ID: 1179089790

View in Genome Browser
Species Human (GRCh38)
Location 21:38254187-38254209
Sequence AAAGCATGCTTAACAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179089788_1179089790 27 Left 1179089788 21:38254137-38254159 CCTTAGTTAGTTTCAGAAATTTC 0: 1
1: 0
2: 0
3: 27
4: 255
Right 1179089790 21:38254187-38254209 AAAGCATGCTTAACAAAGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 215
1179089789_1179089790 5 Left 1179089789 21:38254159-38254181 CCAGAAATACTTAGATCATTCAG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1179089790 21:38254187-38254209 AAAGCATGCTTAACAAAGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 215
1179089787_1179089790 28 Left 1179089787 21:38254136-38254158 CCCTTAGTTAGTTTCAGAAATTT 0: 1
1: 0
2: 3
3: 43
4: 496
Right 1179089790 21:38254187-38254209 AAAGCATGCTTAACAAAGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179089790 Original CRISPR AAAGCATGCTTAACAAAGCC TGG Intronic
902822747 1:18953520-18953542 AAAGCATCTCTAAGAAAGCCTGG + Intronic
906866872 1:49430838-49430860 AAAGCATGCAAAACTAAGCCAGG - Intronic
908329625 1:63058363-63058385 AAAGGATGGTTACCAAAGGCTGG + Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
911001038 1:93165925-93165947 GAAGGATGGTTAACAAAGGCTGG - Intronic
911442678 1:97947847-97947869 GAAGCATGCTTATGCAAGCCTGG + Intergenic
911729576 1:101278935-101278957 AGAGCATGCTTCACAGAGACAGG + Intergenic
916785140 1:168081484-168081506 AAAGCATGCAGCACAATGCCTGG - Exonic
916932521 1:169593617-169593639 AACGCTTTCTTAGCAAAGCCAGG + Exonic
917129635 1:171727801-171727823 AAACCATGCTGAATAAAGCCAGG + Intronic
917616633 1:176752469-176752491 CAAGCATGGTTAGCAAAGCAAGG - Intronic
918609430 1:186470737-186470759 AAAGCATGCTAAAAAAAACATGG + Intergenic
918648531 1:186930171-186930193 AATGCATGCTTAACAAATGAAGG + Intronic
919073832 1:192790118-192790140 GAAGCATCCTGACCAAAGCCTGG + Intergenic
919646426 1:200099357-200099379 ATAGGTTGCTTTACAAAGCCAGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923367241 1:233274685-233274707 AAAGCATGCTGAGAAAAGCCAGG + Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1064059321 10:12124269-12124291 CAAGCATGCGCAACAACGCCTGG - Intergenic
1064182940 10:13134995-13135017 AAAGCATGGTTTCCAAAGCAGGG - Intronic
1065193596 10:23238571-23238593 GAAGCCTGTTTCACAAAGCCTGG + Intronic
1066653918 10:37682156-37682178 AATGAATGCTTATCAAAGACTGG - Intergenic
1071018505 10:81025582-81025604 AAAGCATGGTTACCACAGTCTGG + Intergenic
1072612083 10:97024283-97024305 AAAGCAGGCTGAACAAGACCTGG + Intronic
1074644598 10:115432680-115432702 AAAGCATGCCTCACAAAGGAGGG + Intronic
1076065175 10:127442744-127442766 AAAGCATGCTGAGCACAGCTGGG + Intronic
1078047093 11:7924771-7924793 AAAGCATGACTAGAAAAGCCAGG - Intergenic
1078512161 11:11993278-11993300 AAAGTATGCATAAAAAATCCTGG - Intronic
1078855903 11:15206346-15206368 AAAGCAGTCTTAACAAGGGCAGG + Intronic
1079391748 11:20027626-20027648 AAAGCAGTCTTCACAAAGCAAGG - Intronic
1079423194 11:20314216-20314238 AAGGCATTCTTAAGAAAACCTGG - Intergenic
1079984044 11:27181342-27181364 AAAACATGATTTACAAAGACAGG + Intergenic
1080377181 11:31726007-31726029 TAAGAATGCTTAACAAAGGAGGG + Intronic
1080427356 11:32168445-32168467 AAGGCAGGCTGAGCAAAGCCAGG + Intergenic
1081412355 11:42774679-42774701 AAAGCATGCCTAACAAATGAAGG + Intergenic
1083039403 11:59670965-59670987 AAAGCTTGCTTTACAAAAACGGG - Intergenic
1085264194 11:75226938-75226960 AAAGCATGCTTATCAAATCTGGG - Intergenic
1087401891 11:97677729-97677751 GAAGGATGGTTAACAAAGGCTGG - Intergenic
1088200994 11:107334143-107334165 AAAGCATCTTGAACAATGCCTGG + Intronic
1091818541 12:3457290-3457312 AAAATATGCTTAGCAAAGTCAGG - Intronic
1093184770 12:16007324-16007346 AAAGCATGCATCACCATGCCCGG + Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1095817712 12:46442676-46442698 AAAGGCTGCTCAACAAAGGCAGG + Intergenic
1097166779 12:57090184-57090206 TAAGAATGCTTAACCAGGCCGGG + Intronic
1099471755 12:83058710-83058732 AAAACACACTTTACAAAGCCAGG - Intronic
1099544803 12:83965188-83965210 CAAGCATGCTGAACAAAGAAAGG + Intergenic
1100847352 12:98673479-98673501 AGAGCATGCAAAATAAAGCCAGG - Intronic
1100915196 12:99412430-99412452 AGGGCATGGTTATCAAAGCCAGG - Intronic
1101504980 12:105337754-105337776 AAAGCATGCTAAACAATAGCGGG + Intronic
1107454475 13:40541605-40541627 AAAGTATTCTTGACAAAGACTGG + Intergenic
1108259414 13:48641912-48641934 AAAGCATGCATAAAAATGTCAGG + Intergenic
1109513577 13:63410890-63410912 AAAACATGCAGAACAAAGACAGG - Intergenic
1111512862 13:89288156-89288178 AAAGGATGTTTACCAAAGGCTGG - Intergenic
1115218788 14:31038769-31038791 AAAGCATTCAAAACAATGCCTGG + Intronic
1115994504 14:39181873-39181895 AAAGAATGGCTAAGAAAGCCTGG - Exonic
1116544572 14:46148695-46148717 AAAGAATAGTTAACAGAGCCTGG - Intergenic
1118443566 14:65832566-65832588 AAACCAGGCCTACCAAAGCCTGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118714797 14:68551403-68551425 AACACATGCTTATCACAGCCAGG - Intronic
1118935340 14:70282956-70282978 AAAGCATTCAGAACAATGCCTGG - Intergenic
1124176175 15:27426274-27426296 AAACCAGGCTTAACAAAACGAGG - Intronic
1124686094 15:31783159-31783181 AAAGAATGCTTAAAGAAGACTGG + Intronic
1127297500 15:57621908-57621930 AAAGCATTCTCACCAAAGTCAGG + Intronic
1130187274 15:81696543-81696565 AGAGCTTGTTTAACACAGCCTGG - Intergenic
1130684477 15:86024708-86024730 AAAACAACCTCAACAAAGCCAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1133423590 16:5668051-5668073 CAAGCATGCTTTAAAAGGCCAGG + Intergenic
1134827476 16:17296249-17296271 AAACCATGTTTAGCAAGGCCTGG + Intronic
1137755214 16:50896020-50896042 AGAGCATGGATAACAGAGCCTGG + Intergenic
1137996215 16:53216969-53216991 ATAGCATGATTATCAAAACCAGG + Intronic
1140017628 16:71203583-71203605 GAAGTATGCTTTACAATGCCTGG + Intronic
1143392692 17:6569413-6569435 CAAGCATGATTAGCCAAGCCTGG + Intergenic
1143514641 17:7413699-7413721 AGAGCCTGCTTAATGAAGCCAGG - Intronic
1144479068 17:15613952-15613974 AAAGCAGACATAACCAAGCCAGG - Exonic
1144657029 17:17043187-17043209 AAAGCATGAATCACACAGCCGGG - Intronic
1145771398 17:27495808-27495830 CAAACATGCTTTTCAAAGCCTGG + Intronic
1147336290 17:39728490-39728512 AAAGCACTCTGTACAAAGCCTGG - Exonic
1149379931 17:56083378-56083400 AAAGCATGCTCTACAATTCCAGG + Intergenic
1149713025 17:58760045-58760067 AAAGCATGATTAACAATGAATGG - Intronic
1153022127 18:639129-639151 AAAACATGCTTCATACAGCCGGG + Intronic
1154222944 18:12472933-12472955 CAGGCATGCATCACAAAGCCTGG + Intronic
1156676622 18:39534437-39534459 AAAGCATGCTTCAGAAAACATGG + Intergenic
1158495612 18:57952674-57952696 ACAACATGCTTAGCTAAGCCTGG - Intergenic
1158604998 18:58887850-58887872 AAAGCAGCTTTCACAAAGCCCGG - Intronic
1160331545 18:77996999-77997021 AAAGGCTGCTTAACATAGCCTGG + Intergenic
1163814699 19:19457443-19457465 TAAACATGATTAACAAGGCCAGG + Intronic
1164301455 19:23965708-23965730 AAAGCATGCTTCTTAATGCCTGG - Intergenic
1164903313 19:31946671-31946693 AAAGCAGGCTTGACAAAGCTAGG + Intergenic
1165849207 19:38839548-38839570 AAAGCATCTTTAACAGTGCCTGG + Intronic
1167811725 19:51839249-51839271 AAGGCATGCTCAACCACGCCTGG - Intergenic
1167905026 19:52652291-52652313 CAAGCATGCTCCACCAAGCCTGG - Intronic
924984216 2:253984-254006 AAAGGATGTTAAACAAAACCTGG + Intronic
925262039 2:2537295-2537317 AAGTCATGCATAACAAAGACAGG - Intergenic
925826134 2:7850102-7850124 AATGCATGCTTTACACAGCTTGG + Intergenic
926128806 2:10287423-10287445 AAAGCATGCTCAAGAAATACTGG - Intergenic
926177424 2:10607382-10607404 AAATCATGTTTAACAAAATCTGG - Intronic
926965277 2:18402843-18402865 AAACCACTTTTAACAAAGCCAGG - Intergenic
927342137 2:21994525-21994547 AGAGCAGACTTAACAAAGCTGGG - Intergenic
929679078 2:43970296-43970318 AAAGCAGGCTCAAGAAAACCTGG + Intronic
930442510 2:51426893-51426915 GAAGCATGCTTACCAAAGGCTGG + Intergenic
930952162 2:57156091-57156113 AAAGCATGTATGAGAAAGCCTGG - Intergenic
931229424 2:60361615-60361637 AAAGAATGCTTATCAAAGTAGGG + Intergenic
931691342 2:64837207-64837229 AAACCATGCTGAAGAAAGCCAGG + Intergenic
931718973 2:65053605-65053627 AAAGCTTGCTTAACCCAACCAGG + Intergenic
931792384 2:65676097-65676119 TGAACATGCTTCACAAAGCCAGG - Intergenic
932972930 2:76567669-76567691 AAACCATCCTTAACAAAGGCAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933554634 2:83816631-83816653 AAAGGATGCTAAACATAGGCTGG - Intergenic
933898739 2:86834361-86834383 AATGTATGCTTAACCATGCCAGG + Intronic
935018796 2:99211092-99211114 AAAGCCTTCTTAACAAGGACAGG - Intronic
935437407 2:103049633-103049655 AAAGAATGCTTACCAAAGGCTGG - Intergenic
935581335 2:104758390-104758412 AAAGAATGCTTCTGAAAGCCAGG + Intergenic
936558102 2:113513405-113513427 AAAGCAGGCTCAATAAAGGCTGG - Intergenic
939731612 2:145791523-145791545 AAAGCATTTGTAACAGAGCCTGG - Intergenic
940713557 2:157191752-157191774 AAATCATGCTGAACAAGGCAGGG - Intergenic
941590645 2:167416450-167416472 AAAGGATGCTGCAGAAAGCCTGG + Intergenic
942931365 2:181497363-181497385 CAAGCATGTTTAATAAAACCAGG + Intronic
943394290 2:187313192-187313214 AAAACATGATTACCAAAACCAGG + Intergenic
943923431 2:193739345-193739367 AAAGCCTTCCTAAGAAAGCCAGG + Intergenic
946525086 2:220509623-220509645 CAAGCATGCTTATTACAGCCAGG + Intergenic
946676765 2:222168608-222168630 GAAGCATGGTTACCAGAGCCTGG - Intergenic
947264405 2:228261013-228261035 ATACCATGCTTAACCAGGCCTGG - Intergenic
1176881387 21:14198602-14198624 AGAGCATGCTTTACAAATCTGGG - Intronic
1178162513 21:29936163-29936185 AAAACATGCTTCGGAAAGCCTGG + Intronic
1178768596 21:35480512-35480534 AATGCATGCTTCCCAAAGCAGGG + Intronic
1179089790 21:38254187-38254209 AAAGCATGCTTAACAAAGCCTGG + Intronic
1180882469 22:19215751-19215773 AAATCATGGTGAACAAAGCTTGG - Intronic
1181627648 22:24132522-24132544 GAAGCAGGCTTTCCAAAGCCTGG + Intronic
1183373436 22:37448682-37448704 AAACCATCAGTAACAAAGCCAGG - Intergenic
949209781 3:1483703-1483725 TCACCATGCTTAGCAAAGCCTGG + Intergenic
951953484 3:28227773-28227795 AAAGAATGATCAGCAAAGCCTGG + Intergenic
953469175 3:43152392-43152414 AAAATAAGCTAAACAAAGCCTGG + Intergenic
954286993 3:49626114-49626136 AAAGCATCCTGAACAAAGCCAGG - Intronic
955279571 3:57581407-57581429 AAAGCATTCTAAACAAATCTAGG + Intronic
956871506 3:73422586-73422608 CAACCATGGTTAAGAAAGCCAGG - Intronic
959191578 3:103119287-103119309 GAAGGATGGTTACCAAAGCCTGG + Intergenic
959490995 3:106988518-106988540 AAATCCTGTTTAACAATGCCTGG + Intergenic
960674057 3:120177852-120177874 AAAGGAAGCTTAAGAAAGCTAGG + Intronic
961086208 3:124069524-124069546 AGGGCATGCTTAAGAAAGGCAGG + Intergenic
964443015 3:156731366-156731388 AAATCATGCATATAAAAGCCTGG - Intergenic
965075613 3:163971193-163971215 GAAGCATGCTTATCAGAGTCTGG - Intergenic
965918230 3:173877785-173877807 AAAGCATTTGTAACAATGCCTGG - Intronic
966677187 3:182602218-182602240 AAAGCACACAAAACAAAGCCAGG + Intergenic
967339947 3:188385684-188385706 AAAGCATGTTCCACAACGCCTGG - Intronic
971776015 4:30966028-30966050 ATAGCATGTTTAACAAGGCCAGG - Intronic
972184313 4:36510285-36510307 AAAGCATGCTTATAAAATGCAGG - Intergenic
973582759 4:52360362-52360384 AAAGCTTTATTTACAAAGCCAGG - Intergenic
974277449 4:59742176-59742198 AAAGCATCCTGAACAATACCTGG - Intergenic
975499969 4:75073839-75073861 AAAGCAAGCTTAACAAATGAGGG + Intergenic
975966631 4:79980955-79980977 AAAGCATGCTTATTCAAACCTGG - Intronic
977060836 4:92255200-92255222 AAAGCATGGTTTACCAAGCTGGG + Intergenic
977568288 4:98604314-98604336 AAAGAAGTCTTCACAAAGCCCGG - Intronic
977902144 4:102435305-102435327 AAAGCATGGTCAACAAAGGCCGG + Intergenic
978051192 4:104202324-104202346 CAGGCATGCTTCACCAAGCCCGG + Intergenic
978963345 4:114710954-114710976 AAAGCATAATAGACAAAGCCTGG - Intergenic
983202778 4:164880239-164880261 AATGCATGCTTTCCAAACCCGGG + Intronic
984461245 4:180039886-180039908 AAAGCATTTATAACAATGCCTGG - Intergenic
988061467 5:26175721-26175743 AGAGGATGCATAACAATGCCTGG + Intergenic
988599849 5:32629964-32629986 GAAGCATGCTGAACAGTGCCTGG - Intergenic
991592326 5:68265956-68265978 CAAGCACTCTTAAGAAAGCCTGG - Intronic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
993139370 5:84010946-84010968 AGAGCATCCTGAACAAAGTCAGG + Intronic
993228943 5:85206138-85206160 TTGGCATGCTTAACATAGCCAGG + Intergenic
993981410 5:94546708-94546730 AAAGCATTCCCAACAAAGACAGG + Intronic
995324739 5:110877220-110877242 AGAGGATGGTTAACAAAGGCTGG - Intergenic
995505585 5:112857153-112857175 AAGACATGCTTCAAAAAGCCAGG - Intronic
996647874 5:125839172-125839194 AAAGCATGATAAACAACACCTGG + Intergenic
997552440 5:134765209-134765231 CAGGCATGCTCCACAAAGCCTGG + Intronic
997669016 5:135655206-135655228 CAAGCACTCTTAGCAAAGCCGGG - Intergenic
1000039120 5:157472041-157472063 AAAGCATTCATAACAGTGCCTGG - Intronic
1001974797 5:175988866-175988888 AAAGCTTGCTTTACAATGTCAGG + Intronic
1002242637 5:177854912-177854934 AAAGCTTGCTTTACAATGTCAGG - Intergenic
1003452786 6:6251612-6251634 AAAGCATCTTTAACACAGACAGG + Intronic
1003977422 6:11357130-11357152 ACAACATGCTAAAGAAAGCCTGG - Intronic
1004262520 6:14120538-14120560 AAAACAGGTTTTACAAAGCCAGG - Intronic
1004504320 6:16235719-16235741 AAATTATCCTTAAAAAAGCCTGG - Intergenic
1005714002 6:28529786-28529808 AAAACTTTGTTAACAAAGCCAGG - Intronic
1008427556 6:51377173-51377195 ATAGCATCCCTAACAAAGCTGGG - Intergenic
1008937357 6:57006209-57006231 AAAGCATTCAGAACAGAGCCTGG + Intronic
1010762025 6:79734548-79734570 AAAGGTTGCTTGACAAAGCATGG - Intergenic
1012319995 6:97831460-97831482 AAAACATGCTTGATAAAGCTAGG + Intergenic
1013182539 6:107730465-107730487 AATGCCAGCTTAACAAAGCAAGG + Intronic
1013654219 6:112228629-112228651 AAAGCCTGTTACACAAAGCCAGG + Intronic
1014506730 6:122268778-122268800 ATAGCAAGCTTATCAAAGTCAGG + Intergenic
1015098038 6:129440738-129440760 AATCCATGCTTGACAAAGCGAGG - Intronic
1015135748 6:129868028-129868050 TGAGCCTGCTAAACAAAGCCAGG - Intergenic
1017266991 6:152458700-152458722 AAAGCATGTGTAACAAGACCAGG - Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018844952 6:167549075-167549097 AAAAAGTGCTTAACAAGGCCAGG - Intergenic
1020388956 7:7638586-7638608 CAGGCATGCTTAACCATGCCTGG - Intronic
1020503963 7:8959924-8959946 TAAGCATCCTTAATAAAGCCAGG + Intergenic
1020690102 7:11343795-11343817 AATGCATGCTTAATAAAGATAGG + Intergenic
1020982633 7:15090454-15090476 AAAACATGCTTTACAAAGAATGG + Intergenic
1024636076 7:51291463-51291485 AAAGCAAGCTTTATCAAGCCAGG + Intronic
1024896609 7:54268296-54268318 AAAGCAGGCTTAGCAGAGCCTGG - Intergenic
1025926414 7:65963891-65963913 AAAGCAGGCTTATCAAATACAGG - Intronic
1027919456 7:84374021-84374043 AAAGCATGGTCAACAAGGCCTGG + Intronic
1030045065 7:105487727-105487749 AAACCTTAATTAACAAAGCCAGG + Intronic
1030274594 7:107706872-107706894 AAAGTATGCTTAACAAGGCTGGG + Intronic
1033169133 7:139067967-139067989 GTAGCATTCTTATCAAAGCCAGG - Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1036570406 8:9975385-9975407 TAAACAACCTTAACAAAGCCTGG - Intergenic
1037484086 8:19331167-19331189 AAAGCAGGCTGCTCAAAGCCAGG - Intronic
1037943128 8:22969550-22969572 AAAGAATGCAAAACGAAGCCAGG + Intronic
1039840219 8:41287562-41287584 AAAGGATGCTTGAAAAATCCAGG - Intronic
1042470653 8:69183678-69183700 AAATCATTGTTAACAATGCCTGG - Intergenic
1044135984 8:88585981-88586003 AAATCATTCTTAACAAGTCCTGG - Intergenic
1049513008 8:143039245-143039267 CACGCATGCTTAGCAAGGCCTGG - Exonic
1049894757 9:102861-102883 AAAGCAGGCTCAATAAAGGCTGG + Intergenic
1050577956 9:7018400-7018422 AAAGCATATTTAACACAGCCAGG + Intronic
1052395251 9:27930713-27930735 AGATCATGCTTAACAATACCGGG + Intergenic
1052539323 9:29787690-29787712 AAAGCATGGTTACCAGAGGCTGG + Intergenic
1053735964 9:41102852-41102874 AAAGCAGGCTCAATAAAGGCTGG + Intergenic
1054692409 9:68328547-68328569 AAAGCAGGCTCAATAAAGGCTGG - Intronic
1055051352 9:71984609-71984631 ACAGCATGCTTAGCATAGCTAGG + Intronic
1056652341 9:88476924-88476946 AAACCATGCATAACGAGGCCTGG - Exonic
1059014636 9:110502696-110502718 AAAACATGTTTAACAAAGCAAGG + Intronic
1060156427 9:121323276-121323298 ATAGCACAATTAACAAAGCCAGG + Intronic
1061737908 9:132675336-132675358 AAACAATGCTAATCAAAGCCCGG - Intronic
1062142328 9:134966531-134966553 ACAGCAAGCCTAACAGAGCCAGG + Intergenic
1186107669 X:6225562-6225584 AGTGCATGCTTAAGAAATCCGGG - Intronic
1187625044 X:21101983-21102005 AAAGGATGCTTATCAGAGGCTGG + Intergenic
1187726178 X:22204433-22204455 AAAGCATACTTTAGAAAGCTTGG + Intronic
1193802683 X:85955074-85955096 AAAGGATGGTTATCAGAGCCTGG + Intronic
1194505601 X:94730033-94730055 AAAGGATGTATAAAAAAGCCTGG - Intergenic
1196594702 X:117531245-117531267 AAAAAAGGATTAACAAAGCCTGG + Intergenic
1197019002 X:121663731-121663753 AAAGCATTTTTAACAGCGCCTGG - Intergenic
1197258822 X:124294223-124294245 CAAGCATGCATCACAAAGCCAGG + Intronic
1198843012 X:140879600-140879622 AAAGAATGCTTAACCTAGCCTGG + Intergenic
1201792113 Y:17853453-17853475 ATAGCATGTTTAACATAGCCAGG - Intergenic
1201792335 Y:17856080-17856102 ATAGCATGTTTAATATAGCCAGG + Intergenic
1201809219 Y:18049906-18049928 ATAGCATGTTTAATATAGCCAGG - Intergenic
1201809441 Y:18052536-18052558 ATAGCATGTTTAACATAGCCAGG + Intergenic
1201925386 Y:19280492-19280514 AAAGCATGTTTATCAGAGTCTGG - Intergenic
1202087029 Y:21149081-21149103 AAAGGAAGCTCAACAAAGCATGG + Intergenic
1202353713 Y:24023067-24023089 ATAGCAGGTTTAACATAGCCAGG - Intergenic
1202353873 Y:24025324-24025346 ATAGCATGTTTAATATAGCCAGG + Intergenic
1202516906 Y:25644788-25644810 ATAGCATGTTTAATATAGCCAGG - Intergenic
1202517066 Y:25647048-25647070 ATAGCAGGTTTAACATAGCCAGG + Intergenic