ID: 1179106538

View in Genome Browser
Species Human (GRCh38)
Location 21:38405508-38405530
Sequence CAATTAGGCTGGAGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2044
Summary {0: 1, 1: 0, 2: 18, 3: 219, 4: 1806}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179106532_1179106538 -5 Left 1179106532 21:38405490-38405512 CCCTGGGAGAGTCTGCTTCAATT 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG 0: 1
1: 0
2: 18
3: 219
4: 1806
1179106531_1179106538 -4 Left 1179106531 21:38405489-38405511 CCCCTGGGAGAGTCTGCTTCAAT 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG 0: 1
1: 0
2: 18
3: 219
4: 1806
1179106530_1179106538 4 Left 1179106530 21:38405481-38405503 CCTGGTCTCCCCTGGGAGAGTCT 0: 1
1: 0
2: 0
3: 18
4: 205
Right 1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG 0: 1
1: 0
2: 18
3: 219
4: 1806
1179106533_1179106538 -6 Left 1179106533 21:38405491-38405513 CCTGGGAGAGTCTGCTTCAATTA 0: 1
1: 0
2: 2
3: 11
4: 145
Right 1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG 0: 1
1: 0
2: 18
3: 219
4: 1806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179106538 Original CRISPR CAATTAGGCTGGAGGGCAGT TGG Intronic
Too many off-targets to display for this crispr