ID: 1179097236

View in Genome Browser
Species Human (GRCh38)
Location 21:38326833-38326855
Sequence CCTCATAAGCAACTGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179097233_1179097236 3 Left 1179097233 21:38326807-38326829 CCAGGTTTGTTACTCTCAGAGTC No data
Right 1179097236 21:38326833-38326855 CCTCATAAGCAACTGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179097236 Original CRISPR CCTCATAAGCAACTGTGGAC AGG Intergenic
No off target data available for this crispr