ID: 1179085622

View in Genome Browser
Species Human (GRCh38)
Location 21:38215056-38215078
Sequence GACTTCGTTGAGTTGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179085622_1179085626 10 Left 1179085622 21:38215056-38215078 CCACCACCCAACTCAACGAAGTC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1179085626 21:38215089-38215111 CAGCTAGATCATCATTCCTTTGG 0: 1
1: 0
2: 1
3: 18
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179085622 Original CRISPR GACTTCGTTGAGTTGGGTGG TGG (reversed) Intronic
901231903 1:7646219-7646241 GGCTATGGTGAGTTGGGTGGAGG + Intronic
901231920 1:7646288-7646310 GGCCACGGTGAGTTGGGTGGAGG + Intronic
901231933 1:7646330-7646352 GGCCACGGTGAGTTGGGTGGAGG + Intronic
901231991 1:7646548-7646570 GGCTGTGGTGAGTTGGGTGGAGG + Intronic
901232053 1:7646806-7646828 GGCCCTGTTGAGTTGGGTGGAGG + Intronic
909075082 1:71043583-71043605 GCATTCGTTAAGTTGGGTGTAGG - Intronic
909817347 1:80012758-80012780 AACATCGTTGAGTTGGTTTGTGG + Intergenic
916722361 1:167494024-167494046 GGCTCTGCTGAGTTGGGTGGGGG + Intronic
922978059 1:229801537-229801559 GCCTGAGTTGAGTTGGGGGGTGG + Intergenic
924591379 1:245407678-245407700 GACTTAATTTAGTTGGGTTGGGG - Intronic
1063202953 10:3802286-3802308 GACTTCCTGGTCTTGGGTGGGGG + Intergenic
1067457855 10:46435703-46435725 GACTGCTTTGAGCTGGGAGGTGG - Intergenic
1067629347 10:47948936-47948958 GACTGCTTTGAGCTGGGAGGTGG + Intergenic
1072275159 10:93815808-93815830 TACTTCAGTGAGGTGGGTGGGGG - Intergenic
1077182010 11:1220934-1220956 GACGTCGGTGGGGTGGGTGGGGG + Intergenic
1078896005 11:15597804-15597826 GCCTTTGTTGAATTGGGAGGGGG - Intergenic
1079027563 11:16961013-16961035 GCCTTCCTTGAGTGGGGTGGAGG - Intronic
1080450352 11:32374259-32374281 GACTTCATAGAGTTGTTTGGGGG - Intergenic
1083889756 11:65589879-65589901 GACTTCCTGGGGGTGGGTGGTGG + Intronic
1085040865 11:73325487-73325509 GCCTGTGTTGAGATGGGTGGGGG - Intronic
1088913704 11:114211273-114211295 GACTTGGTGGTGTGGGGTGGAGG + Intronic
1089298395 11:117483190-117483212 GTGTTCATTGAGTTGGGCGGAGG - Intronic
1090946169 11:131431368-131431390 AACTTAGTTGAGTTGGTGGGTGG + Intronic
1092693384 12:11141779-11141801 AACTTCCTTGTTTTGGGTGGAGG + Intronic
1095726103 12:45454812-45454834 GACTTCTTTCACTTTGGTGGTGG + Intergenic
1097544608 12:60983087-60983109 GAGTCCATTCAGTTGGGTGGGGG + Intergenic
1098626552 12:72678218-72678240 GTCTTCGTGGAGTTGGGGGAGGG - Intergenic
1100591064 12:96030064-96030086 GACTTTGTTGATCGGGGTGGGGG - Intronic
1104019619 12:124983040-124983062 GGCTTCTTTTAGTTGGGTGAGGG + Intronic
1104545180 12:129704585-129704607 GCCTTCTGTGAGTTGGGTGCAGG - Intronic
1105786382 13:23753681-23753703 GACTTCCTTGAATAGGGTGTTGG + Intronic
1109062343 13:57633894-57633916 GACTTGGTGGAGTTGAGGGGAGG - Exonic
1111559634 13:89928697-89928719 GATTTCATTCAGTTGGTTGGGGG - Intergenic
1126696508 15:51330297-51330319 GACATCGTTGAGGTGTGTTGTGG + Intronic
1132734443 16:1378644-1378666 GACTTGGCTGAGGTAGGTGGTGG - Intronic
1141330570 16:83107301-83107323 GAGTTCGTTGGGGTTGGTGGTGG + Intronic
1143867790 17:9936480-9936502 GAGGACGTTGTGTTGGGTGGGGG - Intronic
1146679739 17:34798486-34798508 GACTTCCTTTATTGGGGTGGGGG - Intergenic
1148566979 17:48639145-48639167 GACTTCTGTTAGTGGGGTGGTGG - Intergenic
1152808226 17:82368347-82368369 AACTTCTTTGATTTGGGTGAGGG + Intergenic
1155050868 18:22146632-22146654 GAGTTCGTTGAGATGGGTGAAGG - Intergenic
1160768820 19:821474-821496 TACTTCGTGGAGGTGGGTGGGGG - Exonic
1161374400 19:3931874-3931896 GACTTTGTTGAGGCGGGTGAGGG - Intergenic
1162866415 19:13551202-13551224 GAGTTGGTTGAGTTAGGTTGGGG - Intronic
1163047205 19:14652369-14652391 GAAATCGTTGAATTGGGTGATGG + Intronic
1164490367 19:28706918-28706940 GACTCCATTGAGTTGGAAGGTGG - Intergenic
1164852296 19:31494191-31494213 GCCTCTGTGGAGTTGGGTGGAGG - Intergenic
1167533545 19:50033995-50034017 GACATCTTTGTGTGGGGTGGCGG + Intronic
930285535 2:49423036-49423058 GACTTCCTAGGGTTGGGTCGTGG + Intergenic
936316050 2:111425102-111425124 GACTTCCATGAGTTAGGAGGTGG - Intergenic
938713265 2:133993633-133993655 GACTTTATTGTATTGGGTGGGGG + Intergenic
941454123 2:165695322-165695344 TACTACCTTGATTTGGGTGGGGG + Intergenic
942938147 2:181583298-181583320 TAATTTGTTGAGTTGGGGGGTGG - Intronic
943135173 2:183901632-183901654 GTGTTCATTCAGTTGGGTGGAGG - Intergenic
947432593 2:230044019-230044041 GACTTCGGTGTTTTGGGGGGTGG - Intronic
948666285 2:239536561-239536583 GAGTCTGTTGAGCTGGGTGGAGG - Intergenic
1170958550 20:21003901-21003923 GTCTGCTTTGTGTTGGGTGGGGG - Intergenic
1173862530 20:46293590-46293612 GACTTCGTGGAATAGGGTTGTGG - Intronic
1174640533 20:52040114-52040136 AACTTCCTGGAGTTGGGCGGGGG + Intergenic
1176153326 20:63604750-63604772 GGCTTCCTTGAGCTGGGAGGAGG + Exonic
1178373173 21:32044522-32044544 CACTTCGTGGAGTGGGGAGGCGG - Intronic
1179085622 21:38215056-38215078 GACTTCGTTGAGTTGGGTGGTGG - Intronic
1179627280 21:42655819-42655841 GACCTCGTGGAGATGGGGGGCGG - Intronic
1179882927 21:44300807-44300829 GACTTGGCAGAGCTGGGTGGGGG + Intronic
1181730545 22:24843261-24843283 GACTTGGTTGTGTGGGGTGGGGG + Intronic
1183148169 22:36014617-36014639 GACTTTCTTGAGTTTGGTGTAGG - Intronic
1184474705 22:44714233-44714255 GACTTGGATGTGTTGGGGGGTGG + Intronic
1203296405 22_KI270736v1_random:46745-46767 GTCATCGTTGTGTTGGGTGTTGG + Intergenic
949592732 3:5510669-5510691 CACAGCGTTGAGTTGGGTTGTGG - Intergenic
951704596 3:25530793-25530815 GACATCTTTGAGTGGGATGGGGG + Intronic
951945251 3:28128713-28128735 GACTACCTTTGGTTGGGTGGAGG - Intergenic
952823504 3:37505618-37505640 CACTTCCTTGATCTGGGTGGTGG + Intronic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
955863648 3:63358649-63358671 GACATTGTTCAGTTGCGTGGAGG + Intronic
957658550 3:83116028-83116050 CACTTTGTTGAGTTTGGTGTTGG - Intergenic
957885303 3:86280457-86280479 GACTTCTTTCTTTTGGGTGGAGG - Intergenic
961794234 3:129398118-129398140 GAGTCCATTCAGTTGGGTGGGGG - Intergenic
963559341 3:146842227-146842249 GACTTAGTAGAGTTGGATGTAGG + Intergenic
970360635 4:15305454-15305476 GACTGCTTTGAGATGGATGGGGG - Intergenic
972843155 4:42955240-42955262 GATTTCTTTGAGATGGGTGAGGG - Intronic
973704029 4:53564188-53564210 GGCTTCCTTGAGGTGTGTGGGGG + Intronic
973733159 4:53843094-53843116 GAGTTCATTCAGTTGGTTGGGGG + Intronic
982009562 4:151093495-151093517 GAGTCCGTTCAGTTGGTTGGGGG + Intergenic
983800267 4:171919757-171919779 GCCTTCGTAGTGTTGGGTAGAGG - Intronic
986050465 5:4085163-4085185 GACTTCGTAGAGTTGGGGTAGGG + Intergenic
988809158 5:34767620-34767642 GACTTGGTGGAATGGGGTGGGGG - Intronic
989155224 5:38338533-38338555 GACCTACTTGGGTTGGGTGGGGG - Intronic
990740885 5:58911644-58911666 GACTTGGGTGGTTTGGGTGGTGG - Intergenic
999467913 5:151824325-151824347 GACTCAGATGGGTTGGGTGGTGG - Intronic
1004172176 6:13303895-13303917 GACTTCGCTGCTTTGGCTGGAGG - Intronic
1004860239 6:19796506-19796528 GACATTGTTGAGTTGAGTTGGGG - Intergenic
1005902382 6:30228184-30228206 GCCTTGGTTGGGGTGGGTGGAGG - Intergenic
1007349094 6:41255713-41255735 GACTTGGTTGAGCTGGGCAGGGG + Intergenic
1018263332 6:161992187-161992209 AAATTAGTTGAGTGGGGTGGTGG + Intronic
1020085641 7:5308864-5308886 GACTTCATGGAGGTAGGTGGTGG - Exonic
1020351838 7:7228427-7228449 TATTTCTTTGAATTGGGTGGGGG - Intronic
1025208668 7:57008300-57008322 GACTTCATGGAGGTAGGTGGTGG + Intergenic
1025663279 7:63568578-63568600 GACTTCATGGAGGTAGGTGGTGG - Intergenic
1026118869 7:67519200-67519222 GGGTTCGTTCAGTTGGTTGGGGG - Intergenic
1026247446 7:68633762-68633784 GGCTCCATTCAGTTGGGTGGGGG + Intergenic
1028389455 7:90297358-90297380 GGGTTCGTTCAGTTGGTTGGGGG + Intronic
1034107097 7:148499684-148499706 AACTTAGTTGAGTATGGTGGTGG - Intergenic
1044166571 8:88991761-88991783 CACTTAGTTGTGTTGGGTGTGGG + Intergenic
1046060282 8:109131079-109131101 TACTTCTTTGAGTTGTGTGTTGG - Intergenic
1047200534 8:122761469-122761491 GCCTTTGTTGGCTTGGGTGGGGG - Intergenic
1059872754 9:118596221-118596243 GACCTCTTTGACTAGGGTGGGGG - Intergenic
1060859344 9:126941151-126941173 GACTTCGTCTAGTTGTGGGGGGG + Intronic
1190632152 X:52398704-52398726 GACTTGGTGCTGTTGGGTGGGGG - Intergenic
1195286481 X:103389689-103389711 GACATCGATAAGTTGGGGGGTGG + Intergenic
1197953538 X:131922894-131922916 GACTGCGAAGGGTTGGGTGGGGG + Intergenic
1198107754 X:133477389-133477411 GACTTGGAGGAGTTGAGTGGAGG + Intergenic
1199728160 X:150605127-150605149 GAATTCCTTCAGCTGGGTGGTGG - Intronic
1200058133 X:153472194-153472216 GGCTCCGTGGAGCTGGGTGGAGG - Intronic
1201564078 Y:15347777-15347799 GACTTCAGTGATTTGTGTGGAGG - Intergenic