ID: 1179101516

View in Genome Browser
Species Human (GRCh38)
Location 21:38359077-38359099
Sequence CATGTGATTTGGGTTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179101516_1179101525 3 Left 1179101516 21:38359077-38359099 CCTGGAGAAACCCAAATCACATG No data
Right 1179101525 21:38359103-38359125 ATGGGAGAGTGAAGACCCAAGGG No data
1179101516_1179101524 2 Left 1179101516 21:38359077-38359099 CCTGGAGAAACCCAAATCACATG No data
Right 1179101524 21:38359102-38359124 GATGGGAGAGTGAAGACCCAAGG No data
1179101516_1179101528 15 Left 1179101516 21:38359077-38359099 CCTGGAGAAACCCAAATCACATG No data
Right 1179101528 21:38359115-38359137 AGACCCAAGGGAGGGATGTGCGG No data
1179101516_1179101526 6 Left 1179101516 21:38359077-38359099 CCTGGAGAAACCCAAATCACATG No data
Right 1179101526 21:38359106-38359128 GGAGAGTGAAGACCCAAGGGAGG No data
1179101516_1179101527 7 Left 1179101516 21:38359077-38359099 CCTGGAGAAACCCAAATCACATG No data
Right 1179101527 21:38359107-38359129 GAGAGTGAAGACCCAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179101516 Original CRISPR CATGTGATTTGGGTTTCTCC AGG (reversed) Intergenic
No off target data available for this crispr