ID: 1179106318

View in Genome Browser
Species Human (GRCh38)
Location 21:38403797-38403819
Sequence CTGTGCTTGTGGAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 342}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179106318_1179106331 20 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106331 21:38403840-38403862 CTACCCAGGAGAACATTTTGGGG 0: 1
1: 1
2: 1
3: 11
4: 122
1179106318_1179106324 6 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106324 21:38403826-38403848 GCCAGCCTCCCTGGCTACCCAGG 0: 1
1: 1
2: 4
3: 42
4: 350
1179106318_1179106332 21 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106332 21:38403841-38403863 TACCCAGGAGAACATTTTGGGGG 0: 1
1: 0
2: 3
3: 27
4: 314
1179106318_1179106321 -3 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106321 21:38403817-38403839 CAGCCTCCAGCCAGCCTCCCTGG 0: 1
1: 0
2: 13
3: 91
4: 779
1179106318_1179106329 18 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106329 21:38403838-38403860 GGCTACCCAGGAGAACATTTTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1179106318_1179106330 19 Left 1179106318 21:38403797-38403819 CCAGCTGCCTTCCACAAGCACAG 0: 1
1: 1
2: 1
3: 36
4: 342
Right 1179106330 21:38403839-38403861 GCTACCCAGGAGAACATTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179106318 Original CRISPR CTGTGCTTGTGGAAGGCAGC TGG (reversed) Intronic
900580265 1:3405272-3405294 TTGTTCTTGAGGAAAGCAGCCGG + Intronic
900894382 1:5473144-5473166 CTGTGCATTTGGCAGGCAGTCGG - Intergenic
902258725 1:15207717-15207739 CTTTGCAGGTGGAAGTCAGCAGG - Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904089839 1:27937091-27937113 CTGTGCTTCAGGAAGACACCTGG - Intronic
904313749 1:29646492-29646514 CTGAGCTTCTGGAAAGGAGCAGG - Intergenic
905215220 1:36401809-36401831 CTGTGCTGGTGGGAGCCTGCAGG + Intergenic
905502109 1:38447609-38447631 ATGGGGCTGTGGAAGGCAGCTGG + Intergenic
905541345 1:38762963-38762985 CTGTCCTTGAGGAAGGCGGTGGG - Intergenic
905545147 1:38791857-38791879 CTGTGCTTGTGGAAAGGATGGGG + Intergenic
905658937 1:39705529-39705551 ATGCCCTTGAGGAAGGCAGCAGG - Intronic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
907076668 1:51585211-51585233 TTGGACTTGTGGAAGGCAGTGGG + Intronic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
908634492 1:66147468-66147490 GTGGGCATGTGGAAGGTAGCTGG - Intronic
915226711 1:154417098-154417120 ATGTGCTTCTGGAAGGTGGCAGG - Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
916196522 1:162228703-162228725 GTTTGCTTTTGGCAGGCAGCCGG - Intronic
916833424 1:168516459-168516481 CTGTTCATTTGGAAGTCAGCTGG + Intergenic
917521128 1:175749294-175749316 CTGTCTCTGTGGCAGGCAGCTGG - Intergenic
917708180 1:177656135-177656157 CTGAGCCTGTGGAAGTCACCTGG - Intergenic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
920248085 1:204603328-204603350 CTGTAATTGTGCAAGGCATCTGG + Intergenic
920270778 1:204762141-204762163 CTGTCCTGGGTGAAGGCAGCAGG - Intergenic
920702159 1:208226078-208226100 CTGGGCTAGGTGAAGGCAGCAGG - Intronic
920953597 1:210597566-210597588 CTCTGCTTGTGGAAAGGAGAAGG - Intronic
921053017 1:211524595-211524617 CTGTGCCGGTGGCAGGCAGCTGG + Intergenic
921621458 1:217330323-217330345 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
921924916 1:220703426-220703448 CTGGGCTGGTTCAAGGCAGCGGG + Intergenic
923280570 1:232439278-232439300 CTGTGCACCTGGCAGGCAGCAGG - Exonic
923391262 1:233515782-233515804 CTGAGCCTGTGGAAGGCAGGGGG - Intergenic
923437267 1:233979197-233979219 CTGTGCTTCAGGAAGGTACCTGG + Intronic
1064353221 10:14595913-14595935 CTGTGGTTGTGGAGGGCCACGGG - Intronic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1066481266 10:35798014-35798036 TTTTGCTTGTTGAAGGCAACAGG + Intergenic
1067111663 10:43405872-43405894 CGGTTCTTGTGGAGGGCAACAGG - Intronic
1067194250 10:44101653-44101675 CTTTGCTTGTGCAATGAAGCTGG - Intergenic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070366847 10:75744944-75744966 CTGTGCCTGTGCATGTCAGCAGG - Intronic
1070742401 10:78911645-78911667 CTGTCCCTGTGGAACGAAGCAGG - Intergenic
1075124482 10:119688655-119688677 TTTTGCTTCTGGAAGGCAGTTGG - Intergenic
1075413256 10:122244500-122244522 GTGTCCTTGTGGAAGACAGCAGG + Intronic
1076080537 10:127576511-127576533 CTGTGCATCTTGGAGGCAGCAGG + Intergenic
1077762615 11:5119442-5119464 GGGTGTTTGTGGAAGGCAGGTGG + Intergenic
1078463034 11:11529969-11529991 GGGTGCTTGAGCAAGGCAGCTGG + Intronic
1079022207 11:16918389-16918411 CTCACCTTGTGGAAGGCAGCAGG + Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079987950 11:27218052-27218074 CTGTGGCTGTGCATGGCAGCTGG - Intergenic
1081235594 11:40643621-40643643 CCGTGCTGGTGGACGGCAGGGGG - Intronic
1081636374 11:44725166-44725188 CTGCACTTGTGGAATGCTGCTGG - Intergenic
1081781189 11:45714165-45714187 CTGTTCTTGTGGTTGGCAGGTGG - Intergenic
1083477370 11:62923014-62923036 CTGTGCTTCTCAAAGCCAGCTGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1083731169 11:64653512-64653534 GGGTGGTTGTGGAAGGCAGGAGG - Intronic
1084117189 11:67049278-67049300 CTGAGCATGTCGCAGGCAGCGGG + Exonic
1084386402 11:68845360-68845382 CTGTGCTCTTGGCAGGCAACAGG - Intergenic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1087111790 11:94477863-94477885 CTGGGCTTTTGGAAAGAAGCGGG - Intronic
1087154998 11:94893919-94893941 CTGTGTTTGTGGAAGCCATCAGG + Intergenic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1091659793 12:2374792-2374814 CTGTGCTGGTTGGATGCAGCAGG - Intronic
1091916707 12:4275200-4275222 CTGTCCTTGTGGGCCGCAGCCGG + Intronic
1092818849 12:12334577-12334599 CTGTTCTTGTGGCAGCCACCAGG - Intronic
1092991687 12:13909089-13909111 ATGAGCTTGTGGAAGGCAGAAGG - Intronic
1093678345 12:21970454-21970476 CCTTGCTCCTGGAAGGCAGCAGG - Intergenic
1094403293 12:30085993-30086015 TTGTGCTTGTGGGAATCAGCTGG - Intergenic
1096066108 12:48742156-48742178 CTGTGCTTGTACCAGGCAGAAGG - Intergenic
1096675601 12:53224139-53224161 CTGTGCTCATGGAAAGCAGAGGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097288326 12:57894471-57894493 CTGTGCTTGTGAATGGCTGAGGG + Intergenic
1098068653 12:66647981-66648003 CTATGCTAGTGCAAAGCAGCAGG - Intronic
1098559128 12:71852265-71852287 CTGAGGTTGTGCAGGGCAGCAGG + Intronic
1098819958 12:75214608-75214630 CTCAGATGGTGGAAGGCAGCAGG + Intergenic
1099467526 12:83005682-83005704 CTGTGCTTGGTGGAGGCAGGGGG + Intronic
1099674840 12:85745434-85745456 CTGACCTTGTGGAAGGGGGCTGG + Intergenic
1100246027 12:92757747-92757769 CTCTGATTCTGGAAGCCAGCTGG - Intronic
1101842663 12:108339457-108339479 CTGGGCTTGTGGGTGGCGGCGGG + Intergenic
1102479332 12:113210469-113210491 CTGTGCTTGGCCAAGGCAGTAGG - Intronic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104449048 12:128854280-128854302 CTGTGCGGGTGGGAGGCGGCGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104774994 12:131385763-131385785 CGGTGCTTGTGGAGGACATCTGG - Intergenic
1104872735 12:132011951-132011973 CTGTGCCTGTGGAAGCCAGCAGG - Intronic
1104985820 12:132596442-132596464 CTGTGCTTTTTGACGCCAGCTGG + Intergenic
1105415001 13:20203680-20203702 TTTTGCTTCTGGAAGGCAGTTGG + Intergenic
1105930951 13:25051290-25051312 TTTTGTTTGTTGAAGGCAGCAGG - Intergenic
1105956880 13:25291801-25291823 CTGTGCATGTGAAAGGCACAGGG + Intergenic
1106091315 13:26597612-26597634 CTGTTCTGGGGGAAGGCAGAGGG - Intronic
1106132832 13:26953816-26953838 CTGTCCTTGGCCAAGGCAGCAGG - Intergenic
1106393368 13:29357291-29357313 CTGAGCTTGTGGACGTTAGCAGG - Intronic
1106618257 13:31350255-31350277 TTATACTTGTGGGAGGCAGCGGG + Intergenic
1107268910 13:38591350-38591372 CTGTGCTAGTGATAGGCAGGTGG - Intergenic
1107750409 13:43559156-43559178 CTGTGCCTGTACAAGGAAGCAGG + Intronic
1110143069 13:72154897-72154919 CTGCCATTGTGGAAGGCAGTTGG - Intergenic
1110443281 13:75549252-75549274 CTGCTCTTGCGGGAGGCAGCGGG - Intronic
1112896087 13:104302480-104302502 CTGTGGTTCTGTAATGCAGCAGG + Intergenic
1113076576 13:106473119-106473141 CCGTGCTTTTTGAAGGGAGCTGG + Intergenic
1113285204 13:108838906-108838928 TGGTGCTTGTGGAAGGAAGAAGG + Intronic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113794129 13:113047027-113047049 CAGTCGTGGTGGAAGGCAGCGGG + Intronic
1114834935 14:26192861-26192883 GTCTTCTTGTGGAATGCAGCTGG - Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1118081152 14:62362213-62362235 CTGTTCTTGAGGATGGAAGCTGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120554492 14:85912442-85912464 TTGTGCTTGAGGAATTCAGCAGG + Intergenic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121234138 14:92380001-92380023 CTGTGCTGGTGGGAGGGAGGGGG - Intronic
1121983317 14:98474416-98474438 CTGTCCCTGTGGAAGGCACTAGG + Intergenic
1122151667 14:99729214-99729236 CTGAGCCTGTGGAAGGCCACTGG - Intergenic
1122158606 14:99766769-99766791 CTGGGATTGTGGAAATCAGCTGG - Intronic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1127127993 15:55832120-55832142 CATTTCTTGTGGGAGGCAGCAGG - Intronic
1127961507 15:63894194-63894216 CTGTATGTGTTGAAGGCAGCTGG + Intergenic
1129453736 15:75664888-75664910 CTGTGCTTGTGGATGGGATGTGG - Intergenic
1129879708 15:78998637-78998659 AGCTGCTTTTGGAAGGCAGCTGG + Intronic
1130563178 15:84974565-84974587 GTGGGATTGTGGAAGGCAGGGGG + Intergenic
1131908640 15:97171829-97171851 TTGTGCTCATGGAAGGCACCTGG + Intergenic
1132222836 15:100117716-100117738 CTGTGCTTCTGCAAGGCCCCAGG + Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132664003 16:1073409-1073431 GTGAGCTCCTGGAAGGCAGCAGG + Intergenic
1133256324 16:4518575-4518597 CTGGGGTTCAGGAAGGCAGCAGG - Intronic
1134136139 16:11677527-11677549 CTGTGCTTGCGGCAGGGAGCCGG + Exonic
1135304312 16:21355388-21355410 CTGTGCTTGTGGATTGCTGCTGG + Intergenic
1136301055 16:29334518-29334540 CTGTGCTTGTGGATTGCTGCTGG + Intergenic
1137292848 16:47063665-47063687 CTGTGCCTGGGAAAGGAAGCAGG - Intergenic
1137964179 16:52914468-52914490 CTGCCCTTGTGTAAGGCAGAAGG + Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138344067 16:56309179-56309201 CTGTCCTCGTAGAAGGGAGCTGG - Intronic
1138498696 16:57425090-57425112 CTGTCCTTGTGGCAGGGAGAAGG - Intergenic
1139923793 16:70474850-70474872 CTGTGCGAGTGGACGGCCGCCGG + Exonic
1140206588 16:72938496-72938518 ATGTGTTTGCGGGAGGCAGCGGG + Intronic
1142062757 16:88041255-88041277 CTGTGCTTGTGGATTGCTGCCGG + Intronic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142194579 16:88733510-88733532 CTGGGCTTGGGGAGGCCAGCTGG + Intronic
1142647219 17:1322323-1322345 CTGACATTGTGGGAGGCAGCTGG - Intergenic
1143101635 17:4507738-4507760 CTGTGCTTGGGGAAAGCAGGGGG + Intronic
1144619651 17:16809324-16809346 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1144674565 17:17153573-17153595 CGGTGCTTGTGCAAGGTAGCAGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144893034 17:18506380-18506402 CTGAGCATGAGGAAGGCAGTTGG + Intergenic
1145139183 17:20437912-20437934 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1148092205 17:45029411-45029433 CTGTACTTGTGGGTGGCATCCGG + Intronic
1148572187 17:48678798-48678820 CTATGCTTCTGGAAGGGTGCAGG - Intergenic
1148958083 17:51370355-51370377 CTGCAGTTGTGAAAGGCAGCGGG - Intergenic
1149154773 17:53614633-53614655 CTGTTTTAGTGGGAGGCAGCAGG - Intergenic
1149302640 17:55318932-55318954 CTGTGCTTCTGAAAGCGAGCAGG - Intronic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1153246138 18:3074252-3074274 CTGTGTATGTGGACTGCAGCTGG - Intronic
1153457403 18:5295812-5295834 CTGTGCCTGTGCCAGGCTGCAGG - Exonic
1153616566 18:6940500-6940522 CTGTGCTTGTGAAAGGCCAAGGG + Intergenic
1154262050 18:12843611-12843633 CTCCGCTGGTGGAGGGCAGCAGG + Intronic
1155137289 18:23008141-23008163 CAGTCCTTGTGAAAGGCAGAAGG - Intronic
1156309533 18:35909295-35909317 CTGTCCTTGGGCCAGGCAGCAGG - Intergenic
1157325931 18:46668920-46668942 CTGGCCATGTGGGAGGCAGCTGG - Intronic
1157327382 18:46678913-46678935 CTGGGCTTGGGGCAGTCAGCTGG - Intronic
1158883806 18:61806469-61806491 CTGTGTTTGTGGAAGGCCTGAGG + Intergenic
1160106388 18:75982333-75982355 ATGTGCCTGAGGAAGGCGGCTGG - Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1160940379 19:1618006-1618028 CTGGGCTGGTGGAAGGCACAGGG + Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1161772011 19:6235897-6235919 CTGTGCCTGGGGACAGCAGCAGG - Intronic
1164558962 19:29275461-29275483 CTGTGCTGGGGAAAGACAGCAGG - Intergenic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165528672 19:36378622-36378644 CTGTTCTTTAGGAAGGCAGCGGG - Intronic
1166270018 19:41708023-41708045 CTGTCCTTGGGGAAGGCTCCAGG - Intronic
1168120300 19:54248265-54248287 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168123955 19:54272553-54272575 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168178409 19:54642981-54643003 CTGTGTTTGTGGATGGCACTGGG - Intronic
926116938 2:10219377-10219399 CTCAGCTGGTGGGAGGCAGCAGG - Intergenic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
927053418 2:19350593-19350615 CTGCGCTTGGGAAAGGCCGCGGG + Intergenic
927939360 2:27094027-27094049 ATGAGCTTGTGGAGGACAGCTGG + Intronic
928308144 2:30188172-30188194 CTGGGCTCGGGGAAGGTAGCAGG + Intergenic
929746068 2:44660193-44660215 CTGTCTTAGTGGAAGACAGCTGG + Intronic
930056297 2:47254660-47254682 AAGTGCTGGTGGAAGGTAGCTGG - Intergenic
931288151 2:60849798-60849820 ATGTCCTTGTGGAAGGCAGAGGG + Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
931766743 2:65463571-65463593 CTGGGCTTGGGGATGGGAGCTGG + Intergenic
932329379 2:70889071-70889093 CTGGGCTCGGGAAAGGCAGCGGG - Intergenic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934563639 2:95326581-95326603 CTGTGCTTGTGAATGGCGGTGGG + Intronic
934576349 2:95403953-95403975 TGGTGCTTGTGTAAGACAGCAGG + Intronic
935654227 2:105408159-105408181 GTGTGCTTTTGCTAGGCAGCCGG + Intronic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
938293556 2:130162953-130162975 CTGTCCCTGTGGAGGGCAGGAGG - Intronic
938462999 2:131510008-131510030 CTGTCCCTGTGGAGGGCAGGAGG + Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939639086 2:144617677-144617699 TTTTGCTTGTTAAAGGCAGCAGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
941253334 2:163195632-163195654 CTGTGTTTGTGACAGACAGCAGG + Intergenic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
942972207 2:181970808-181970830 CTCTGCTTGTGGAAAGGAGATGG - Intronic
944584316 2:201160176-201160198 CTGTGCCTGTGGCTGGCATCAGG + Intronic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
948128197 2:235580438-235580460 CGGTGCTTGTTGGAGGCAGTGGG + Intronic
948488282 2:238295051-238295073 CAGTGCTTGTTGCAGGCAGAGGG - Intergenic
948773327 2:240263876-240263898 CTGTCATGGTGGAAGGCAACAGG - Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948972539 2:241440526-241440548 CTGTGCTTTTGGAAGGCCCCAGG + Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1168789746 20:568239-568261 CTCTGCTTGGGCTAGGCAGCTGG + Intergenic
1169422413 20:5471117-5471139 CTGTGCGTTTGATAGGCAGCTGG + Intergenic
1170196918 20:13698560-13698582 CTGTGCTTGTGTATGGTAGATGG - Intergenic
1170507407 20:17041802-17041824 GTTTGCTTTTAGAAGGCAGCTGG + Intergenic
1171143799 20:22764743-22764765 GTGTGCCTGTGAAAGGCTGCAGG + Intergenic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171458024 20:25282832-25282854 AGGTGCTGGTGGAGGGCAGCGGG + Intronic
1171473472 20:25390317-25390339 CGGTGCCTGGGGAAGGGAGCGGG + Intronic
1171723312 20:28588932-28588954 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1171787909 20:29488388-29488410 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1171860030 20:30391000-30391022 CTGTGCTTTGGGAAGGCAATGGG - Intronic
1172406462 20:34693546-34693568 CTGTCCTTGGGGAAGGCAGTGGG - Intergenic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1174106200 20:48164101-48164123 GTGTGCTTGTGTAGGGGAGCTGG - Intergenic
1175063251 20:56263156-56263178 CTGGGCTTGGGGGAGGCAGCAGG + Intergenic
1175262963 20:57686254-57686276 CTGGGCATCTGGCAGGCAGCAGG - Intronic
1175778707 20:61668882-61668904 GGGTGCTGGTGGAAGGCACCCGG - Intronic
1176312087 21:5157113-5157135 CTGTGCTTGCGGGAGGCGGTGGG - Intergenic
1176953889 21:15077549-15077571 CTGTGTATCTGGAAGACAGCAGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178598492 21:33976030-33976052 TTGTTCTTGTGGAATGTAGCCGG - Intergenic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179346719 21:40565109-40565131 CTCGGCTACTGGAAGGCAGCAGG - Intronic
1179844961 21:44104917-44104939 CTGTGCTTGCGGGAGGCGGTGGG + Exonic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180171349 21:46060270-46060292 TTGTGCTTGCTGAAGGCAGATGG - Intergenic
1180249320 21:46570238-46570260 CTGCCCTTCTGGAGGGCAGCAGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181987064 22:26807136-26807158 CTGTGCTTCGGGAAGGCGCCAGG - Intergenic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
950077345 3:10196436-10196458 CTGGGCCTGTGGAAGGCAGTGGG + Intronic
950443947 3:13025435-13025457 GTGCACTTGAGGAAGGCAGCAGG + Intronic
950606282 3:14084122-14084144 CCAGGCTTGTGGTAGGCAGCAGG - Intergenic
952119150 3:30220680-30220702 CTGAGCTGGTGGGGGGCAGCAGG + Intergenic
952500991 3:33961843-33961865 CTGGGCTTCTGGAAGGCGTCAGG + Intergenic
952866822 3:37860781-37860803 CTGTGCTTGTGCAAGGCAGCTGG - Intergenic
952981462 3:38739394-38739416 CTGTCCTTGTGGGAGGGAGCAGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953798451 3:46003073-46003095 CTATCCTTGTAGAAGGCAGCTGG + Intergenic
954314837 3:49795509-49795531 CTGGTCTTGGAGAAGGCAGCAGG - Intronic
955330249 3:58041432-58041454 CTGGGCTTTTGGATGTCAGCAGG + Intronic
955343210 3:58141695-58141717 CTGCCCTTTTGGAAGGCAGTTGG - Intronic
957961760 3:87264263-87264285 ATGTGCTTGTTAAAGGCAACAGG - Intronic
959483170 3:106897950-106897972 GTGTGCTTGTGGTAGGAAGTAGG + Intergenic
960799163 3:121520620-121520642 CTGTTCCTGTGGAAAACAGCAGG + Intronic
961213764 3:125144361-125144383 CAGTGCTTGTCCAAGGCTGCAGG + Intronic
961737959 3:129014165-129014187 CTGGGCATGAGGGAGGCAGCTGG + Intronic
963026563 3:140924880-140924902 TTGTGCTTGTTCAAGGCAGGAGG + Intergenic
963386751 3:144605936-144605958 CTGTGCTGGTGGAAGTCATGTGG + Intergenic
964348549 3:155779985-155780007 CTGTGCTTCTGTAACACAGCAGG + Intronic
964880306 3:161416486-161416508 CTGTTCTTGTGGTAGGAAGGAGG + Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966256881 3:177927112-177927134 TCGTGCTAGTGGAAGGCATCAGG + Intergenic
969438458 4:7202103-7202125 CTGTGCTTGTGGGAACCTGCTGG - Intronic
969497514 4:7534605-7534627 GGGTCCTTGTGGAGGGCAGCAGG + Intronic
969620624 4:8277076-8277098 CTGTTCATGTGGAACGCAGGCGG - Intronic
971134157 4:23848820-23848842 GTGTCCTTGAGGAAGGCATCTGG + Intronic
971533365 4:27717099-27717121 CTGTAATTGTGGCAGGCAGGGGG + Intergenic
972738232 4:41866054-41866076 CTGGGGTTGGGGAAGGCAGGTGG - Intergenic
972750550 4:41983410-41983432 CTGCGCTTGAGGAAGCCAGTGGG + Exonic
974020268 4:56686906-56686928 CTGTGCTAGTAGAAAGCAGGGGG + Intergenic
974152577 4:58028354-58028376 CTGTCCTTGTGTATGGAAGCTGG - Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
976148083 4:82063259-82063281 TTGTGGTTGTGGGAGGCAGGTGG - Intergenic
976163372 4:82227771-82227793 CTATGCTTTTGGAAGGGAGGTGG - Intergenic
977399228 4:96510396-96510418 CTATGTTTGTGGAAGGCACTGGG - Intergenic
978268514 4:106858758-106858780 CTGAAGTTCTGGAAGGCAGCTGG - Intergenic
978431402 4:108636745-108636767 CTGGGCTTCTGGCAGACAGCAGG + Intergenic
979611805 4:122697479-122697501 ATGTGATTTTGGTAGGCAGCTGG + Intergenic
982042131 4:151407669-151407691 CTGCGCTTGTGGATGACTGCAGG - Intergenic
982566902 4:156997085-156997107 CTGAGGCTGTGCAAGGCAGCAGG + Intergenic
985351746 4:189070953-189070975 GTGTGCCTGTGTAAGGCAGCGGG - Intergenic
985438200 4:189954840-189954862 CTGTGCTTTGGGAAGCCAACGGG - Intronic
985618486 5:938781-938803 TTGGGCATGTGGGAGGCAGCAGG - Intergenic
986265503 5:6186820-6186842 GTGGGCTTCTGGATGGCAGCGGG + Intergenic
987737964 5:21869355-21869377 ATGTACTTGTGGAAGGCAAAGGG + Intronic
989216270 5:38907747-38907769 CTGTGGTTGGGGGAGGCTGCAGG - Intronic
990774266 5:59287322-59287344 CTCTGCTTGTGGAAAGGAGAAGG + Intronic
993252513 5:85547845-85547867 GTGTGCTTGTGGGAGGGAGAAGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
996749586 5:126875257-126875279 GTGTGCTTCTGGAACACAGCAGG + Intronic
997357630 5:133273964-133273986 CTTTCCTTGTGGGATGCAGCAGG - Intronic
997756625 5:136405852-136405874 CTGGGCTGGTGGAAGACAGTTGG + Intergenic
998783100 5:145680399-145680421 CTGTGGTTGTGGCAGGGATCAGG - Intronic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
999578273 5:153005310-153005332 CTGTGTTTGTTGATGGCAGCTGG - Intergenic
999689810 5:154136975-154136997 CTGGGCTGGTTGAAGGGAGCAGG - Intronic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1000537217 5:162493727-162493749 CTTTGCTGGTAGAAGGCAGAGGG - Intergenic
1001994423 5:176144262-176144284 ATGGGCTTGTGGAACTCAGCTGG - Intergenic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1002430174 5:179198892-179198914 CTGAGCCTGTGGCAGGCAGGGGG - Intronic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003413289 6:5885213-5885235 CTCTGCTTCTGGAATACAGCTGG + Intergenic
1004590411 6:17046089-17046111 CTGTGCTGGAGCAAAGCAGCAGG - Intergenic
1005908214 6:30284168-30284190 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007667345 6:43522962-43522984 ATGAGATTGTGGAAGGCACCTGG + Exonic
1007756471 6:44102802-44102824 CTGTTCCTGTGGAGGGGAGCTGG - Intergenic
1010678058 6:78767668-78767690 CTGAGGTTGTGCAAGGCAGTGGG - Intergenic
1010715633 6:79226207-79226229 CTGTGTTTGAGAAAGGCTGCAGG + Intronic
1010823172 6:80440342-80440364 CTGTGCTTAAGGAAGCCATCTGG - Intergenic
1010987115 6:82437466-82437488 CTGAGGTTGTCCAAGGCAGCTGG + Intergenic
1012440448 6:99257358-99257380 CTGTGCTTCTGGAAGGCCTGCGG + Intergenic
1013285220 6:108675419-108675441 CTGGGCTTGGTCAAGGCAGCAGG - Intronic
1014022409 6:116606189-116606211 CTGTGCTTGCCGAAGTCAGAGGG - Intergenic
1014801857 6:125787451-125787473 CTGAGCCTGTGGGAGGCAGCTGG - Intronic
1016301809 6:142640125-142640147 ATGTGATTGGGGAAGGCAGATGG + Intergenic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018098715 6:160417255-160417277 CTGTTCTTGTGGCAGACAGAAGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018998065 6:168725168-168725190 GGGTGGTTGTGGAAAGCAGCAGG - Intergenic
1019146493 6:169978616-169978638 CTGAGCAGGTGGATGGCAGCGGG + Intergenic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1022999440 7:35792933-35792955 GTCTGGTTGTTGAAGGCAGCTGG + Intergenic
1023835707 7:44066063-44066085 CTGGCCTTGTGGAAGGTACCAGG + Intronic
1024224941 7:47319334-47319356 CTGGACTTGTGAAAGGAAGCTGG + Intronic
1024596100 7:50939170-50939192 CTGTGGTCGTGGAAAACAGCTGG - Intergenic
1027241943 7:76336370-76336392 CTGTGCTTGTGTGGGGCAGGGGG + Intronic
1030021007 7:105275195-105275217 CTTTCCTTGTGGAGAGCAGCAGG + Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1034657886 7:152743806-152743828 CTCTCCTGGTGGAAGGCAGAAGG + Intergenic
1034851634 7:154499322-154499344 CTGTGCTCCTAGAAGGCAGGGGG - Intronic
1036077530 8:5518056-5518078 CAGTGCTTGAGAATGGCAGCAGG - Intergenic
1036142981 8:6225463-6225485 CTGGGCTTGTGGAGGGTGGCAGG - Intergenic
1036429924 8:8680774-8680796 GTGTCCTTGTGGAGGGCTGCTGG + Intergenic
1037660897 8:20926046-20926068 CTTTGCTTCTGGGAGGCATCTGG + Intergenic
1039186249 8:34919923-34919945 AAGTGTTTGTGGAAAGCAGCTGG - Intergenic
1043085525 8:75827083-75827105 CTGAGGTTGAGCAAGGCAGCAGG - Intergenic
1046118086 8:109808747-109808769 CTGTGCTTCCTGTAGGCAGCTGG - Intergenic
1046718181 8:117589840-117589862 CTGTGCTTATCTATGGCAGCAGG - Intergenic
1047254995 8:123207700-123207722 CTGGGCCTGCGGAGGGCAGCAGG - Exonic
1047504305 8:125466755-125466777 CTTGGACTGTGGAAGGCAGCTGG + Intergenic
1047543866 8:125796989-125797011 CAGTGCATGTGGAGGGCAGGAGG + Intergenic
1048307790 8:133296110-133296132 CTGGGCTTGGGGAATGCGGCTGG - Intronic
1048979642 8:139696527-139696549 CTGTGCTGGTGGGAGGCACACGG - Intronic
1049720904 8:144115073-144115095 CTGTGCAGCTGGAAGTCAGCAGG + Intronic
1049987412 9:964664-964686 TTGTGCTTGGGGAAGGGAGTTGG - Intronic
1050013804 9:1211743-1211765 CTGGTCCTGTGGAAGGGAGCAGG + Intergenic
1050144507 9:2552243-2552265 CAGAATTTGTGGAAGGCAGCAGG + Intergenic
1050462927 9:5892606-5892628 ATGTACTGGTGGAAGTCAGCAGG - Intronic
1051136433 9:13927001-13927023 GTGTCCTTGTGGATGGCAGGAGG - Intergenic
1051828976 9:21255056-21255078 CTGTACTTGTTAAAGGCAGTAGG - Intergenic
1054803565 9:69376964-69376986 CTGTGCTGGTGGGAGGCTGTGGG + Intronic
1059107340 9:111523138-111523160 CTGTGCATCAGGAAGGAAGCAGG - Intergenic
1059459445 9:114420601-114420623 CTGTGCATGTGGAGGGTACCTGG + Intronic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1060370036 9:123060063-123060085 CTATTCTTGTGAATGGCAGCAGG - Intronic
1062354743 9:136156672-136156694 CTGGGCTGGTGAAAGGCAGCCGG - Intergenic
1202803725 9_KI270720v1_random:28774-28796 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1185762204 X:2697186-2697208 TTGTCATTGTGGACGGCAGCTGG + Intronic
1186509122 X:10117356-10117378 CTCTGCTTGTGGAAGCCCGAGGG - Exonic
1186819654 X:13274373-13274395 CTGTACTGGTGGGAGTCAGCTGG + Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190062389 X:47219466-47219488 GTGTGCTTGTGGAAGGAGGGCGG + Intronic
1192221846 X:69202769-69202791 CTGTGCATTTGGCAAGCAGCAGG + Intergenic
1193213903 X:78840033-78840055 CTGTGCTTGAGGAAAGGAGATGG + Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1198519843 X:137441658-137441680 CTGGGCTTATGGAATACAGCTGG - Intergenic
1199289939 X:146094014-146094036 CTGAGATTGTGCAAGGCATCAGG + Intergenic
1199586763 X:149423190-149423212 GTGTCCTTGGGGAGGGCAGCCGG + Intergenic
1200061738 X:153486816-153486838 GTGTGCTGGAGGAAGGCGGCAGG - Exonic
1200067632 X:153511656-153511678 CGGAGCTGCTGGAAGGCAGCAGG + Intergenic