ID: 1179101770

View in Genome Browser
Species Human (GRCh38)
Location 21:38360652-38360674
Sequence ATGTTGTGGGAGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179101759_1179101770 20 Left 1179101759 21:38360609-38360631 CCACCAAAATCTCATCTTGAATT 0: 249
1: 8219
2: 11584
3: 9790
4: 8797
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data
1179101761_1179101770 -9 Left 1179101761 21:38360638-38360660 CCCATAATTCCCACATGTTGTGG 0: 708
1: 1990
2: 3526
3: 4232
4: 4298
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data
1179101760_1179101770 17 Left 1179101760 21:38360612-38360634 CCAAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data
1179101757_1179101770 22 Left 1179101757 21:38360607-38360629 CCCCACCAAAATCTCATCTTGAA 0: 222
1: 8206
2: 11815
3: 9812
4: 7210
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data
1179101758_1179101770 21 Left 1179101758 21:38360608-38360630 CCCACCAAAATCTCATCTTGAAT 0: 230
1: 8455
2: 11559
3: 10114
4: 7531
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data
1179101763_1179101770 -10 Left 1179101763 21:38360639-38360661 CCATAATTCCCACATGTTGTGGG 0: 692
1: 1998
2: 3538
3: 4205
4: 4129
Right 1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179101770 Original CRISPR ATGTTGTGGGAGAGGGCAGG TGG Intergenic
No off target data available for this crispr