - Intronic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004413704 6:15405199-15405221 CTGGAACAGCAGCATCAAAATGG - Intronic
1005060888 6:21776138-21776160 GTGGAGCAGCAGGGGTACAGTGG - Intergenic
1006520529 6:34568599-34568621 GTGGAGTAGGAGGGGCAAAGGGG + Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1006931270 6:37690080-37690102 CTGGAGCAGAATGAGCCAGGGGG - Intronic
1008004383 6:46394684-46394706 CTGGAGCATTTTGAGCAAAGGGG + Intronic
1008701482 6:54105842-54105864 CTGGAGTTGAAGGAGAAAAGGGG + Intronic
1010007540 6:71011859-71011881 ATGAAGAAGCAAGAGCAAAGGGG - Intergenic
1010473018 6:76252097-76252119 CTGGGGCAGCAGGAGTGAGGAGG + Intergenic
1011206696 6:84906658-84906680 GTGGAGGAGCATGAGCCAAGGGG + Intergenic
1011571892 6:88746699-88746721 CTGCAACAGCAGGAGGTAAGTGG - Intronic
1011699563 6:89942878-89942900 CAGGAGCAGCAGGACCGAGGTGG + Intronic
1011805959 6:91072654-91072676 ATGTGGCAGCAGGAGAAAAGTGG - Intergenic
1013300734 6:108802935-108802957 CTGGAGCAGAATGAGTAAAGGGG + Intergenic
1013812908 6:114064848-114064870 CTGGAGGAGGAGGAGCAAGGAGG + Intronic
1014574224 6:123050614-123050636 CTGGAGCAGAATGAGCTATGGGG + Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014814227 6:125917743-125917765 CTGGAGAGGAAGGAGAAAAGAGG + Intronic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015992891 6:138966281-138966303 CTGGTCAAGCAGGAGCAAATGGG + Intronic
1016144052 6:140647589-140647611 CTGAGGCAGCAGGGGCCAAGTGG + Intergenic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1017311613 6:152982901-152982923 CTGGCGCTGCAGGAGCAGCGGGG + Exonic
1017530740 6:155289901-155289923 CTGGAGCAGTAGGAAGAGAGTGG - Intronic
1017987916 6:159460668-159460690 CTGGAGCTGCAGGAGCAGGTAGG - Intergenic
1018720423 6:166567797-166567819 CTAGACCAGCAGGAGACAAGAGG + Intronic
1018953877 6:168395251-168395273 CTGGAGCAGCAGGCGGGGAGGGG - Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020980053 7:15055588-15055610 GTGGAACAGTAGGTGCAAAGAGG + Intergenic
1021217537 7:17935358-17935380 CTGGAGAAGAGGGAGCAATGGGG + Intronic
1021410042 7:20320033-20320055 ATGGACCAGCAGGGGGAAAGTGG - Intergenic
1021554750 7:21908038-21908060 CAGCAGCTGTAGGAGCAAAGTGG + Intronic
1021981614 7:26060876-26060898 CTGTAGAGGAAGGAGCAAAGAGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022561918 7:31358329-31358351 ATGGATCAGAAAGAGCAAAGCGG - Intergenic
1022992462 7:35721860-35721882 CTGGACAAGCAGGAAGAAAGAGG - Intergenic
1023178225 7:37454343-37454365 GTGGAACAGCTGGAGCAGAGGGG - Intergenic
1023313039 7:38907253-38907275 AAGGAACAGCATGAGCAAAGAGG + Intronic
1023623102 7:42092367-42092389 CTGGAGCAGCAAGAGGACACAGG + Intronic
1023689830 7:42774283-42774305 CTGGAGCAGGAGGTGGAAATTGG - Intergenic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1025987969 7:66472721-66472743 CTGAAGCAGGAGGAACAAATTGG - Intergenic
1027210958 7:76148624-76148646 CTGAAGCAGGAGGAACAAATTGG - Intergenic
1027263723 7:76482633-76482655 CTGGAGCAGCAGGTGGCCAGGGG + Exonic
1027315098 7:76980746-76980768 CTGGAGCAGCAGGTGGCCAGGGG + Intergenic
1028841423 7:95433736-95433758 ATAGTGCAGCAGGAGCAAAGGGG - Intronic
1030300315 7:107967994-107968016 CAGGAATAACAGGAGCAAAGAGG + Intronic
1030595218 7:111530046-111530068 CAGAAGCAGCATCAGCAAAGAGG + Intronic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1031528848 7:122852688-122852710 CTGGAGCAGAGAGAGCAAGGGGG + Intronic
1031767654 7:125801930-125801952 CTTGGGCAGCAGGTACAAAGTGG + Intergenic
1031890741 7:127290731-127290753 ATGGAGCTGCAGGACCTAAGAGG - Intergenic
1032329919 7:130968596-130968618 CTTGAGCAGCAGGAGAAATGAGG - Intergenic
1032437314 7:131910717-131910739 CTGCAGGAGCAGAAGCGAAGGGG - Intergenic
1032699077 7:134363006-134363028 CTGGGCAAGCAGAAGCAAAGCGG - Intergenic
1032710074 7:134453408-134453430 CTGGAGCTGCTGCAGGAAAGTGG + Intronic
1033078608 7:138272771-138272793 CTGGAGCAGGAGGAACAGTGGGG + Intergenic
1034086124 7:148324261-148324283 GCAGAGGAGCAGGAGCAAAGGGG + Intronic
1034354589 7:150442761-150442783 CGGGTGCAGCATGTGCAAAGGGG - Intergenic
1034732253 7:153398105-153398127 CTGCAGCAGCAGGCACAATGTGG - Intergenic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035175767 7:157049510-157049532 GGGGAGCAGTAGGAGCAAATGGG + Intergenic
1035820772 8:2589384-2589406 GTGGAGGATCAGGAGAAAAGAGG - Intergenic
1036244034 8:7101559-7101581 CAGGGGTAGCAGGAGGAAAGGGG - Intergenic
1036897809 8:12649868-12649890 CAGGGGTAGCAGGAGGAAAGGGG + Intergenic
1036913713 8:12784429-12784451 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1037417824 8:18670259-18670281 CTGGTGCGGCTGGAGCAAATGGG + Intronic
1037728470 8:21503947-21503969 CAGGAGGAACAGGAGCAAAAAGG + Intergenic
1037810004 8:22081488-22081510 CTGAAGCAGCAGGGGTAAGGGGG - Exonic
1038355198 8:26822849-26822871 CTGGAGCAGAAGCAAGAAAGTGG + Intronic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1038851737 8:31285316-31285338 CTGGGCCAGCAGGAGGAAAGGGG - Intergenic
1039937256 8:42056430-42056452 CTGGAGCAGCAGCAAAAAAGAGG - Intergenic
1040516077 8:48136298-48136320 ATGGAGCAGGATGAGCAAGGTGG - Intergenic
1040934883 8:52772162-52772184 CTGGAGGAGAAGGAGCTAAGAGG + Intergenic
1040965572 8:53077847-53077869 CTGGACCAGCAGCTGCATAGGGG - Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041696795 8:60744375-60744397 TTGGACCAGAAGGATCAAAGTGG + Intronic
1041934081 8:63317650-63317672 ATGAATCTGCAGGAGCAAAGAGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1044826737 8:96205790-96205812 CTGGAGCAGGAAAAGCAAGGAGG - Intergenic
1044894913 8:96881344-96881366 TGGCAGGAGCAGGAGCAAAGGGG + Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1045204707 8:100026145-100026167 CTATAAAAGCAGGAGCAAAGGGG + Intronic
1045638400 8:104220317-104220339 CTGAAGCTGCAGGAGGGAAGTGG + Intronic
1047126819 8:121971864-121971886 CTGGAGCAAAAAGTGCAAAGGGG + Intergenic
1047733771 8:127748129-127748151 CTGAAGATACAGGAGCAAAGGGG + Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047948298 8:129905102-129905124 CTGGAGCAGAAGTTGCAAACTGG - Intronic
1048504279 8:135006648-135006670 CTGGTGCAGCAGAAACAAAATGG + Intergenic
1048850181 8:138637329-138637351 CAGGAGCAGCAGCACCAAACGGG + Intronic
1049276840 8:141724248-141724270 AGAGAGCAGCAGGAGCACAGCGG + Intergenic
1049318096 8:141980394-141980416 GTGCAGCAGCAGGAGCCACGTGG + Intergenic
1049391197 8:142372567-142372589 TGTGAGCAGCAGGGGCAAAGGGG + Intronic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1050135164 9:2455319-2455341 CTAGAGAAGCATGAGCAAGGAGG - Intergenic
1051136013 9:13922383-13922405 CTGGAGCAAGAGGAGAAAGGAGG - Intergenic
1051190882 9:14510955-14510977 CTGAAGCAGCATCATCAAAGAGG - Intergenic
1051807893 9:21016578-21016600 AGGGAGCAGCCTGAGCAAAGAGG + Intronic
1051921500 9:22271961-22271983 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1052706298 9:31997424-31997446 ATGGAGCAGCAGCTGCAATGGGG + Intergenic
1053593384 9:39534591-39534613 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1053851118 9:42289299-42289321 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054452691 9:65411870-65411892 CTGGCACAGCAGGAGGGAAGGGG + Intergenic
1054572922 9:66830686-66830708 CTGGAGCTGCTGGAGCAGAAAGG + Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056795989 9:89659346-89659368 CTGAAGCAACAGGACCACAGAGG - Intergenic
1056858647 9:90158859-90158881 CTGGAGGAGCAGGCGCCTAGAGG + Intergenic
1057396991 9:94689340-94689362 CTGGAACAGCAGGTGCTGAGGGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058707342 9:107648292-107648314 CTGGAGGAGCAGCAGTTAAGAGG - Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058910775 9:109518152-109518174 CAGGAGCAGAGGGAACAAAGAGG - Intergenic
1059565387 9:115379454-115379476 CTGCTGCAGCAGGAGCAAGTGGG + Intronic
1059902822 9:118947174-118947196 CTGGAGCAGTTGGAGCAATCTGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060271360 9:122144461-122144483 TTGTAGCAGCGGGAGCAATGAGG - Intronic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1060807294 9:126585793-126585815 CTGGAGAAGGAGGAGCCAGGGGG + Intergenic
1060969538 9:127730361-127730383 CTGCTGCAACAGGAGCACAGAGG + Intronic
1060976873 9:127770252-127770274 CTGGAGCAGGAGGAAGGAAGGGG - Intronic
1061669387 9:132180127-132180149 CTTGGGCAGCAGGAGGGAAGTGG - Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062271911 9:135713727-135713749 CAGGAGAAGCAGGAGCTGAGGGG - Intronic
1203530553 Un_GL000213v1:138936-138958 GGGGAGCAGCAAGAGCAACGTGG - Intergenic
1186660516 X:11664515-11664537 GTGGAGAAGGACGAGCAAAGAGG + Exonic
1187246354 X:17555877-17555899 CTGGAGGAACAGGAACAAACCGG + Intronic
1187617168 X:21009298-21009320 CTGGAACAGCATGTGCCAAGGGG - Intergenic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1188675778 X:32937322-32937344 CTGCAGCAGGAGGAGTACAGTGG - Intronic
1189048009 X:37613931-37613953 CTGAAGTAGCAGGAAGAAAGGGG - Intronic
1190129425 X:47733352-47733374 CTGGAACAGCAGGTGTAAACTGG + Intergenic
1190214387 X:48470074-48470096 CTGGAGGGACAGGAGAAAAGAGG + Exonic
1190428465 X:50354729-50354751 CTGGAGGAACAGTAGCCAAGAGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1191926130 X:66312033-66312055 CTGGAGCAGAAGAATCCAAGTGG - Intergenic
1192034126 X:67545301-67545323 CTGCTGCAGCAGCAGCAAACTGG - Exonic
1192200261 X:69062089-69062111 CTGGAGCTGCGTGAGCATAGTGG + Intergenic
1192582785 X:72298908-72298930 CTTGAGAAACAGGAGCACAGAGG - Intronic
1192789572 X:74368195-74368217 CTGGGGCAGCAGGGGCCAAATGG - Intergenic
1192858615 X:75040748-75040770 CTGCAGCAGCAGGGGCCATGTGG - Intergenic
1193574756 X:83184050-83184072 CTGGATAGGGAGGAGCAAAGGGG + Intergenic
1193915046 X:87353746-87353768 CAGAGGCAGCAGGAGCCAAGTGG - Intergenic
1195127415 X:101822281-101822303 CTGGGCCAGGAGCAGCAAAGCGG - Intergenic
1195701089 X:107706382-107706404 GAGGAGGAGCAGGAGCAAAGAGG - Intergenic
1195749474 X:108149829-108149851 TGTGAGCAGCAGTAGCAAAGAGG - Intronic
1195942848 X:110179674-110179696 CAGGTGCTGTAGGAGCAAAGTGG - Intronic
1196679096 X:118452620-118452642 CTGGAGCACATGGAGCACAGTGG - Intergenic
1197178027 X:123505201-123505223 CAGGAGAAGGAAGAGCAAAGAGG + Intergenic
1197804254 X:130384359-130384381 CTAGATCAGCAGGAGCTAGGGGG - Intergenic
1197812238 X:130455524-130455546 TGGCAGGAGCAGGAGCAAAGGGG - Intergenic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198443221 X:136684786-136684808 ATGGAGCAGAAGGAGCAAATTGG - Intronic
1198963135 X:142203671-142203693 GAGGAGCAGCAGGAGCTCAGAGG + Exonic