ID: 1179100951

View in Genome Browser
Species Human (GRCh38)
Location 21:38355338-38355360
Sequence GCCAAGAAGACCTACATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179100951_1179100954 -9 Left 1179100951 21:38355338-38355360 CCTGAAATGTAGGTCTTCTTGGC No data
Right 1179100954 21:38355352-38355374 CTTCTTGGCCACAGTGGGAAAGG No data
1179100951_1179100956 -7 Left 1179100951 21:38355338-38355360 CCTGAAATGTAGGTCTTCTTGGC No data
Right 1179100956 21:38355354-38355376 TCTTGGCCACAGTGGGAAAGGGG No data
1179100951_1179100955 -8 Left 1179100951 21:38355338-38355360 CCTGAAATGTAGGTCTTCTTGGC No data
Right 1179100955 21:38355353-38355375 TTCTTGGCCACAGTGGGAAAGGG No data
1179100951_1179100958 4 Left 1179100951 21:38355338-38355360 CCTGAAATGTAGGTCTTCTTGGC No data
Right 1179100958 21:38355365-38355387 GTGGGAAAGGGGAGCCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179100951 Original CRISPR GCCAAGAAGACCTACATTTC AGG (reversed) Intergenic
No off target data available for this crispr