ID: 1179089178

View in Genome Browser
Species Human (GRCh38)
Location 21:38247987-38248009
Sequence GTGTTATTGCTTCCAAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179089176_1179089178 5 Left 1179089176 21:38247959-38247981 CCATCTCTAGGACTCAGTGAACT 0: 1
1: 0
2: 0
3: 24
4: 251
Right 1179089178 21:38247987-38248009 GTGTTATTGCTTCCAAACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 148
1179089174_1179089178 26 Left 1179089174 21:38247938-38247960 CCTGTTAACTAAACTAAAATTCC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1179089178 21:38247987-38248009 GTGTTATTGCTTCCAAACTTGGG 0: 1
1: 0
2: 1
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179089178 Original CRISPR GTGTTATTGCTTCCAAACTT GGG Intronic
900234800 1:1583180-1583202 CTGTTTTTGCTGCCAAATTTTGG + Intergenic
903260726 1:22130369-22130391 GTGTCATTGCTGCCACCCTTTGG + Intronic
906542767 1:46600744-46600766 GTGTTATAGCTTGGAAACTAAGG - Intronic
907857266 1:58315990-58316012 GTCTTTTTGATTCCAAACTTTGG - Intronic
908692235 1:66795435-66795457 GTCTTACTGGATCCAAACTTAGG - Intergenic
910889647 1:92004349-92004371 GTTTTCTTCCTTCCAAAATTTGG + Intronic
911404408 1:97418866-97418888 GTGTCATTGCTTCTAGGCTTTGG - Intronic
913299919 1:117359841-117359863 GTCTTATTTCATCCAAAGTTGGG - Intergenic
916256720 1:162795680-162795702 GAGTCATAGCTTCTAAACTTAGG - Intronic
917363932 1:174208364-174208386 GTTTTATTTCTTCCAATCTTAGG + Intronic
917446819 1:175113186-175113208 ATCTTTTTGCTTCCAAACGTAGG + Intronic
919957290 1:202431383-202431405 CTGTTATTGCTTCCACATATAGG + Intronic
921383306 1:214546534-214546556 ATGGTATGGCTTCCTAACTTAGG + Intronic
1069165703 10:65156141-65156163 GTGTCATTCCTTTCAAACGTAGG - Intergenic
1071064630 10:81616149-81616171 GTCCTTTTGCTTCCAAATTTAGG - Intergenic
1071452146 10:85806539-85806561 TTGTTTTTTTTTCCAAACTTGGG - Intronic
1072514355 10:96164628-96164650 CTGTTAATGCCTCCAAATTTAGG + Intronic
1072584762 10:96771719-96771741 TTTTTATTGCTGCAAAACTTGGG - Intergenic
1073862271 10:107760638-107760660 CTGTTATTGCTTCCTACCCTGGG - Intergenic
1078146629 11:8726105-8726127 GTGCTTTTGGATCCAAACTTGGG + Exonic
1078855594 11:15204415-15204437 ATCATATTGCTTCCAAAGTTGGG + Intronic
1079516838 11:21279797-21279819 TTTTTATTGCTTCCAAGTTTGGG - Intronic
1079777511 11:24551131-24551153 ATGTTATAGTTTCCAAACATAGG - Intronic
1082655715 11:55854698-55854720 GTTTTATTCCTTCCATAGTTTGG + Intergenic
1084719836 11:70897731-70897753 GTGTTTTTTCTTCCTTACTTAGG + Intronic
1085183372 11:74554990-74555012 GTGTTTTTCCTTCCCATCTTAGG - Intronic
1085742862 11:79091904-79091926 CTGTAATTCCTTCCTAACTTGGG + Intronic
1086416491 11:86593581-86593603 GTAATATTACTTTCAAACTTGGG - Intronic
1088539798 11:110901930-110901952 GTTTTATTGCTTCCAAAACAGGG + Intergenic
1092582158 12:9853672-9853694 GTGATTTTGCTTCCAAACCAAGG + Intronic
1094773352 12:33691803-33691825 GTGTTATGCCTTTGAAACTTGGG + Intergenic
1095522885 12:43087931-43087953 TTGTAATTGCTTCCATATTTTGG + Intergenic
1097103901 12:56609214-56609236 GTGTTATTGCATTCCAACCTGGG - Intronic
1098001076 12:65943961-65943983 GTTTTAGTGCTTCCTAAGTTGGG - Intronic
1100346884 12:93741228-93741250 GTTTTATTGCTTTCATGCTTAGG + Intronic
1100422658 12:94452385-94452407 AAGTTATCTCTTCCAAACTTTGG + Intronic
1100993613 12:100278601-100278623 GTGTTGTTTCTGCCAAATTTGGG + Intronic
1101229147 12:102722027-102722049 GTGTTACAGCTAACAAACTTGGG - Intergenic
1106423134 13:29600499-29600521 GTTTGATTGCTTCCAAGTTTTGG - Intergenic
1108930937 13:55817686-55817708 GTATTTTTGCTTCCCAACTAAGG + Intergenic
1109087415 13:57992579-57992601 AAGTTATTGCTTCCAAGTTTGGG + Intergenic
1111212325 13:85095456-85095478 GATTTACTGCTTCCAAAGTTGGG - Intergenic
1111557656 13:89902474-89902496 GTGATTTTGCTCACAAACTTGGG + Intergenic
1111749775 13:92314307-92314329 GAGTTTTTCCTTCCAAAGTTGGG - Intronic
1113141224 13:107152364-107152386 GTGTTATTTCTTTAAATCTTTGG + Intergenic
1113182646 13:107648848-107648870 TTGTCATTGTTTCCAATCTTAGG + Intronic
1116631137 14:47335438-47335460 GCATTATTGCTTCCAAAACTTGG - Intronic
1117441870 14:55767491-55767513 GGGTCATTGTTTCAAAACTTAGG - Intergenic
1131147911 15:90027130-90027152 TTGCTATTGGTTCTAAACTTTGG - Intronic
1135585225 16:23665178-23665200 CTGTTATTGTTTCCAGGCTTGGG + Intronic
1138860224 16:60746833-60746855 GTTTGGTTGCTTCCAAATTTTGG - Intergenic
1144177049 17:12717587-12717609 ATTTTATGGCTTCCCAACTTGGG - Intronic
1156153870 18:34278165-34278187 GTGTATTTGTTTCCAAACATAGG + Intergenic
1156494939 18:37519503-37519525 GTGTTAGTGCTTCCAAACAACGG - Intronic
1157829571 18:50844794-50844816 GTGATATTGCTTGAAAACTCTGG - Intergenic
1162508117 19:11099968-11099990 GTGTTGTTGATTCCAAAATATGG - Intronic
1162525297 19:11203190-11203212 GGGTTCCTTCTTCCAAACTTAGG - Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1165489494 19:36115052-36115074 GAGTAATTGCTTCCAATTTTTGG + Exonic
1166016746 19:39986555-39986577 GTGTTAGTTCTTCGAAAGTTTGG - Intronic
925638607 2:5966224-5966246 GTGTTTTTGCTTCCAGATGTAGG + Intergenic
926252165 2:11161020-11161042 TTATTATTGCTTCCAATCCTCGG - Intronic
926591758 2:14748006-14748028 GTGTTAGTTCTTCCATACATTGG - Intergenic
926709933 2:15871104-15871126 GTGTTATTACTTCCAAACTAGGG - Intergenic
926860638 2:17305238-17305260 TTATTATTGCTTCTAATCTTTGG - Intergenic
928885274 2:36141328-36141350 GTGTCCTTGATTCCAAACTGGGG + Intergenic
930726017 2:54682180-54682202 GTTTTATTTCTTCAAAACTGAGG + Intergenic
931013896 2:57952458-57952480 TTGTTATTTCTTCCAAACTCTGG + Intronic
933374502 2:81462064-81462086 GTTTTATTGCTTCCACTTTTTGG + Intergenic
934140887 2:89046285-89046307 GTGTTTATGCTTCCAATCTCAGG - Intergenic
934228345 2:90154257-90154279 GTGTTTATGCTTCCAATCTCAGG + Intergenic
936231756 2:110708179-110708201 GTCTTTTTTCTTCCAAATTTTGG + Intergenic
943770724 2:191713534-191713556 GTGTTTTTTCTTCCAAATTCAGG + Intergenic
947644837 2:231730926-231730948 TTGTTTTTCCATCCAAACTTTGG + Intergenic
1169481294 20:5983885-5983907 GCATTATTGCTGCCAAACATTGG + Intronic
1172369520 20:34377501-34377523 TTGTCATTGTTTCCAAACCTTGG - Intronic
1172724174 20:37024734-37024756 GTCTTATTTCTGTCAAACTTAGG + Intronic
1174131825 20:48350257-48350279 GTGTTTGTGCTTCCAAACCCAGG - Intergenic
1175397379 20:58675678-58675700 GAGTTTTTGTTTCCAAATTTAGG + Intronic
1179089178 21:38247987-38248009 GTGTTATTGCTTCCAAACTTGGG + Intronic
1179873990 21:44258307-44258329 GTTTTGTTGCTTCCAAGCCTAGG - Intronic
952318940 3:32258110-32258132 TGGTTATTGCTTCTAATCTTTGG + Intronic
955231987 3:57107635-57107657 GAGTTGCTGCTTTCAAACTTTGG - Intronic
959351741 3:105274017-105274039 GTGTGACTAATTCCAAACTTAGG + Intergenic
959878942 3:111420452-111420474 GTTTTTTTTCTTCTAAACTTGGG + Intronic
960533168 3:118788000-118788022 GTATTATTGCTTGCAAACCTTGG - Intergenic
962698764 3:137976651-137976673 CTGAGATTGCTTCCAAATTTTGG + Intergenic
964272206 3:154968690-154968712 ATCTTATTGCTTACAATCTTAGG - Intergenic
969199563 4:5592067-5592089 TTGTATTTGTTTCCAAACTTGGG - Intronic
970257501 4:14183956-14183978 GGGTTATGGCTGCCAAATTTAGG - Intergenic
970463557 4:16300521-16300543 GTTTTTTTGCTTCCATATTTTGG - Intergenic
970619053 4:17798255-17798277 GGGTTATTTCTTCTAAACTGTGG - Intergenic
971847022 4:31932073-31932095 ATGTTATTTCTGCCAAAATTTGG - Intergenic
973646800 4:52958161-52958183 TTGTTTTTGCTTCCCACCTTGGG - Intronic
974759133 4:66252575-66252597 ATGTTATAGCTTCCTAAGTTTGG - Intergenic
975742942 4:77448111-77448133 CTATTATTGCATCCAATCTTAGG - Intergenic
978127347 4:105150436-105150458 ATGTTATTGTTTCCTACCTTGGG + Intronic
979867803 4:125777706-125777728 GTGTGATGGCTTACACACTTTGG + Intergenic
980030425 4:127822987-127823009 TTGTTATTGTTGCCAATCTTGGG + Intronic
980442186 4:132863641-132863663 GTCTTATTGAATCAAAACTTTGG - Intergenic
981705401 4:147654091-147654113 CTGTTATTGCTGGCACACTTGGG - Exonic
983333383 4:166360025-166360047 GTGCTATTGCATTGAAACTTTGG + Intergenic
983778431 4:171638687-171638709 GTGCTGTCTCTTCCAAACTTTGG + Intergenic
984361941 4:178745040-178745062 CTATTATTAGTTCCAAACTTGGG - Intergenic
984732901 4:183084939-183084961 GTGGCATTGCTTCTAAACCTAGG + Intergenic
986035705 5:3935195-3935217 TTGTGATTGCTTCCAAGTTTTGG + Intergenic
987510481 5:18830323-18830345 ATGTGCTTGCTTACAAACTTTGG - Intergenic
989259157 5:39399950-39399972 ATGATATTGCTTCAAAACCTTGG - Intronic
990076273 5:51849583-51849605 GTTTTCTGGCTTCCAAACCTGGG - Intergenic
990616132 5:57510272-57510294 TTATTATTGCTTCCTGACTTTGG + Intergenic
993025372 5:82639236-82639258 TTTTTATTGCTTCCAACCATTGG + Intergenic
996573960 5:124962255-124962277 CTGTGATAGCTTCAAAACTTCGG - Intergenic
997356953 5:133268662-133268684 GTTTTATGGTTTCCAAAGTTAGG - Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
999619276 5:153455812-153455834 TTCTTTTTGCTTCAAAACTTTGG - Intergenic
1004089720 6:12488661-12488683 ATCTTATGGCTTCCAAACTTTGG + Intergenic
1005494262 6:26375085-26375107 GATTTAATGCTTCCAAGCTTTGG + Intronic
1005777279 6:29148577-29148599 TTTTTTTTGCTTCCAAGCTTTGG + Intergenic
1005906470 6:30265313-30265335 GTGTTCTTGCTACCAAAAGTGGG - Intergenic
1007649316 6:43408207-43408229 GTGTTCATGCTTCCTAACTCTGG + Intergenic
1008217564 6:48813337-48813359 GTCTTATTGCTTACAAAAATGGG - Intergenic
1009321318 6:62292937-62292959 GGGTGACTGCTCCCAAACTTTGG - Intergenic
1009732429 6:67626086-67626108 ATGTTATTTCTTCAAAATTTAGG - Intergenic
1011450448 6:87486334-87486356 GTTTCATTCCTTCCAAACATTGG + Intronic
1011556873 6:88579370-88579392 GTGTTATTTCTTCCTAAAATGGG + Intergenic
1013580044 6:111524638-111524660 GTGTTACTGCCTCTGAACTTGGG + Intergenic
1014526560 6:122508478-122508500 GTGTTATTGAGTGGAAACTTTGG + Intronic
1019459555 7:1149753-1149775 GTGTTTGTGCTTCCAAACCTAGG + Intergenic
1020955188 7:14731770-14731792 CTGATATTGCTTCCATCCTTGGG - Intronic
1021271955 7:18599701-18599723 TTTTTGTTGCTTCCAAATTTTGG + Intronic
1024563803 7:50665536-50665558 GTGTTATGGGTTCCAAACCTGGG - Intronic
1027883146 7:83868875-83868897 GCATTATTGCTTCAAAATTTGGG + Intergenic
1027963147 7:84972783-84972805 GTGTTATGACTTTCAAACCTGGG - Intergenic
1031737345 7:125383102-125383124 GTCTTATTTTTTCCAATCTTAGG + Intergenic
1031952163 7:127903607-127903629 GTCTTATTTCTTTCACACTTGGG - Intronic
1041094849 8:54339814-54339836 GAGTTATTGCATTCAAACATGGG - Intergenic
1041628866 8:60062286-60062308 TTGTTATTACTTCCAGTCTTAGG - Intergenic
1046573048 8:115990974-115990996 GTGTTACTGTTTCCATACTGGGG + Intergenic
1046791616 8:118328221-118328243 ATTTTATTGCTTCCCATCTTGGG + Intronic
1048714917 8:137257724-137257746 ATGTTCTTTCTTCCAACCTTGGG + Intergenic
1051622101 9:19061394-19061416 GTGTTTTTCCTTTCAAAATTAGG + Intronic
1052237422 9:26228443-26228465 GTGTTACTGATTCCTAACATGGG - Intergenic
1059461067 9:114430503-114430525 GTGTTGTGGCTTCCAAACCTAGG + Intronic
1059522867 9:114960254-114960276 GTTTGATTTCTTCCAACCTTAGG - Intergenic
1059892749 9:118822389-118822411 GTCTTGTTGCTTCCAAGTTTTGG + Intergenic
1059997862 9:119930883-119930905 ATTTTATAGATTCCAAACTTTGG + Intergenic
1060281328 9:122217413-122217435 GTGTTGTTGCGTCCAAGCTAAGG - Intronic
1060348306 9:122836044-122836066 GGGATGTTGCTTCCAAAATTTGG + Intergenic
1062310499 9:135933234-135933256 ATCTTATTGCTTATAAACTTTGG - Exonic
1190282159 X:48938236-48938258 ACGTTAATGATTCCAAACTTAGG - Intronic
1190898669 X:54647134-54647156 CTGTGATTGCTTCCAAGTTTTGG + Intergenic
1194853691 X:98902039-98902061 GTGTTAGTGCTTTAAAACTGGGG + Intergenic
1195117974 X:101718705-101718727 GTGTTATTTCTTGCAATCCTAGG - Intergenic
1195510323 X:105708682-105708704 GTGTTAAAGCTTACAAAGTTAGG - Intronic
1195740496 X:108060409-108060431 TTGTTATTGCTCCCAAGCTGTGG - Intronic
1197056550 X:122127560-122127582 GTCTTTTTGCTTCCAAGTTTAGG + Intergenic
1197144939 X:123160968-123160990 CTTTGATTGCTTCCAAACATTGG + Intergenic
1197292426 X:124675263-124675285 CTTTTATTTCTTCCAAACATAGG + Intronic
1199243149 X:145572049-145572071 TTTGTATTGCTTACAAACTTTGG - Intergenic