ID: 1179106446

View in Genome Browser
Species Human (GRCh38)
Location 21:38404732-38404754
Sequence TTCCCGGGACAAGCCCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179106440_1179106446 7 Left 1179106440 21:38404702-38404724 CCACCTGTAAACTAAGAGCACTG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1179106441_1179106446 4 Left 1179106441 21:38404705-38404727 CCTGTAAACTAAGAGCACTGATC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1179106439_1179106446 8 Left 1179106439 21:38404701-38404723 CCCACCTGTAAACTAAGAGCACT 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1179106438_1179106446 23 Left 1179106438 21:38404686-38404708 CCTTTCTGTGTCTGTCCCACCTG 0: 1
1: 0
2: 6
3: 35
4: 380
Right 1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179106446 Original CRISPR TTCCCGGGACAAGCCCTTAG GGG Intronic
902385698 1:16074197-16074219 TGCCCTAGACAAGCCCTGAGAGG - Intergenic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
904801140 1:33093609-33093631 TTCCTGGGACAAGACCTTCTGGG - Intronic
920990864 1:210938020-210938042 TTCCAGGGACATTCCCATAGAGG - Intronic
1066594356 10:37033197-37033219 TAACAGGTACAAGCCCTTAGAGG - Intergenic
1085894103 11:80616674-80616696 TAACAGGTACAAGCCCTTAGAGG + Intergenic
1098847851 12:75560250-75560272 TTCCCAGGAAAAGCACTGAGTGG + Intergenic
1100603467 12:96132149-96132171 TTCCTGGGACAAGGCTTTTGAGG - Intergenic
1101923210 12:108949895-108949917 TTCCCGGGAGTAGCCCTCACTGG + Intronic
1101987836 12:109461363-109461385 TTCCTGCAACAAGCACTTAGTGG + Intronic
1104864486 12:131944764-131944786 ATCGCGGAACAGGCCCTTAGTGG + Exonic
1113290874 13:108904799-108904821 TTCCAGGAACAGGCCCTAAGTGG - Intronic
1115909925 14:38244268-38244290 TTCCCTGGACAAGCCCCAAATGG - Intergenic
1118361211 14:65058772-65058794 TTCCCAGGATAAGCCCTTCTTGG + Intronic
1122571157 14:102702882-102702904 TCCCTGGGAAAAGACCTTAGTGG + Intronic
1124221107 15:27850478-27850500 TTCCCGGGACTGGTTCTTAGGGG + Intronic
1125499836 15:40232689-40232711 TTCCCGGGAGCAGCCCCTATGGG - Intergenic
1125901625 15:43353567-43353589 TTCCAGTGACCAGCCCCTAGGGG - Exonic
1131200148 15:90388720-90388742 TCCCCGGGACACGCCCTGCGCGG - Intronic
1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG + Intergenic
1132381539 15:101369858-101369880 TTCCCGGGACAGGCCCCTGCTGG + Intronic
1135160205 16:20087642-20087664 TTCTGGGGACAAACCCTCAGAGG - Intergenic
1144088926 17:11835880-11835902 TTCCCTGAACAAGCTCTAAGAGG + Intronic
1147624796 17:41893055-41893077 CTCCCGAGACGAGCCCTCAGTGG - Exonic
1151961834 17:77409643-77409665 TTCCTGGGACAAGTGCTGAGAGG - Intronic
1153858418 18:9173944-9173966 TCCCTGGGACAAGCCCCTAGGGG - Intronic
1166951333 19:46430044-46430066 TTCCAGGGATAAGCCCTGATTGG + Intergenic
925903411 2:8524677-8524699 TTCTCGGGAGAAGCCCACAGAGG - Intergenic
940274579 2:151925728-151925750 TTCCAGGGAAAGGGCCTTAGAGG + Intronic
1174520644 20:51127801-51127823 ATCCTGGGACCAACCCTTAGAGG - Intergenic
1174734856 20:52956295-52956317 AGCCCGGGTAAAGCCCTTAGTGG - Intergenic
1175950312 20:62580206-62580228 TTCCCGGGAGATGCGCTCAGGGG - Intergenic
1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG + Intronic
1179984838 21:44914418-44914440 TTCCCCGGAGAACCCCTCAGGGG + Intronic
1183590718 22:38777826-38777848 TTCAGGGGACAACCCCTGAGGGG + Intronic
962864232 3:139434189-139434211 TTCCCAGCACCAGCCCTCAGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
979643290 4:123035021-123035043 TTACTGGGAAAAGCCCTGAGAGG + Intronic
981527457 4:145720640-145720662 TTCCTGGTACAAGGCCTTACAGG + Intronic
985599451 5:818945-818967 TTCACGGGAAAAGCCCTGTGTGG - Intronic
990997997 5:61752583-61752605 TTTCCAGGACAAGCCCTGATAGG + Intergenic
995654728 5:114412715-114412737 TTCCCAGCACTAGCCATTAGAGG + Intronic
997198331 5:131994403-131994425 TTCCTGGGAAAAGCCCTTCTAGG - Intronic
1004005322 6:11632740-11632762 TGCCCAGGACAAGTCCTGAGTGG + Intergenic
1006434405 6:34018844-34018866 TGCCAGGGCCAAGCCCTGAGGGG + Intronic
1017319436 6:153072637-153072659 TTCCAGGGCTAAGCCCTCAGAGG + Intronic
1022106959 7:27203597-27203619 TTCCCCGGAGGAGCCCTGAGAGG + Intergenic
1032793639 7:135260254-135260276 TTCCCGATACAAGTCCTTGGTGG - Intergenic
1033448325 7:141440968-141440990 TTCGAGGGACCAGCTCTTAGTGG - Intronic
1034435362 7:151060502-151060524 TTCCCGGGACCAGCCCCGACCGG - Intronic
1034484730 7:151352161-151352183 CTCCCTGGAGAAGCCCATAGCGG - Intronic
1044266376 8:90186768-90186790 TTCTCTGGAGAAGCCCTTAGAGG + Intergenic
1046011661 8:108555981-108556003 TTCCCAGTACCAGCCTTTAGAGG - Intergenic
1047557314 8:125946421-125946443 TTCTCTGGACAAGCCCTGACTGG - Intergenic
1055842509 9:80522210-80522232 TTCCCAGGACAAACCCTATGTGG + Intergenic