ID: 1179087869

View in Genome Browser
Species Human (GRCh38)
Location 21:38236480-38236502
Sequence AGGAAGAAACGGCATGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179087869_1179087875 29 Left 1179087869 21:38236480-38236502 CCATAAACATGCCGTTTCTTCCT 0: 1
1: 0
2: 2
3: 21
4: 211
Right 1179087875 21:38236532-38236554 AGCATGAGATAGACACATATGGG 0: 1
1: 0
2: 1
3: 11
4: 150
1179087869_1179087874 28 Left 1179087869 21:38236480-38236502 CCATAAACATGCCGTTTCTTCCT 0: 1
1: 0
2: 2
3: 21
4: 211
Right 1179087874 21:38236531-38236553 CAGCATGAGATAGACACATATGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179087869 Original CRISPR AGGAAGAAACGGCATGTTTA TGG (reversed) Intronic
900125268 1:1066274-1066296 AGGAATAACCGGCAGGTATAGGG - Intergenic
902710848 1:18238725-18238747 AGAAAGACACGGCATATCTAAGG + Intronic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
905113307 1:35614196-35614218 GGGAAGAAATGACATGGTTAGGG - Intronic
911331067 1:96526347-96526369 AGGAAGAAACGGGGTTTTTCAGG - Intergenic
913041966 1:115035868-115035890 AGGCAGAAACGGCAGGTAGAAGG - Intergenic
913573243 1:120142596-120142618 AGGTAGCAAAGGCATTTTTAGGG + Intergenic
914294502 1:146307393-146307415 AGGTAGCAAAGGCATTTTTAGGG + Intergenic
914555546 1:148758176-148758198 AGGTAGCAAAGGCATTTTTAGGG + Intergenic
915602507 1:156931022-156931044 AGGAAGGCAGGGCATTTTTATGG + Intronic
916525718 1:165607046-165607068 AGGAATAACCGGCAGGTATAGGG - Intergenic
919428892 1:197468886-197468908 TTGAATAAACGGCATGTTTCAGG + Intronic
920797166 1:209150643-209150665 AGGAAGAAACCTAATGTTGATGG - Intergenic
921627481 1:217393640-217393662 AGGAAGAAAGAACATGTTCAAGG + Intergenic
922019136 1:221685988-221686010 TGTAATAAACGGCATGTTCAGGG - Intergenic
924902848 1:248419927-248419949 AGGAAGAAAATGAATGTTCAAGG + Intergenic
924931581 1:248737181-248737203 AGGAAGCAGCGACATGTTTGGGG - Intronic
1065045069 10:21739671-21739693 AGGCAGAAACGGGAACTTTAAGG + Intronic
1065191152 10:23210290-23210312 AGGAGGCATGGGCATGTTTATGG + Intronic
1066398934 10:35055752-35055774 AGGAATAAATGGCATTTTAAAGG - Intronic
1068127836 10:52863739-52863761 AGGAAGATAGGTAATGTTTAAGG - Intergenic
1068150586 10:53125674-53125696 AGGAAGAAAAATCATGTTAATGG - Intergenic
1070765716 10:79054971-79054993 AGGAAGAAATGTCCTGTTTCAGG + Intergenic
1071701811 10:87946765-87946787 AGGAAGAGACGTCAAGTATAAGG + Intronic
1073342926 10:102759310-102759332 AGGAATAACCGGCAGGTATAGGG - Intronic
1074692145 10:116015935-116015957 AGAAAGAAACGGAATGGTGAGGG + Intergenic
1075141171 10:119837405-119837427 AGGTAGACTGGGCATGTTTAAGG - Intronic
1075186279 10:120261255-120261277 GAGAAGAAACGGAATGTTTTGGG + Intergenic
1077927629 11:6697727-6697749 TGAAAGAAATGGCATGTTTGAGG + Intergenic
1079595110 11:22234717-22234739 AGGAAGAAACTGCAAGGGTAAGG - Intronic
1079937769 11:26638990-26639012 AGAAAGAAACAGCATGTATGAGG - Intronic
1081364726 11:42220596-42220618 GGAAAGATACTGCATGTTTATGG + Intergenic
1081836664 11:46160991-46161013 AGGGAGAAACGCCATGTTTTAGG + Intergenic
1082962994 11:58936931-58936953 AGGAAGAAGGGGGATGTTTAGGG - Intronic
1084176089 11:67423091-67423113 AGGAGGAAAAGGCATGTTCTGGG - Intronic
1087213308 11:95466015-95466037 AGGAGGAAACGGAATGTATTGGG - Intergenic
1087580363 11:100043539-100043561 AGAAAGCAACTGCAAGTTTATGG - Intronic
1087743634 11:101917638-101917660 AGGAAAAAAAGGCAGGTATAAGG - Intronic
1089051228 11:115547869-115547891 AGGAAGAAATGGATTCTTTAGGG + Intergenic
1089171304 11:116513544-116513566 AGGGAGACAGGGCATGTTTGGGG - Intergenic
1091767482 12:3131136-3131158 AAAAAGAAACCGGATGTTTATGG + Intronic
1092000082 12:5024614-5024636 AGGATGAGAGGGCTTGTTTATGG - Intergenic
1092905227 12:13095195-13095217 AGCAGGAAAAGGCATGTTTGGGG - Intronic
1093120310 12:15263105-15263127 AGGAAGATATGCCATGTTTATGG + Intronic
1093233836 12:16582231-16582253 AGGAAGAAACACCATAGTTATGG - Intronic
1093902383 12:24650697-24650719 AGAAAAAAACTGCATTTTTAAGG - Intergenic
1094535602 12:31319999-31320021 AGGAAGAAACAGAATTTCTAAGG - Intronic
1095134166 12:38578225-38578247 TGGAAAAAACTCCATGTTTATGG + Intergenic
1095137660 12:38625458-38625480 TGGAATAAATGGCATATTTAAGG - Intergenic
1095922760 12:47547024-47547046 AGGAAGAAAAGGTATGTTAAAGG + Intergenic
1095922903 12:47548644-47548666 AGGGAGAAACAGCTGGTTTATGG + Intergenic
1097243084 12:57589614-57589636 AGGAATAACCGGCAGGTATAGGG - Intergenic
1099362928 12:81728905-81728927 AGGAAGAAAGGACATTTTTAAGG + Intronic
1099764600 12:86967227-86967249 TGGAAGAACCAGCATTTTTATGG - Intergenic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1101589089 12:106110603-106110625 AGGAACAAATGGGATTTTTAGGG - Intronic
1102433577 12:112902496-112902518 AGGAAACAACGGCACATTTATGG - Intergenic
1103462172 12:121113716-121113738 GGGAAGATAAGGCATGTTTGGGG - Intergenic
1104650042 12:130524894-130524916 AGGGAGAAAGTGCAGGTTTAAGG + Intronic
1104785694 12:131446821-131446843 AGCAGTAAACGGCATATTTATGG + Intergenic
1105947056 13:25199081-25199103 AGGGAGAAACGGCACGTGTCTGG - Intergenic
1108517258 13:51215065-51215087 AGGAGGAAGCGACATGTCTAAGG + Intergenic
1110094304 13:71497316-71497338 AGGAAGAAACCACAGGCTTATGG - Intronic
1111108529 13:83676162-83676184 AGGAATAACCGGCAGGTATAGGG - Intergenic
1111302947 13:86368430-86368452 AGAAAGATACCCCATGTTTATGG - Intergenic
1111384993 13:87513832-87513854 AGGAAGAAAATGCATGTTAAGGG + Intergenic
1115882338 14:37933453-37933475 AAGAAAAAAAGGCATATTTATGG - Intronic
1121713766 14:96058330-96058352 AGGTAGAAATGGCATCATTAAGG - Intronic
1126972934 15:54138470-54138492 AGGAAGTAACCTCATGTTTGAGG - Intronic
1128353282 15:66906389-66906411 AGGAAGAAAGGGAATGTCCATGG - Intergenic
1128611983 15:69081433-69081455 AGGAAGAAACGGGATATTTCAGG + Intergenic
1133064156 16:3194087-3194109 AAGAAGAAACGGCATGAATTTGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133357147 16:5144964-5144986 AGAAAGAAAAGACATGTGTATGG - Intergenic
1134198123 16:12174826-12174848 AGTAATAAACAGCATGTTGAAGG + Intronic
1136363757 16:29798920-29798942 AGGAAGAAACAGCCTCTCTATGG + Intronic
1137982805 16:53084199-53084221 AGCAAGTAACTGCATATTTAAGG - Intronic
1138329156 16:56199363-56199385 AGTAAGAAACAGGATGTTTCTGG + Intronic
1143459459 17:7092061-7092083 AGGAATAACCGGCAGGTATAGGG - Intergenic
1143807344 17:9440348-9440370 AGGAGGAATCGGCAGGTTTGGGG - Intronic
1144206875 17:12985619-12985641 TGGAAGGAACGGGATGTTTTTGG + Intronic
1146172267 17:30643333-30643355 AGGAAAAAAAGGAATGTTTTAGG + Intergenic
1149649908 17:58270248-58270270 AGGAAGAAAACTCTTGTTTAAGG + Exonic
1149881408 17:60295828-60295850 AGGAAGAAACGGTATATATAGGG + Intronic
1150847423 17:68673779-68673801 ATGAAGAAAGGACATATTTAAGG - Intergenic
1151335005 17:73434551-73434573 AGGAAGAATGGGGATGTTCAGGG - Intronic
1153338226 18:3947092-3947114 AGGAAAAAACGGTGGGTTTAGGG - Intronic
1156005316 18:32433808-32433830 ATGAAGAAATAGCATGTTCATGG + Intronic
1156972855 18:43177917-43177939 AGGAAAAACCGCCATGTTTTAGG + Intergenic
1160111443 18:76035871-76035893 AGGAACAAAAAGCATCTTTAAGG + Intergenic
1165281470 19:34801894-34801916 AGGAAGAAACTGTATACTTAGGG - Intergenic
1167927795 19:52835470-52835492 AGGAATAACCGGCAGGTATAGGG - Intronic
1168058636 19:53878046-53878068 AGGAATAACCGGCAGGTATAGGG - Intergenic
925650099 2:6080741-6080763 AGGAAGAAATGGCATGATCTCGG - Intergenic
926161293 2:10491398-10491420 AGGAAGACACCCCATGCTTACGG + Intergenic
931116616 2:59173009-59173031 AGGAATAACCGGCAGGTATAGGG + Intergenic
931231102 2:60375479-60375501 AGGAAGAAACGACAAGGTTGGGG + Intergenic
931711778 2:64993995-64994017 GGGAAGAAGAGGAATGTTTAGGG + Intronic
933437155 2:82262644-82262666 AGGAAGAGGCGGAACGTTTAAGG - Intergenic
933730844 2:85455234-85455256 AGGAAGTAAAGGCATGTATATGG + Intergenic
934540982 2:95174938-95174960 AGGAGGAAAAGGCATATTTGCGG - Intronic
935108019 2:100063702-100063724 AGGAGGAAAGGGAATATTTAAGG + Intronic
937692206 2:124769275-124769297 AAAAAGAAAGGGCATGTTTAGGG - Intronic
940557577 2:155250661-155250683 AAGAAGATAAGGAATGTTTAAGG + Intergenic
942389379 2:175476303-175476325 AAAAAGATACCGCATGTTTATGG + Intergenic
943623475 2:190175259-190175281 AGGAAGATGAGGCTTGTTTACGG + Intronic
945092169 2:206185867-206185889 AGGAGGAAAGGGGATGTATAAGG - Intronic
945570593 2:211462555-211462577 AGGAAGAAAAGGGTTTTTTAAGG + Intronic
946461721 2:219874786-219874808 AGGAAGAAACTGTATTTTTATGG + Intergenic
947629582 2:231643400-231643422 AGGAAGAGAGTGCATGTTCAGGG + Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1173242794 20:41312730-41312752 AGGAGAATACGGCATGTTTGAGG + Intronic
1173561343 20:44007816-44007838 AGGAAGAAACATCATATTTTTGG + Intronic
1175552622 20:59827130-59827152 AGGTAGAAGGGGCATGTTCACGG + Intronic
1179087869 21:38236480-38236502 AGGAAGAAACGGCATGTTTATGG - Intronic
1179399511 21:41070819-41070841 AGGAAGAGACGGTATGATGAGGG + Intergenic
1180758933 22:18183993-18184015 AGGAAAAAACGCCATCTCTAGGG - Intergenic
1180769220 22:18367784-18367806 AGGAAAAAACGCCATCTCTAGGG - Intergenic
1180777092 22:18494611-18494633 AGGAAAAAACGCCATCTCTAGGG + Intergenic
1182763922 22:32744943-32744965 AGGAAGGAAAGCAATGTTTACGG + Intronic
1183781003 22:39998794-39998816 AGGCAGAAAGGGCATCTTTAGGG + Intronic
1183835701 22:40451115-40451137 TGGAAGAAACAGCAGGTATATGG + Intronic
1184435590 22:44473121-44473143 AGGATGAAACCGCATGTTTAGGG + Intergenic
1184700517 22:46169052-46169074 TGGAACACAGGGCATGTTTAGGG + Intronic
1203277237 22_KI270734v1_random:96918-96940 AGGAAAAAACGCCATCTCTAGGG - Intergenic
949294785 3:2508640-2508662 AGCAAGAAACGGCATCTCTTTGG - Intronic
950060019 3:10063060-10063082 AGAAAGATATGCCATGTTTATGG + Intronic
952072907 3:29660766-29660788 TGAAAGAAACTGCATGTATAGGG - Intronic
955777104 3:62445528-62445550 AGGAAGAAAGGTCCTGTTTGAGG - Intronic
956265031 3:67386596-67386618 GGCAAGAAAGGGCATGTGTAGGG + Intronic
957016491 3:75069931-75069953 AGGCAGGAATGGCATGCTTAGGG + Intergenic
957217847 3:77344859-77344881 AAGAAGAAACAGTATGTTCATGG - Intronic
957393488 3:79610222-79610244 AGGAAAAAACAGCATATTTAAGG - Intronic
958135574 3:89485418-89485440 TGGAAGAAAAGGCACTTTTATGG - Intergenic
958679834 3:97314183-97314205 AGAAATAAACACCATGTTTACGG - Intronic
958800898 3:98754315-98754337 AGGAAGAAACTGCAGATTGATGG + Intronic
959108867 3:102097580-102097602 AGGAAGAAGCCACATGTTTCAGG - Intergenic
960901737 3:122560974-122560996 TGGAAGAAATGGAATGCTTAGGG - Intronic
961117249 3:124341083-124341105 AGGAAGAAAGGGGGTGATTAGGG + Intronic
963332335 3:143928429-143928451 AGGATGAAATGGGATGTTTGTGG + Intergenic
965165042 3:165187266-165187288 AGGAAGAAACTGCAGGTTTAGGG + Exonic
966042774 3:175511742-175511764 AGGTAGAATTGGCATGTTTATGG - Intronic
967376606 3:188810617-188810639 AGGAAAAAACAGTATGTATAGGG + Intronic
969397621 4:6932915-6932937 AGGATGAAACAGCATGTTGGCGG + Intronic
970238425 4:13982218-13982240 AGGAAGAAACAGAATGTCTGTGG - Intergenic
970378478 4:15481946-15481968 AAGAAGAAAAGGCGTGTGTAGGG - Intronic
970430371 4:15983561-15983583 CAGAAGAAACGGCATGTGCATGG + Intronic
970457063 4:16235104-16235126 AGGATGAAATGGGATGTTGATGG + Intergenic
971670819 4:29554773-29554795 AGGAAGAAAAAGCATGTTTCAGG - Intergenic
972978090 4:44662171-44662193 AGGAAGAAACAGTATATATAGGG - Intronic
975233600 4:71964493-71964515 AGTAAGAAAAGCCATGTTAAAGG - Intergenic
975600326 4:76093119-76093141 AGTCAGAAACAGCATGTTGATGG + Intronic
976944101 4:90743037-90743059 AGGAAAAATTGGCATGTTGATGG + Intronic
977900022 4:102411747-102411769 GGGAGGAAAATGCATGTTTATGG - Intronic
978349734 4:107809022-107809044 AAGAAGAAATGCCATGTTAAAGG + Intergenic
979404068 4:120287316-120287338 TGGAAGAAATGGGATGTTTAAGG + Intergenic
979854544 4:125615070-125615092 AGGTATAAAAGGTATGTTTAGGG + Intergenic
980713785 4:136605868-136605890 AGGAAGAAATGGCATCATTAGGG - Intergenic
982821430 4:159944728-159944750 AGAAAAAAAAGGCAAGTTTAAGG + Intergenic
983556556 4:169064225-169064247 AGTAAGAAACTGCAATTTTAGGG + Intergenic
984751522 4:183281062-183281084 AGGAAGTAATGGCAAGATTATGG + Intronic
985509911 5:307588-307610 AGGAACAACGGGCATGTTTGGGG + Intronic
985798035 5:1979132-1979154 AGGAAGAGACAGCATGTGCAGGG + Intergenic
990523385 5:56601437-56601459 AGGAAGAAAAGGCAGGCTTGAGG + Intronic
990833135 5:59983155-59983177 ATGAAGCAACAGCATGCTTATGG - Intronic
992536309 5:77707498-77707520 AAGAAGAAAGGGCATGTTCAGGG + Intronic
996852002 5:127963631-127963653 AGCAAAAAACAGCATGTTTGGGG + Intergenic
998183913 5:139964547-139964569 TAGTAGAAAGGGCATGTTTATGG - Intronic
1001178007 5:169490924-169490946 AGAAAGAAAATCCATGTTTATGG + Intergenic
1002533263 5:179862163-179862185 AGGAAAAAACAGTATGTATAAGG + Exonic
1004173192 6:13315189-13315211 TGGAAGAAAATCCATGTTTAAGG - Intronic
1004740180 6:18452413-18452435 AAGAAGAAAGGGAATTTTTAGGG + Intronic
1004927471 6:20429476-20429498 AGGAAAAAACAGTATGTATAGGG + Intronic
1005605341 6:27472168-27472190 AGGAAGGAACGGTATGCTTAGGG - Intronic
1005914438 6:30340461-30340483 GGGAAGAAAGGGCAGGGTTAGGG - Intronic
1006599076 6:35213975-35213997 AGGCAGAAAGGGCGTGTTTCTGG + Intergenic
1008103582 6:47419045-47419067 AGGATGAAATGGAATGTCTATGG - Intergenic
1010584766 6:77644068-77644090 AAGTAGAAAGGGCATGTTTCTGG + Intergenic
1012839358 6:104309952-104309974 TGGAAGAAACTGCATGGATAAGG - Intergenic
1013034887 6:106371998-106372020 AGGAAGAAACTACATGATGATGG - Intergenic
1013807406 6:114010985-114011007 AGGAAGCAACTGCAGGTTTCTGG - Intronic
1014209396 6:118691974-118691996 AGGAAGAAAAGACATCTCTAGGG - Intronic
1014302607 6:119701269-119701291 AGGAAGAAGCAGCAAGTCTAGGG + Intergenic
1014325019 6:119983144-119983166 AGAAAGAAATCCCATGTTTATGG - Intergenic
1014829182 6:126081241-126081263 TGGAAGAAAAGGCATTTTTCAGG - Intergenic
1015504394 6:133967087-133967109 AGGAAGAATCAGCATGGCTACGG - Intronic
1016196953 6:141355704-141355726 AGAAAAAAACGGCATGCTTTAGG - Intergenic
1017374069 6:153747094-153747116 AAGAAGAAGCTGCATGTTAAAGG + Intergenic
1018205953 6:161437060-161437082 AGGAAAAAACAGCATATATAGGG - Intronic
1021298512 7:18940234-18940256 AAGAAGAAAATGCATGTTTTGGG - Intronic
1022924125 7:35043109-35043131 AGGAGGCAAGGCCATGTTTAGGG - Intergenic
1024263626 7:47589983-47590005 AGGAAGAAAAGGCAGGGTCAGGG - Intergenic
1026165609 7:67906486-67906508 GGCAAGAAACAGCATGTTCAGGG + Intergenic
1031091037 7:117354715-117354737 AGGACAAAACTGCATGATTATGG + Intergenic
1031268088 7:119607741-119607763 AGGAAGAAAGAGCATCTTTGAGG + Intergenic
1032916298 7:136493743-136493765 GGGAAGAAAAGGCACGTTTAGGG + Intergenic
1034994804 7:155570914-155570936 GGGAAGACAGGGCAGGTTTAGGG - Intergenic
1036135712 8:6159664-6159686 AGGAATAAAATGCATGATTAAGG - Intergenic
1036405338 8:8449945-8449967 AAGGAGAATCGGCATGTGTAAGG + Intergenic
1037267189 8:17076571-17076593 AGGCAGGAACAGCATTTTTAGGG - Intronic
1037546576 8:19929686-19929708 AGGAAGAGACTTCATGTTAAGGG - Intronic
1042667514 8:71222780-71222802 GGGAAGAAACGGCGAGTTGAGGG - Intronic
1047760781 8:127952574-127952596 AGAAAGAACTGGCATGTTTTGGG + Intergenic
1048735231 8:137492365-137492387 AGGAAGAAAGGGCAAGTACATGG - Intergenic
1048969462 8:139636758-139636780 AGGAAGAAAAGAAAGGTTTATGG + Intronic
1051790342 9:20795483-20795505 AAGAAGACACAGCATGTTTTGGG + Intronic
1052148800 9:25085909-25085931 AGGCAGAAATGGCATGATTGGGG + Intergenic
1052606575 9:30710656-30710678 AAGAAGAAACAGCAGGTTTTGGG + Intergenic
1053102018 9:35378910-35378932 AGGAAGAAACACTATCTTTATGG - Intronic
1055438839 9:76319461-76319483 AGGAATAACCGGCAGGTATAGGG + Intronic
1057390867 9:94640469-94640491 AGGAAGACACGGAATGTGGAGGG + Intergenic
1057524355 9:95785609-95785631 AGTAAGAATCGGCATGCTTTGGG + Intergenic
1057827310 9:98380931-98380953 AGAAAAAAGCGGCATGTATATGG + Intronic
1058003594 9:99892387-99892409 TGGAAGAAATAACATGTTTAAGG + Intergenic
1062279064 9:135743964-135743986 AGGAAGAAAGGGCAGGCTTCAGG - Intronic
1186181677 X:6979526-6979548 AGGCACAAAAGGCATATTTAAGG + Intergenic
1187267722 X:17750787-17750809 GGGAAGAAAGGGTATGTTTTTGG + Intronic
1187950096 X:24463306-24463328 AGGAAGAAGCTGGATGTTTGTGG - Intergenic
1188016466 X:25112495-25112517 AGAAAGAAAAGGCATTTTCAGGG - Intergenic
1188464184 X:30460275-30460297 AGGAAGAACCTGAATGTTTATGG - Intergenic
1191960574 X:66697036-66697058 AGGAAGAGACTTCTTGTTTATGG - Intergenic
1192888308 X:75361226-75361248 AGAAAGAATCTGAATGTTTATGG - Intergenic
1194368653 X:93042083-93042105 AGAATGAAACTGCATTTTTAAGG - Intergenic
1194668570 X:96703057-96703079 AGGAAGTTAGGGCATGTTTGAGG + Intronic
1195012745 X:100749430-100749452 AGGAAAAAACAGCATATATAGGG + Intergenic
1198448793 X:136745355-136745377 AAGAGGAAAAGGCATGTTAAAGG + Intronic
1198529887 X:137541975-137541997 ACTAAGAAACAGCATGGTTAGGG - Intergenic
1199076874 X:143535117-143535139 AGGAACAATTGGCATGTTCATGG - Intergenic
1199190174 X:144961640-144961662 AGGAAAAAATGGCATTTTCAAGG - Intergenic
1200175762 X:154115226-154115248 AGGAGGAAATGGCATCTTTGCGG + Intergenic
1200676853 Y:6158410-6158432 AGAATGAAACTGCATTTTTAAGG - Intergenic
1200822327 Y:7599649-7599671 ATGAAGATACGGCATTGTTAAGG - Intergenic
1202237974 Y:22734368-22734390 ATGAAGATACGGCATTGTTAAGG + Intergenic