ID: 1179097267

View in Genome Browser
Species Human (GRCh38)
Location 21:38327064-38327086
Sequence GGACCACTGATTAAAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179097267_1179097270 6 Left 1179097267 21:38327064-38327086 CCTCACACTTTAATCAGTGGTCC No data
Right 1179097270 21:38327093-38327115 TGCTTACAAGCCCAGCTGCTCGG No data
1179097267_1179097271 7 Left 1179097267 21:38327064-38327086 CCTCACACTTTAATCAGTGGTCC No data
Right 1179097271 21:38327094-38327116 GCTTACAAGCCCAGCTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179097267 Original CRISPR GGACCACTGATTAAAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr