ID: 1179099146

View in Genome Browser
Species Human (GRCh38)
Location 21:38341531-38341553
Sequence CCCTTTCCCCAAAGAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179099146_1179099151 30 Left 1179099146 21:38341531-38341553 CCTTGTTCTCTTTGGGGAAAGGG No data
Right 1179099151 21:38341584-38341606 CCTTCTTACCCAGCCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179099146 Original CRISPR CCCTTTCCCCAAAGAGAACA AGG (reversed) Intergenic
No off target data available for this crispr