ID: 1179095478

View in Genome Browser
Species Human (GRCh38)
Location 21:38310846-38310868
Sequence CAAAACATGGAGAGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179095478_1179095487 6 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095487 21:38310875-38310897 CTCCCAGGTGGGCCATTACAGGG No data
1179095478_1179095482 -6 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095482 21:38310863-38310885 GTTTTGTCCTGCCTCCCAGGTGG No data
1179095478_1179095483 -5 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095483 21:38310864-38310886 TTTTGTCCTGCCTCCCAGGTGGG No data
1179095478_1179095481 -9 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095481 21:38310860-38310882 CATGTTTTGTCCTGCCTCCCAGG No data
1179095478_1179095491 26 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095491 21:38310895-38310917 GGGTGCATCCAAAAAAGCATAGG No data
1179095478_1179095486 5 Left 1179095478 21:38310846-38310868 CCTGGCTTCCTCTCCATGTTTTG No data
Right 1179095486 21:38310874-38310896 CCTCCCAGGTGGGCCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179095478 Original CRISPR CAAAACATGGAGAGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr