ID: 1179106541

View in Genome Browser
Species Human (GRCh38)
Location 21:38405552-38405574
Sequence TGCTCATTAGAGTCACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 1, 2: 29, 3: 126, 4: 549}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179106541_1179106548 4 Left 1179106541 21:38405552-38405574 CCCCCAGGTGACTCTAATGAGCA 0: 1
1: 1
2: 29
3: 126
4: 549
Right 1179106548 21:38405579-38405601 AGGTTCAGATCATCTTCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 208
1179106541_1179106551 24 Left 1179106541 21:38405552-38405574 CCCCCAGGTGACTCTAATGAGCA 0: 1
1: 1
2: 29
3: 126
4: 549
Right 1179106551 21:38405599-38405621 GGGCCTCACTATTCCAAGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1179106541_1179106547 3 Left 1179106541 21:38405552-38405574 CCCCCAGGTGACTCTAATGAGCA 0: 1
1: 1
2: 29
3: 126
4: 549
Right 1179106547 21:38405578-38405600 AAGGTTCAGATCATCTTCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179106541 Original CRISPR TGCTCATTAGAGTCACCTGG GGG (reversed) Intronic
900851242 1:5144690-5144712 TGCACTTTAGAGTCACCTATTGG - Intergenic
901689973 1:10966472-10966494 TTCTCATTCCAGGCACCTGGAGG - Exonic
902359388 1:15933960-15933982 GGCTTTTTAGAGTCAACTGGCGG - Exonic
902626647 1:17680382-17680404 TGCACAGAAGCGTCACCTGGAGG + Intronic
902984473 1:20147273-20147295 TGCACAATAGAATCAGCTGGAGG - Intronic
903000051 1:20258750-20258772 TGCACATTAGAATCATCTGGGGG + Intergenic
903020262 1:20388622-20388644 TGCTCATGAGAAGCACCTGAGGG - Intergenic
904072677 1:27813827-27813849 TGCATATTATAATCACCTGGGGG - Intronic
904156919 1:28491541-28491563 TCTTCATTGGAATCACCTGGGGG - Intronic
904884753 1:33727693-33727715 TGCTCCTTAGAGTCACTTAGGGG - Intronic
905328493 1:37175431-37175453 TCTTCATTTGAATCACCTGGTGG + Intergenic
905338143 1:37259567-37259589 TGCACATTAGAATCACCTGGGGG - Intergenic
905439465 1:37985388-37985410 TGCACATTAGAATCACCTGGGGG + Intronic
905485216 1:38291351-38291373 TGGGCATTAGAATCATCTGGTGG - Intergenic
905785500 1:40753692-40753714 TGCACACTAGAATCACCTGTTGG + Intronic
906032628 1:42733566-42733588 TGCACATTCGAATCACCTGGGGG - Exonic
907743529 1:57190088-57190110 TGTGCATTAGAATCACCTGGAGG + Intronic
907743980 1:57194126-57194148 TGTGCATTAGAATCATCTGGAGG + Intronic
909832619 1:80211705-80211727 TGCTGATTAGAGGCAGCTGAGGG - Intergenic
910106306 1:83634519-83634541 AACACATTAGAGTCACCTGAGGG - Intergenic
910205777 1:84747618-84747640 TGCAAATTAGAATCACCTGGAGG + Intergenic
910677361 1:89828036-89828058 TGCACATTAGAATTACCTGGAGG - Intronic
912311431 1:108625126-108625148 TGTGCATCAGAGTCTCCTGGAGG + Intronic
915237146 1:154492315-154492337 TGCTCTTTAGAATCACCTGGGGG - Intronic
916181037 1:162083856-162083878 TGTTCATCAGAATCACATGGTGG - Intronic
916561427 1:165936875-165936897 TTGTCATCAGAATCACCTGGAGG - Intergenic
916570739 1:166025097-166025119 TGCTTCTTTGAGGCACCTGGGGG + Intergenic
917268835 1:173251081-173251103 TGTTCATCAGAATCACCTGTAGG - Intergenic
918194139 1:182206158-182206180 TGCACAACAGAATCACCTGGAGG + Intergenic
918307830 1:183263457-183263479 TGCACATTAGAATCACCTGAGGG + Intronic
918464522 1:184807782-184807804 TACACATTGGAATCACCTGGGGG - Intronic
919650561 1:200144975-200144997 TGCTCATCAGAATCATCTGGGGG + Intronic
920763557 1:208809462-208809484 TGCACAGTGGAATCACCTGGAGG - Intergenic
922162844 1:223090957-223090979 TTCACATGAGAATCACCTGGGGG + Intergenic
922223863 1:223628523-223628545 TGTGCATCAGAGTCACCTAGAGG + Intronic
922346837 1:224703358-224703380 CGCACATTAGAATCACCTGGGGG + Intronic
922447643 1:225711124-225711146 TGATCATCAGAATCACCTGGGGG + Intergenic
922763714 1:228147182-228147204 TGCTCACTACAGGCACCTTGGGG + Intronic
923152565 1:231246840-231246862 TGCACATTAAAATAACCTGGGGG - Intronic
923191256 1:231622913-231622935 TGTGCTTTAGAATCACCTGGAGG + Intronic
923198320 1:231688894-231688916 TGCTTATTACAGTGACCTGAAGG + Intronic
923225122 1:231932018-231932040 TGCTCAGTACTGACACCTGGTGG + Intronic
923264826 1:232304335-232304357 TGTTCTTTAGAGTCCCCTGGGGG + Intergenic
924434876 1:244030481-244030503 TGCTCATCAGAATCGCCTGGGGG - Intergenic
924465330 1:244294343-244294365 TACATATTAGAATCACCTGGGGG - Intergenic
924518553 1:244786258-244786280 TGGATATTAGAATCACCTGGTGG + Intergenic
924617099 1:245621043-245621065 TACACATTAGACTCACCTGGAGG + Intronic
1063274549 10:4550846-4550868 TCTGCATTAGAATCACCTGGTGG - Intergenic
1063359145 10:5435111-5435133 TGCAGATCAGAGTCACCTGAGGG + Intronic
1063828301 10:9923832-9923854 TGCTCCTTGGAGTTTCCTGGAGG + Intergenic
1064888077 10:20134914-20134936 TGCTCACTTTACTCACCTGGAGG + Intronic
1065326485 10:24554357-24554379 TTCCCATGAGAATCACCTGGGGG - Intergenic
1066371751 10:34823443-34823465 TGTGCATTAGAGTCACCAGGAGG - Intergenic
1067932897 10:50581221-50581243 TGCACATTAGAATCACCCTGAGG - Intronic
1068056678 10:52020129-52020151 TACTCATTAGAGTCATATGAGGG + Intronic
1068550802 10:58405658-58405680 AGCACATTAGAGTCGCCTGGGGG + Intergenic
1068746050 10:60531905-60531927 TGAACATTAGAGTCACCAGGAGG - Intronic
1069287872 10:66739218-66739240 TGTCCATCAGAATCACCTGGAGG + Intronic
1069742230 10:70692149-70692171 TAGTCATTAAAATCACCTGGAGG - Intronic
1069861528 10:71474617-71474639 TGCTCATTAGGGGCACGGGGTGG + Intronic
1069876520 10:71566524-71566546 TGCTCTTTACAGCCACCAGGAGG + Intronic
1070051044 10:72890178-72890200 TTCTCATCAGAATCACCAGGAGG - Intergenic
1070644096 10:78189448-78189470 TGTACATGAGAATCACCTGGAGG - Intergenic
1070673089 10:78391843-78391865 TGCTCTTTAAAGAGACCTGGGGG + Intergenic
1070824277 10:79381730-79381752 TGCTCACCTGAGTCACCTGCGGG - Intergenic
1071318254 10:84424410-84424432 TATTCATTATAGTCACCTTGAGG - Intronic
1071369804 10:84939734-84939756 TGTGCATCAGAGTTACCTGGAGG - Intergenic
1072495935 10:95959394-95959416 TGTGCATCAGAATCACCTGGAGG - Intronic
1072523948 10:96254922-96254944 TGCACATTAGAATCACTTAGGGG + Intronic
1072832929 10:98678385-98678407 TGCACATCAGAATCACCTGGAGG + Intronic
1073001785 10:100291136-100291158 TGCACATTAGAATACCCTGGGGG - Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1073610159 10:104935363-104935385 TGCTCTTTAGGATTACCTGGAGG + Intronic
1074045335 10:109832759-109832781 TGCTCATTAAAATTAGCTGGAGG - Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1074786231 10:116843930-116843952 CACACATTAGAATCACCTGGAGG - Intergenic
1074904717 10:117851695-117851717 TGCCCATTAGACTCTCCTGGTGG + Intergenic
1075263427 10:120981597-120981619 AGCTTAATAGAGTCTCCTGGGGG + Intergenic
1075425272 10:122337206-122337228 TGCACATCAGAATCACCTGGGGG + Intronic
1077179580 11:1206296-1206318 TGCTCATAAAACCCACCTGGAGG + Intergenic
1078350881 11:10592165-10592187 TGCACATTAGAATCACCTGGGGG + Intronic
1078390914 11:10934634-10934656 TGCGCATGAGTGTCACCTGGAGG + Intergenic
1078449366 11:11428709-11428731 TGCATATTAGAATCACTTGGAGG - Intronic
1079029238 11:16973563-16973585 TGCACATTAAAATCACTTGGGGG + Intronic
1080409800 11:32012693-32012715 TTCACATAAGGGTCACCTGGCGG + Intronic
1080854452 11:36100164-36100186 TGTGCATTAGAATCACCTTGAGG - Intronic
1080923277 11:36730460-36730482 CCCACATTAGAATCACCTGGAGG - Intergenic
1081685482 11:45039915-45039937 TGTGCATTAGAATCACCTGGAGG - Intergenic
1082771328 11:57210061-57210083 TACACATTAGAATCACCTGGGGG + Intergenic
1086143389 11:83523882-83523904 TGCCCATTAGAGTCAGCCAGTGG + Intronic
1086411503 11:86549057-86549079 TGAGCATTAAAATCACCTGGAGG - Intronic
1088088770 11:106012726-106012748 TGTGCATTAGAGTTATCTGGAGG - Intronic
1088425112 11:109693703-109693725 TGCCCATATGTGTCACCTGGGGG + Intergenic
1088603041 11:111500253-111500275 TGGGTATTAGAATCACCTGGGGG - Intronic
1088686617 11:112289683-112289705 TGACCATTAGGATCACCTGGGGG + Intergenic
1088796069 11:113267787-113267809 TGCTCATCAGACCCAGCTGGAGG - Intronic
1089767870 11:120781672-120781694 TGCCCATCAGAGTCACCTAGAGG - Intronic
1089918756 11:122186462-122186484 TGGGCATCAGAGTCATCTGGAGG - Intergenic
1090670592 11:128942574-128942596 AGTACATCAGAGTCACCTGGAGG - Intronic
1091512371 12:1141389-1141411 TGCACATCAGAATCATCTGGAGG - Intronic
1091638615 12:2216738-2216760 TGCCTATTAGAATCACCTGGGGG - Intronic
1091661377 12:2386304-2386326 TGCTCATCAGAATCAACCGGAGG - Intronic
1092758945 12:11791834-11791856 TGCACAACAGATTCACCTGGTGG + Intronic
1093643323 12:21553542-21553564 TGCCCATTAAAGGCACCTGTTGG - Intronic
1094182547 12:27607500-27607522 TGCACATTAGAATCACCTGGAGG + Intronic
1094487649 12:30937810-30937832 GGTACATTAGAATCACCTGGAGG - Intronic
1094797489 12:33992835-33992857 TCTTCATTAGAATCACCTGGAGG + Intergenic
1095719843 12:45388366-45388388 CGCACATTAGAATCACTTGGGGG + Intronic
1096332830 12:50729375-50729397 TGTACATAAGAATCACCTGGGGG + Intronic
1096822691 12:54249452-54249474 TACACATTATAATCACCTGGGGG - Intronic
1096857645 12:54496455-54496477 TGTGCATTGGAATCACCTGGAGG + Intergenic
1097363372 12:58682653-58682675 TGCATATTAGAATCACTTGGGGG + Intronic
1097695969 12:62775228-62775250 TGTACATCAGAATCACCTGGGGG - Intronic
1097780454 12:63697294-63697316 TGCTCATTGGAATCACCAGGGGG - Intergenic
1097940049 12:65294206-65294228 TGCTTATTAGTGTCTCCTGTTGG + Intronic
1099607749 12:84827139-84827161 AGCCCATCAGAGTCACCTGAGGG - Intergenic
1099886105 12:88532987-88533009 TGCACATCGGAATCACCTGGAGG - Intronic
1100557147 12:95706859-95706881 TGTGCATCAGAATCACCTGGAGG + Intronic
1100579121 12:95921982-95922004 TGTACATTACAGCCACCTGGGGG - Intronic
1100698858 12:97124723-97124745 TACACATTAGAATCACCTGGGGG + Intergenic
1100761365 12:97811052-97811074 TGCACATGAGAGTTACCTGCAGG + Intergenic
1100780868 12:98024807-98024829 TGCCCATTAGAATCACCTGGGGG + Intergenic
1101077121 12:101142003-101142025 TGTTCATCAGAAGCACCTGGAGG - Intergenic
1101156784 12:101935320-101935342 TGTGCATCAGAATCACCTGGAGG + Intronic
1101183496 12:102247831-102247853 TGCTCTTTAAAGTCATATGGGGG - Intergenic
1101299686 12:103466351-103466373 TGCTCATCAGAGTCTCCCAGAGG + Intronic
1101760278 12:107652569-107652591 TACTAATTAGAATCACCTGGGGG + Intronic
1101829145 12:108243556-108243578 TGCTCATCGGTATCACCTGGAGG - Intronic
1101851758 12:108408994-108409016 TGCATCTTAGAATCACCTGGGGG + Intergenic
1101956844 12:109219376-109219398 TGTACATTAGAATCACCTAGGGG + Intronic
1102203417 12:111074234-111074256 TTCTCATTTGAATCACCTGGGGG + Intronic
1102365578 12:112331389-112331411 TGCACATTGGATTCACCTGTGGG - Intronic
1102421749 12:112808827-112808849 AGCACATCAGAATCACCTGGAGG - Intronic
1102438998 12:112947138-112947160 TGCACATTAGAATTACCTGGGGG + Intronic
1103259652 12:119575521-119575543 TGCTCACCAAAGTCACCAGGGGG - Intergenic
1105729000 13:23192944-23192966 TCCTCATTAGACTCACCTCCAGG - Intronic
1105898107 13:24734893-24734915 TGCACATTAGGATCACATGGGGG - Intergenic
1106303092 13:28487045-28487067 CACACATTAGAATCACCTGGTGG - Intronic
1107434183 13:40367244-40367266 TGTACATAAAAGTCACCTGGAGG - Intergenic
1107636984 13:42402241-42402263 CCATCATGAGAGTCACCTGGAGG + Intergenic
1107637686 13:42409151-42409173 GGTGCATCAGAGTCACCTGGAGG + Intergenic
1107705061 13:43094434-43094456 TGTACATTAGAATCAACTGGAGG - Intronic
1108842697 13:54640177-54640199 TGTTCATCAGAATAACCTGGAGG + Intergenic
1110494302 13:76148519-76148541 TGGGCATGAGAGTCACCTGGAGG + Intergenic
1110652507 13:77958672-77958694 TGCACATTAAAATAACCTGGGGG - Intergenic
1111958028 13:94779616-94779638 TGTGCATTGGAGTCACCTGGAGG + Intergenic
1112353181 13:98653686-98653708 TGTGCACGAGAGTCACCTGGAGG - Intergenic
1112985070 13:105438591-105438613 TGAGTATTAGATTCACCTGGAGG - Intergenic
1113036521 13:106055949-106055971 TGTGCATCAGAATCACCTGGAGG - Intergenic
1113304106 13:109058008-109058030 TGCACATCAAAATCACCTGGAGG + Intronic
1114172469 14:20287172-20287194 TGTGCATCAGAGTCACCTGGAGG + Exonic
1114954068 14:27795920-27795942 TGCACATTAGAGTCACCTTGGGG + Intergenic
1115323836 14:32115124-32115146 TGCACAGTAGAGTCATCTGTAGG + Intronic
1115343448 14:32317171-32317193 TGATCTTTAGAATAACCTGGGGG + Intergenic
1115876151 14:37864355-37864377 TGCTGATTAAAGCCACTTGGGGG + Intronic
1117006868 14:51429359-51429381 TGCACATTAGAATCACCTGGGGG - Intergenic
1117062924 14:51981280-51981302 AGCACATCAGAGTCACCTGTAGG + Intergenic
1117263038 14:54056474-54056496 TGTTCATTAGAATTACCTGGGGG + Intergenic
1117659566 14:57989358-57989380 TGTGCATTAAAATCACCTGGAGG - Intergenic
1118663473 14:68040855-68040877 TGTGCATGAGAATCACCTGGAGG - Intronic
1118699064 14:68415199-68415221 TGCACATTAGAATCACATGGGGG - Intronic
1118882489 14:69841324-69841346 TGTGCATTAGAATCACCTGGGGG + Intergenic
1119222459 14:72920209-72920231 TGCTCCTTTGAGCCTCCTGGTGG - Intergenic
1119464615 14:74845993-74846015 TGCATATTAGAATGACCTGGTGG - Intronic
1119778230 14:77261175-77261197 TGCACACTGGAATCACCTGGGGG - Intergenic
1119781297 14:77278211-77278233 TGCACATTAGGATCACCTGGGGG + Intronic
1120222608 14:81751498-81751520 TGTGCATCAGAATCACCTGGAGG - Intergenic
1120814708 14:88843269-88843291 TGGACATTGGAATCACCTGGCGG - Intronic
1121944222 14:98103754-98103776 TGTACATCAGAATCACCTGGGGG - Intergenic
1123905823 15:24920401-24920423 TGTGCATTAGTATCACCTGGGGG + Intronic
1124449882 15:29778349-29778371 TGCTCATTAGAATCACCTGGGGG - Intronic
1125398397 15:39274399-39274421 TGCTTATTAGAATCACTAGGTGG - Intergenic
1125878894 15:43175071-43175093 TGCACATTAGAATAACCTAGGGG - Intronic
1125882358 15:43205754-43205776 TGCACATTAGAATCACCTGGGGG - Intronic
1125904651 15:43379821-43379843 TGTGCATTAGAATCACCTGGAGG + Intronic
1126197472 15:45948372-45948394 TGTACACTAGAATCACCTGGGGG - Intergenic
1127313359 15:57771582-57771604 TGCACATTAGAATCATCTGAGGG + Intronic
1127791369 15:62401536-62401558 TGCACATTGGAATCACCTGGAGG + Intronic
1127961665 15:63895013-63895035 AGCACATCAGAATCACCTGGAGG + Intergenic
1128114411 15:65096341-65096363 TGCACATTAGAATCACCTGGAGG - Intronic
1128186648 15:65648276-65648298 TGCACATTAAAATCACCTGAAGG - Intronic
1128247708 15:66144269-66144291 TGCTCATTGGAATCACCTGGGGG - Intronic
1128683191 15:69666183-69666205 TCTTCATTTGAGCCACCTGGGGG + Intergenic
1128730545 15:70017851-70017873 TGCACATTGAAGTCACCTAGGGG + Intergenic
1128772857 15:70295362-70295384 TGCCCATTAGAGCCACCAAGAGG + Intergenic
1128836479 15:70812950-70812972 TGCACATTGGAATCACCTGCAGG + Intergenic
1129099402 15:73245299-73245321 TGCTCTTTAGAATCTCCTTGAGG + Intronic
1129953250 15:79610512-79610534 AGCTCATCAGAATCACCTGGAGG + Intergenic
1130097219 15:80864817-80864839 CGCTTATCAGAATCACCTGGAGG + Intronic
1130513601 15:84608654-84608676 CGCACATTAGAATTACCTGGGGG + Intronic
1130644503 15:85712154-85712176 TGGGCATCAGAATCACCTGGAGG - Intronic
1130803567 15:87293045-87293067 GGTGCATAAGAGTCACCTGGAGG - Intergenic
1131012911 15:89033250-89033272 TGTGCATCAGAGCCACCTGGAGG - Intergenic
1131033372 15:89205068-89205090 TGCACATTTGAGCCACCTGCTGG + Intergenic
1131176429 15:90212191-90212213 GGCACATAAGAGTCACCTGCAGG - Intronic
1131467966 15:92670634-92670656 TGCACATTAGAATCCCCTGGAGG + Intronic
1133343842 16:5056734-5056756 TGATCATTAGATTCAGCAGGTGG - Intronic
1133600347 16:7334170-7334192 GGGTGATTAGAGTCATCTGGGGG + Intronic
1134115318 16:11543660-11543682 TGCACCTTAGAATCCCCTGGGGG - Intergenic
1134328570 16:13229517-13229539 TGCATATTAGAATCACCTGAGGG + Intronic
1134345912 16:13391699-13391721 TGCACAATGGAGTCACCTGGGGG - Intergenic
1135129127 16:19837726-19837748 TGCAGATTAGAATCTCCTGGGGG + Intronic
1135139856 16:19912087-19912109 TGCACATTAAAATCATCTGGGGG + Intergenic
1135816176 16:25636029-25636051 TGCTCCCCAGAGTCACCTGGTGG - Intergenic
1135967643 16:27049192-27049214 TGCAAATTAGAATCACTTGGGGG - Intergenic
1136102922 16:28008736-28008758 TGCACATTTGAGTTACCTGAGGG + Intronic
1137682021 16:50357102-50357124 TGTGCATTAGAATCACCTGAAGG + Intronic
1137872826 16:51967079-51967101 TGTGCATCAGAATCACCTGGCGG + Intergenic
1138634912 16:58330619-58330641 TGCACATTGGACTCACCTGGGGG - Intronic
1138911195 16:61401203-61401225 TGTGCATCAGAATCACCTGGTGG - Intergenic
1138982022 16:62281153-62281175 GGCTAATTAGCATCACCTGGTGG - Intergenic
1139195408 16:64912806-64912828 TGCACATTAAAATCACTTGGGGG + Intergenic
1139241353 16:65395560-65395582 CGTGCATTAGAGTCACCTGGAGG - Intergenic
1139445053 16:66992543-66992565 TGTGCATCAGAATCACCTGGAGG - Intronic
1139553507 16:67690580-67690602 TGCACACTAGGATCACCTGGGGG - Intronic
1139818860 16:69702672-69702694 TGTGCATCAGAATCACCTGGAGG - Intronic
1140688683 16:77459774-77459796 TTTGCATTAGAGTCATCTGGAGG - Intergenic
1141006633 16:80358837-80358859 GGCACATCAGAATCACCTGGTGG - Intergenic
1141271588 16:82545849-82545871 TGCACAGTAGACTGACCTGGGGG - Intergenic
1141307866 16:82883381-82883403 TGTCTATCAGAGTCACCTGGGGG + Intronic
1141390550 16:83659532-83659554 TGTTCATTAGAATCACAGGGGGG + Intronic
1142389554 16:89789960-89789982 TGGGCATTAGACTCGCCTGGAGG - Intronic
1142888727 17:2929388-2929410 CGCCCATCACAGTCACCTGGCGG - Intronic
1143327826 17:6111043-6111065 TGTACATAAGAGTCACCTGTGGG + Intronic
1143547358 17:7605670-7605692 TCCTTATTATAGTCAGCTGGAGG + Exonic
1143574453 17:7782459-7782481 TGCTTCTTCCAGTCACCTGGGGG - Intronic
1143834603 17:9680568-9680590 TGAATATTAGAATCACCTGGAGG + Intronic
1144384464 17:14736598-14736620 TGCTCACCTGAGTCTCCTGGTGG - Intergenic
1145787433 17:27603337-27603359 GGCTCATTAGCGACACCTGGTGG - Intronic
1145871917 17:28280996-28281018 TGCTCATCAAAATTACCTGGAGG + Intergenic
1146214745 17:30970458-30970480 TGCGCGTCAGAATCACCTGGGGG + Exonic
1146395498 17:32461908-32461930 TCCTCATTGGAGCCCCCTGGTGG - Intronic
1146508817 17:33428332-33428354 TGCACATTAGAGTCATCTGAGGG - Intronic
1146513462 17:33470386-33470408 CGCTCATCAGACTCACCTGGGGG - Intronic
1146774212 17:35597589-35597611 TGTGCGTTAGAGTCACTTGGTGG + Intronic
1146996907 17:37328921-37328943 TGTTCATCAGAATCACCTCGGGG - Intronic
1147913187 17:43870161-43870183 TGCCCGTTAGGATCACCTGGGGG - Intergenic
1147993289 17:44348316-44348338 TGCCCATCTGAGTCACCAGGAGG - Intronic
1148038000 17:44682962-44682984 TGCACATTAGAATCACCTACAGG + Intronic
1148125396 17:45233965-45233987 TGCTCCTTAGTCTCACCTGCAGG + Intronic
1148220698 17:45859685-45859707 TGCCCATCTGAGTCACCTGGAGG - Intergenic
1148241239 17:46000631-46000653 TGCACACTAGAGTCACCCAGGGG - Intronic
1148773748 17:50081623-50081645 TGCACATTAGCATCACTTGGGGG - Intronic
1148892432 17:50817724-50817746 TGGGCATGAGAATCACCTGGAGG - Intergenic
1149855025 17:60074954-60074976 TACACATTAGAATCACTTGGAGG - Intronic
1150605321 17:66685874-66685896 TGGACATCAGAATCACCTGGAGG + Intronic
1150628268 17:66857925-66857947 TGCCCATGAGTGTCATCTGGGGG - Intronic
1150717481 17:67584060-67584082 TGCCCCTTAGATTCACCTGGGGG - Intronic
1152110295 17:78353900-78353922 TGCTGAGCAGAGTCATCTGGGGG + Intergenic
1153594908 18:6715601-6715623 TGCTCATTAGAGTCCCCACTAGG + Intergenic
1153605939 18:6832404-6832426 TGCTCATTAGATTAAGGTGGTGG + Intronic
1153621641 18:6984464-6984486 AGCACATTAGAATCACCTGAGGG + Intronic
1153771787 18:8422581-8422603 TGCTCACAAGAGTCAACAGGTGG + Intergenic
1154979705 18:21492638-21492660 AGCTCATCAGAATCACCTGCAGG + Intronic
1155509253 18:26560542-26560564 TGCACATTAGAATCACCTGCAGG - Intronic
1156159531 18:34342977-34342999 TGCACATTAGAATCACCTCCTGG - Intergenic
1156245036 18:35289912-35289934 CGCGCATCAGAATCACCTGGAGG - Intronic
1157090186 18:44627679-44627701 TGCAGGTTAGAATCACCTGGGGG - Intergenic
1157211790 18:45749157-45749179 TGCACATCAGAATCATCTGGGGG - Intronic
1157241687 18:46015649-46015671 TGAGCATCAGAATCACCTGGAGG - Intronic
1157587552 18:48814406-48814428 TGTACATTGGAGTCACCTGGAGG - Intronic
1157758841 18:50244035-50244057 TGCACATTACTATCACCTGGGGG - Intronic
1158110805 18:53939579-53939601 TGCACATCAGATTCACCTGAAGG - Intergenic
1158184159 18:54752409-54752431 TGCACATGAGAATCACCTGGGGG - Intronic
1158514475 18:58119740-58119762 TGCACATCAGAATCACCTGGGGG + Intronic
1158669205 18:59459762-59459784 GGCACATTACAATCACCTGGAGG + Intronic
1159605254 18:70468260-70468282 TGCACGTTGCAGTCACCTGGGGG + Intergenic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163555611 19:17990913-17990935 TGCTCATTGAAGTCACCAGGGGG + Intronic
1163743025 19:19028217-19028239 AGCACGTTAGCGTCACCTGGGGG - Intronic
1164697760 19:30259525-30259547 TACGCATCAGAGTCACCTAGAGG - Intronic
1166339480 19:42129134-42129156 AGCACATTAGAATCACCAGGAGG - Intronic
1166427777 19:42695037-42695059 TACTGATTAGAGTCACTTGCAGG + Intronic
1166625169 19:44345180-44345202 TGCACACTGTAGTCACCTGGGGG - Intronic
1168083372 19:54027001-54027023 TGTGCATCAGAATCACCTGGAGG - Intergenic
1168229985 19:55024786-55024808 TGAGCATAAGAATCACCTGGAGG - Intronic
926067386 2:9854053-9854075 TGTGCATCAGAATCACCTGGAGG - Intronic
926857819 2:17276058-17276080 TGTGCATCAGAGTCACTTGGAGG - Intergenic
926980367 2:18561145-18561167 TGCACATCAGAATCACCTGGAGG + Intronic
927967460 2:27280056-27280078 TACTCATTAGCATCACCAGGTGG - Intronic
928258870 2:29749133-29749155 GGCACATCAAAGTCACCTGGAGG + Intronic
928469245 2:31557289-31557311 TGCACATTAAAATCATCTGGGGG - Intronic
928856476 2:35808644-35808666 TGTGCATCAGAATCACCTGGAGG + Intergenic
929290359 2:40183757-40183779 TGCATATTAGAATCACCTGTGGG + Intronic
931379993 2:61743825-61743847 TGCACGTTAGAATCATCTGGGGG - Intergenic
931756430 2:65378755-65378777 TGCACACTGGAATCACCTGGAGG + Intronic
932255153 2:70278687-70278709 TGCACATTGGAATCACCTGTAGG + Exonic
933292036 2:80448589-80448611 TGTACATTAGTATCACCTGGAGG - Intronic
933722523 2:85407387-85407409 TGCACATTAGAATCATTTGGGGG + Intronic
933762035 2:85679128-85679150 TGCTCATCACAGTCACCCCGGGG + Intergenic
934085574 2:88506364-88506386 CGTGCATTAGAATCACCTGGAGG - Intergenic
934483199 2:94673049-94673071 TGCACATTAGAGTCACCTTGGGG - Intergenic
934578934 2:95422832-95422854 TGACCATTAGAATCACCTGTGGG + Intergenic
934600513 2:95653871-95653893 TGACCATTAGAATCACCTGTGGG - Intergenic
934715821 2:96542654-96542676 GGCCCATCAGAATCACCTGGAGG - Intronic
934773980 2:96925625-96925647 TGCTCATAAGAGTCCAATGGTGG - Intronic
935338197 2:102036110-102036132 TGCTGATTAGAGCCACAGGGTGG + Intergenic
935645765 2:105332905-105332927 TGCCCATTAGAATCCTCTGGAGG - Intergenic
935653664 2:105403632-105403654 TAGTCATCAGAATCACCTGGAGG - Intronic
936007602 2:108905161-108905183 TGAACATTAGAGTCACCTGCAGG - Intronic
938556594 2:132430304-132430326 TACACATTGGAGTCACCTGAAGG - Intronic
938570218 2:132555916-132555938 TGTTCATTAGAACTACCTGGAGG + Intronic
938644152 2:133314349-133314371 TGTTCATCTGAGTCACCTGGTGG + Intronic
938731078 2:134148289-134148311 TGCCCATTGGAATCACCTGGGGG + Intronic
938842899 2:135180206-135180228 TGTGCATCAGAGTCACCTGAAGG - Intronic
938961969 2:136352218-136352240 TGCACATTAGAATCACCTGGGGG + Intergenic
938973587 2:136454674-136454696 TGTTCATTAGGATCACCTAGAGG - Intergenic
939563577 2:143759811-143759833 TGCTCATTAGTATTACCTGGGGG + Intronic
939614563 2:144348036-144348058 TGCACATTAGAATCACCTGGGGG + Intergenic
939666081 2:144953102-144953124 TTATCATTAAAGTTACCTGGGGG + Intergenic
940026471 2:149213848-149213870 TGCACATCAGAATCACCTCGGGG - Intronic
940047046 2:149420930-149420952 TGCAAGTTAGAATCACCTGGAGG + Intronic
940175702 2:150875484-150875506 TGTGCATCAGAATCACCTGGAGG + Intergenic
940498696 2:154466773-154466795 TGCTCTTAAGAGTAAGCTGGGGG + Intergenic
940805752 2:158184722-158184744 TGCTCATTAGAATCATCTAGTGG - Intronic
940893095 2:159054384-159054406 TGCACATTAGAATCACCTGGTGG + Intronic
940912895 2:159224680-159224702 TGCTGCTCAGAGTCACCTGGGGG - Intronic
940994120 2:160128689-160128711 TGCTCAGTCTAGTCACCTGGGGG - Intronic
941127082 2:161596989-161597011 TGTGCATCAGAATCACCTGGAGG + Intronic
941323500 2:164084686-164084708 TGCACATTACAATCACCTGGGGG - Intergenic
941906847 2:170724886-170724908 TGTGCATTAGAATCACCTGGAGG - Intergenic
941942264 2:171053002-171053024 TGCTCCTTAGACTCACCAGTTGG - Intronic
942106937 2:172642577-172642599 AGCACATCAGACTCACCTGGAGG - Intergenic
942256277 2:174102251-174102273 TGTGCATTAGAATCATCTGGAGG - Intronic
942598048 2:177611064-177611086 TATACATTAGAGTTACCTGGGGG + Intergenic
942719430 2:178934113-178934135 TGCACACTGGAGTCACCTGGGGG - Intronic
942821947 2:180125000-180125022 TACACATTAGAATCACCTCGGGG - Intergenic
943007221 2:182400562-182400584 TGCTCCTGAGAGTCCTCTGGAGG - Intronic
943755577 2:191553640-191553662 TGCATATGAGAGTCACCTGGGGG - Intergenic
943759315 2:191591293-191591315 TGTGCATCAGAATCACCTGGAGG - Intergenic
944285041 2:197939812-197939834 TGCATATTAGAATCACTTGGGGG - Intronic
944402849 2:199347993-199348015 TGTGCATCAGAATCACCTGGAGG - Intronic
944556794 2:200895063-200895085 TGGGCATCAGAATCACCTGGAGG - Intronic
945286607 2:208088773-208088795 TGCACATTAGAATCAGCTGAGGG + Intergenic
945656701 2:212632760-212632782 TTCACATAAGAATCACCTGGAGG - Intergenic
946854439 2:223939247-223939269 TGTGCATCAGAATCACCTGGGGG - Intronic
947160120 2:227206373-227206395 TGCACATTAGAATCACCTGAGGG - Intronic
948113696 2:235477687-235477709 TCCCCATTAGACTCACTTGGTGG - Intergenic
948338562 2:237230888-237230910 TAATCAGTAGAGTCACCTGGGGG + Intergenic
1169529704 20:6471710-6471732 TGCATATTAGAATCAACTGGAGG + Intergenic
1169785474 20:9355066-9355088 GGTACATTAGAATCACCTGGGGG - Intronic
1170008492 20:11694819-11694841 TGTCCATCAGAATCACCTGGAGG + Intergenic
1170036052 20:11991306-11991328 TGCACATTAGAATCACCCTGGGG + Intergenic
1170306814 20:14947590-14947612 TGTGCATCAGAGTCACCTAGAGG + Intronic
1170391375 20:15878373-15878395 TGTGCATGAGTGTCACCTGGAGG + Intronic
1170568183 20:17618278-17618300 AGCCCATTGTAGTCACCTGGGGG - Intronic
1170899177 20:20443977-20443999 TGCGCATGAGAATCACCTAGTGG + Intronic
1171006131 20:21467407-21467429 TGCTCATTAGAATCATTTTGGGG - Intergenic
1172557641 20:35856349-35856371 TGTACATCAGAATCACCTGGAGG + Intronic
1173478638 20:43382043-43382065 TGTGCATTAGAATCACCTGGAGG - Intergenic
1174083139 20:47984900-47984922 TGCATATTTGAGTCACCTGAGGG - Intergenic
1174132813 20:48358062-48358084 TGCACATTTGAGTCACCTGAGGG + Intergenic
1175077826 20:56391051-56391073 TGCAGATTAGAGTCACCTGAAGG - Intronic
1175084447 20:56446813-56446835 TGCTCAGTACAATCACCTGAGGG - Intronic
1175224554 20:57437447-57437469 TGCCCATCAGAGTCACCTGAGGG + Intergenic
1175248202 20:57593802-57593824 TGGGCATCAGAGTCACCTGTGGG + Intergenic
1175671181 20:60903808-60903830 TGCTGATGTGAGTGACCTGGTGG - Intergenic
1177474724 21:21605074-21605096 TTTGCATTAGAGTCACCTGCTGG + Intergenic
1178261314 21:31102248-31102270 GGCACATTAAAATCACCTGGAGG + Intergenic
1178346519 21:31833305-31833327 TGTGCATCAGAATCACCTGGAGG + Intergenic
1178456656 21:32760636-32760658 TGTGCATCAGAATCACCTGGAGG + Intronic
1178476732 21:32943874-32943896 TGAGCCGTAGAGTCACCTGGAGG + Intergenic
1178884629 21:36475509-36475531 TGCACATCAGAATCACCGGGTGG - Intronic
1179025193 21:37673865-37673887 TGCACATCGGAGACACCTGGAGG + Intronic
1179093645 21:38291780-38291802 TGTGCTTTAGAATCACCTGGAGG - Intronic
1179106541 21:38405552-38405574 TGCTCATTAGAGTCACCTGGGGG - Intronic
1179207201 21:39292575-39292597 TGTGCATGAGAATCACCTGGAGG - Intronic
1179254125 21:39700140-39700162 TGCACATCAGAATCACCTGGAGG - Intergenic
1179364305 21:40741785-40741807 TGCTCATTCGAATCACCTGGTGG - Intronic
1179394953 21:41030858-41030880 TGCTCAGTAGAATCCCATGGAGG - Intergenic
1179623119 21:42631905-42631927 TGCTCATTAGATTCACGTGGGGG + Intergenic
1180710744 22:17837749-17837771 TGATTATGAGACTCACCTGGGGG + Intronic
1181417798 22:22772742-22772764 TGCTCTATAGAGACTCCTGGAGG - Intronic
1181519537 22:23437168-23437190 TGCTCTTTAGAGTGACAGGGAGG - Intergenic
1182670794 22:31994178-31994200 TGTGCATCAGAATCACCTGGAGG + Intergenic
1182701286 22:32241170-32241192 TGCTGCTCAGTGTCACCTGGTGG - Intronic
1183093133 22:35537015-35537037 GGCGCATTAGAATCACCTAGGGG - Intergenic
1183266123 22:36826762-36826784 TGCACTTTAGAGGCACCTGCTGG + Intergenic
1183926835 22:41212306-41212328 TGCACATTAGAATCATCTAGGGG + Intronic
1184250985 22:43260186-43260208 TCCTCATTAGAGTCACTTTTGGG - Intronic
949311895 3:2709319-2709341 TGCATATTAGAATCATCTGGGGG + Intronic
950621287 3:14207566-14207588 TGTGCATGGGAGTCACCTGGAGG - Intergenic
951465877 3:23000037-23000059 AGCACATTAGAATCATCTGGGGG - Intergenic
951477741 3:23126395-23126417 TACACATCAGAATCACCTGGAGG - Intergenic
952329652 3:32352492-32352514 TGACCATCAGAATCACCTGGAGG - Intronic
952717012 3:36490019-36490041 TGTGCATCAGAATCACCTGGAGG - Intronic
953137146 3:40190796-40190818 TGCACAGTAGAATCACCAGGAGG - Intronic
953801497 3:46027315-46027337 TGCACATCAGAACCACCTGGAGG - Intronic
955550620 3:60081146-60081168 TTCCCATTAGAATCACCTGAGGG + Intronic
956060273 3:65341964-65341986 TGCATATTAGAATCACATGGGGG - Intergenic
956636518 3:71370726-71370748 TGCTCATCAAAATCACCTGGAGG + Intronic
956644575 3:71443488-71443510 TGTGCATCAGGGTCACCTGGAGG - Intronic
956660453 3:71592239-71592261 TGCGCATTGGAATCAGCTGGAGG + Intergenic
956698059 3:71935402-71935424 TGTGCATTAGAAGCACCTGGGGG + Intergenic
956837613 3:73108270-73108292 AGCTCATCTGAGTCGCCTGGAGG + Intergenic
956885019 3:73550384-73550406 TGCACATTATAATCACCTGGAGG + Intronic
956979749 3:74622104-74622126 TGCACATTAGAATCACCTGGAGG + Intergenic
958829711 3:99072687-99072709 TTCACATTAGAATCACTTGGCGG + Intergenic
960314268 3:116157077-116157099 GGATTATTAGAATCACCTGGGGG + Intronic
961107209 3:124252175-124252197 TGCACATTAGAATCACCAGGGGG + Intronic
961108947 3:124267475-124267497 TGCACATTAGAATCATCTGAGGG + Intronic
961209260 3:125112878-125112900 TGCACATTAGAATCACCTGGAGG - Intronic
961433752 3:126902120-126902142 TGCACATTAGAATCTCTTGGGGG + Intronic
961709835 3:128819637-128819659 TACACATTAGAATCACCTGGAGG - Intergenic
961925426 3:130474479-130474501 TTAACATTAGAGTCACCTTGAGG - Intronic
962291273 3:134138347-134138369 TGAGCATCAGAATCACCTGGAGG - Intronic
962478968 3:135782049-135782071 TGTGCGTTAGAATCACCTGGAGG - Intergenic
962611360 3:137079262-137079284 TGGGCATCAGAATCACCTGGAGG - Intergenic
962873200 3:139516067-139516089 TGCATATTAAAATCACCTGGGGG + Intergenic
963751788 3:149187533-149187555 TGCACATTAGAATCAACTGGGGG - Intronic
963983424 3:151565603-151565625 TGTGCATCAGACTCACCTGGGGG + Intergenic
964428813 3:156582157-156582179 GGCTCATCAGAATCACCTGTTGG + Intergenic
964449906 3:156802051-156802073 TGTGCATTAGAATCCCCTGGAGG + Intergenic
964710312 3:159665038-159665060 TGCACATTACAATCACCGGGGGG + Intronic
964844164 3:161027765-161027787 TGTACATAAGATTCACCTGGAGG - Intronic
965230802 3:166049997-166050019 TGCACATTAGAATAACCTGAGGG - Intergenic
965389858 3:168092075-168092097 TGCCCATTAGTATCACCTGGTGG - Intronic
965602478 3:170468870-170468892 TGCACTTGAAAGTCACCTGGGGG + Intronic
965642878 3:170849406-170849428 TGCACGTTAAAGTCAGCTGGGGG - Intronic
966178886 3:177170018-177170040 TGTGCATCAGAATCACCTGGAGG - Intronic
966213464 3:177477044-177477066 TACACATTGGAATCACCTGGGGG + Intergenic
967108024 3:186269542-186269564 TGCCCATTAGAAGTACCTGGGGG + Intronic
967883254 3:194316129-194316151 AGCTCATGGGAGTCGCCTGGAGG + Intergenic
967935040 3:194720414-194720436 TGTACATTAGAATCACCTGGGGG - Intergenic
968149503 3:196325859-196325881 TGTGCATGAGAATCACCTGGAGG - Intronic
968352837 3:198075658-198075680 TGTGCATTACAGTGACCTGGGGG - Intergenic
968426917 4:530142-530164 TGCTCATTTGGCTCATCTGGTGG - Intronic
969621695 4:8281921-8281943 AGCTCAGAAGGGTCACCTGGGGG + Intronic
969920718 4:10537034-10537056 TGCATATTAGCTTCACCTGGGGG + Intronic
969950426 4:10829992-10830014 TGCATAGTAGACTCACCTGGAGG + Intergenic
970150565 4:13085209-13085231 TGTGCATCAGAATCACCTGGAGG + Intergenic
970480034 4:16463465-16463487 TGGGCATCAGAATCACCTGGAGG + Intergenic
971049002 4:22839482-22839504 TGGGCATCAGTGTCACCTGGAGG + Intergenic
971344361 4:25798459-25798481 TGCACACTGGAATCACCTGGGGG - Intronic
972511008 4:39769159-39769181 TGTGCATCAGAATCACCTGGAGG + Intronic
973723573 4:53749903-53749925 TACACATCAGAATCACCTGGTGG - Intronic
973785792 4:54331787-54331809 TGCACATTAGAATCATCTGGAGG - Intergenic
974095689 4:57361440-57361462 TGAGCATCAGAATCACCTGGAGG + Intergenic
975569900 4:75804637-75804659 TATACATTAGAATCACCTGGTGG - Intronic
976042163 4:80899547-80899569 TGCTCATTTTAGTCAACAGGTGG - Intronic
976403857 4:84639227-84639249 TGGCCATTAGAATTACCTGGGGG - Intronic
976476023 4:85483891-85483913 TGTACATCAGAATCACCTGGAGG - Intronic
978275796 4:106948229-106948251 TGTGCATCAGAATCACCTGGAGG + Intronic
980001110 4:127489053-127489075 TGACCATTAGAATCTCCTGGGGG - Intergenic
980669693 4:135988139-135988161 TCCTCATTAGAATCACCAGGAGG + Intergenic
980755579 4:137155211-137155233 GGCTCATAAGAGTCATCTCGAGG + Intergenic
980795730 4:137680153-137680175 TGCTCACTAGAGTCTCCAGAAGG + Intergenic
980954703 4:139416271-139416293 TCCTCATTACTGCCACCTGGTGG - Intronic
981009443 4:139910303-139910325 TACTCATCACAGTCATCTGGAGG - Intronic
981714184 4:147736721-147736743 TGCTCAATAAAATCACCTGGGGG + Intronic
981920594 4:150080117-150080139 CCCACATTAGAATCACCTGGGGG - Intronic
981979919 4:150778883-150778905 TGTTCATTAGAGACTTCTGGAGG + Intronic
982080792 4:151787514-151787536 TGTACATTAGAATCACTTGGGGG + Intergenic
984489753 4:180418026-180418048 TGTGCATCAGAATCACCTGGAGG - Intergenic
984589001 4:181595612-181595634 TGCACATATGAGTCACTTGGGGG - Intergenic
986000624 5:3628108-3628130 TGCTGCTCAGAGTCACCTAGGGG - Intergenic
986510049 5:8495450-8495472 TGCCCGTTTGAGTCAGCTGGAGG + Intergenic
986638439 5:9848028-9848050 TGTGCATCAGAATCACCTGGAGG - Intergenic
989021954 5:37018169-37018191 CATTCATTAGAATCACCTGGAGG - Intronic
989122205 5:38016084-38016106 TGCACATTATAATCACCTGGAGG - Intergenic
989145533 5:38245890-38245912 TGCACATTCGAATCACTTGGGGG - Intergenic
989156440 5:38348890-38348912 TGCACATTAGAATCACCTGGAGG + Intronic
989166468 5:38437649-38437671 TGCACATTAGAACCACCTGGCGG - Intronic
989358454 5:40571802-40571824 AGCGCATTAGAATTACCTGGGGG - Intergenic
989557963 5:42818837-42818859 TTCTCATCAGAGTCTCCTGCTGG - Intronic
990173261 5:53078997-53079019 TGTGCATTACAATCACCTGGAGG + Intronic
990393278 5:55350169-55350191 TGCACAGCAGAATCACCTGGGGG - Intronic
990402753 5:55455897-55455919 GGTTCATTAGAGTTATCTGGAGG - Intronic
990982655 5:61615762-61615784 TGAACATTAGAGTCACTTGAGGG - Intergenic
991197005 5:63946542-63946564 TGCACATTAGAATTACCAGGGGG - Intergenic
991627688 5:68621219-68621241 TGCACATTAGAATTGCCTGGAGG - Intergenic
992400977 5:76411146-76411168 AGCGCATCAGAATCACCTGGAGG - Intronic
992532936 5:77670117-77670139 TGTTCATCATACTCACCTGGAGG - Intergenic
992677200 5:79117051-79117073 TCCATCTTAGAGTCACCTGGGGG - Intronic
993529890 5:89011217-89011239 TGCACGTTAGATTCACCTAGAGG - Intergenic
993710899 5:91223720-91223742 TGCACATTAGAATCATCTAGGGG - Intergenic
993774906 5:91981250-91981272 TGAGCATCAGATTCACCTGGAGG + Intergenic
994139658 5:96327985-96328007 GGCTCATTAGGGGCATCTGGTGG - Intergenic
994356391 5:98798382-98798404 TGCTTATTAGAGGTACCTGGGGG - Intronic
994367806 5:98935265-98935287 GGCACATTAGAATCACCTAGGGG - Intergenic
995459548 5:112388502-112388524 TGCACATTACAGTCACCTGTGGG - Intronic
995549060 5:113262722-113262744 TGAGCATCAGAGTCATCTGGAGG + Intronic
995604674 5:113839712-113839734 TGTGCATTAGAATCACCTCGAGG - Intergenic
997433221 5:133856012-133856034 TCCACATCAGAATCACCTGGAGG + Intergenic
997734663 5:136204413-136204435 TGGTCATCAGAGTTGCCTGGGGG + Intergenic
998389390 5:141777836-141777858 TGTGCATCAGAATCACCTGGAGG - Intergenic
998790634 5:145763060-145763082 TGAGCATCAGAGTCATCTGGAGG - Intronic
999130627 5:149280495-149280517 TGAACATCAGAATCACCTGGGGG - Intronic
999664058 5:153894387-153894409 GGTGCATTAGACTCACCTGGAGG + Intergenic
999817236 5:155189439-155189461 TGTGCATCAGAATCACCTGGAGG + Intergenic
999960724 5:156753165-156753187 TGAGCATCAGAATCACCTGGTGG - Intronic
1000063801 5:157678318-157678340 TGCTTATCAGAATCCCCTGGAGG + Intronic
1000142129 5:158415703-158415725 TGCACAATAGAATCACCCGGGGG + Intergenic
1000297377 5:159923710-159923732 TGCTCATCAGAAACATCTGGAGG + Intronic
1000703342 5:164480123-164480145 TGTGCATTAGAATCACCAGGAGG - Intergenic
1001111782 5:168902705-168902727 TGCTCATAAGCATCACATGGAGG - Intronic
1001156091 5:169273491-169273513 TGCAAATTAGAATCACCTGAGGG + Intronic
1001682946 5:173572044-173572066 TGCATATCAGAGTCACCTGAAGG - Intergenic
1002637672 5:180616191-180616213 TGGTCAGTAGGGTCCCCTGGGGG + Intronic
1002899396 6:1398390-1398412 TGCACATCAGAATCACCTGGAGG + Intergenic
1003422194 6:5968596-5968618 TGCACATTAGAATCACCTGGGGG + Intergenic
1003453732 6:6261619-6261641 AGCACATCAGAATCACCTGGAGG - Intronic
1003453738 6:6261656-6261678 AGCACATCAGAATCACCTGGAGG - Intronic
1003453744 6:6261693-6261715 AGCACATCAGAATCACCTGGAGG - Intronic
1003453750 6:6261730-6261752 AGCACATCAGAATCACCTGGAGG - Intronic
1003453756 6:6261767-6261789 AGCACATCAGAATCACCTGGAGG - Intronic
1003453762 6:6261804-6261826 AGCACATCAGAATCACCTGGAGG - Intronic
1003453768 6:6261841-6261863 AGCACATCAGAATCACCTGGAGG - Intronic
1003453774 6:6261878-6261900 AGCACATCAGAATCACCTGGAGG - Intronic
1003453780 6:6261915-6261937 AGCACATCAGAATCACCTGGAGG - Intronic
1003453786 6:6261952-6261974 AGCACATCAGAATCACCTGGAGG - Intronic
1003453792 6:6261989-6262011 AGCACATCAGAATCACCTGGAGG - Intronic
1003453798 6:6262026-6262048 AGCACATCAGAATCACCTGGAGG - Intronic
1003453804 6:6262063-6262085 AGCACATCAGAATCACCTGGAGG - Intronic
1003453810 6:6262100-6262122 AGCACATCAGAATCACCTGGAGG - Intronic
1003453816 6:6262137-6262159 AGCACATCAGAATCACCTGGAGG - Intronic
1003453822 6:6262174-6262196 AGCACATCAGAATCACCTGGAGG - Intronic
1003453828 6:6262211-6262233 AGCACATCAGAATCACCTGGAGG - Intronic
1003453834 6:6262248-6262270 AGCACATCAGAATCACCTGGAGG - Intronic
1003874664 6:10425042-10425064 TGTGTATTAGAGTCAGCTGGAGG + Intergenic
1004649295 6:17593130-17593152 TGTTCATCAGAATCACATGGAGG + Intergenic
1004689241 6:17977198-17977220 TGTGCATCAGAATCACCTGGAGG - Intronic
1004789567 6:19009353-19009375 AGTACATTACAGTCACCTGGGGG - Intergenic
1005003485 6:21265593-21265615 TGGTCCTTAGATTCACATGGTGG + Intergenic
1005124240 6:22428084-22428106 TGCCCAATAGAGTCAACTTGAGG + Intergenic
1005595200 6:27372530-27372552 TATGCATCAGAGTCACCTGGAGG - Intergenic
1005732284 6:28709749-28709771 TGATTTTCAGAGTCACCTGGGGG + Intergenic
1005957771 6:30676649-30676671 TCCTCATTGGAGTGACCTGAAGG - Exonic
1006185852 6:32181380-32181402 TGCTCATTGGGGTCATCTTGTGG - Exonic
1006376138 6:33672674-33672696 TGCACCTCAGAATCACCTGGAGG - Intronic
1006972580 6:38062021-38062043 TGCACATTAGAATCCACTGGGGG + Intronic
1007152232 6:39705182-39705204 TGTGCATCAGAATCACCTGGAGG + Intronic
1007161823 6:39797527-39797549 TGCACATTAGAACCACTTGGGGG + Intronic
1007812514 6:44496464-44496486 TGAGCATCAGAATCACCTGGAGG + Intergenic
1008749165 6:54711260-54711282 TGTTCATTAGAATTACTTGGAGG - Intergenic
1008872134 6:56284963-56284985 TGCACATTTGAATCACCTGGGGG - Intronic
1009294730 6:61932329-61932351 TCATCATTATAGTCACCTGGCGG + Intronic
1009673599 6:66788200-66788222 TGCTCATTTGCATCACCAGGGGG + Intergenic
1010208080 6:73340966-73340988 TGTGCATCAGAATCACCTGGAGG + Intergenic
1010590320 6:77704651-77704673 TATTCATGAGAATCACCTGGGGG - Intronic
1010931825 6:81812981-81813003 TCTTCACAAGAGTCACCTGGTGG - Intergenic
1011794511 6:90937775-90937797 TGAACATCAGAATCACCTGGAGG + Intergenic
1011883866 6:92067062-92067084 TGAACATTAGAGTCAGCTGCAGG + Intergenic
1012256628 6:97040477-97040499 TGGGCATGAGAGTCACCTGGAGG + Intronic
1012394146 6:98776279-98776301 TGTGCATTAGAATCACCTGGAGG - Intergenic
1012677476 6:102135321-102135343 TGTTCAGAAGAGTCACATGGAGG + Intergenic
1012871815 6:104682151-104682173 TGTGCATCAGAATCACCTGGAGG + Intergenic
1013104050 6:107011223-107011245 TGTGCATCAGAATCACCTGGAGG + Intergenic
1013646476 6:112146528-112146550 TGTGCATTAGAATCACCTGGAGG - Intronic
1013970265 6:116009392-116009414 TGTACATTAGATTCAGCTGGGGG - Intronic
1014015082 6:116520550-116520572 TGCAAATTGGAATCACCTGGGGG + Exonic
1014178397 6:118355165-118355187 TGCAATTTAGAATCACCTGGGGG - Intergenic
1014241331 6:119021165-119021187 TGCACATTGGAGTGACCTGAAGG - Intronic
1014625116 6:123715454-123715476 TGGTCAGTTGAGTCACCAGGGGG - Intergenic
1015135652 6:129866868-129866890 TGGGCATCAGAATCACCTGGAGG + Intergenic
1015166076 6:130201562-130201584 TGCACATTAAATTCACCTAGTGG - Intronic
1015768502 6:136744746-136744768 TGCACATTGTAATCACCTGGGGG + Intronic
1015895008 6:138008547-138008569 TGCACAGTGGAATCACCTGGGGG - Intergenic
1015964259 6:138682720-138682742 GCCTCATTGGAATCACCTGGGGG + Intronic
1016308917 6:142712920-142712942 TGTGGATTAGAATCACCTGGGGG + Intergenic
1016376895 6:143430404-143430426 TGCCCGTTAGAATCACCTGGAGG - Intronic
1017152268 6:151291163-151291185 TGCCCATTGGAATCACCTGGGGG + Intronic
1018576929 6:165268676-165268698 TGCACATTAGACTGACATGGGGG - Intergenic
1019480186 7:1262972-1262994 TGCTGGCCAGAGTCACCTGGAGG + Intergenic
1019671763 7:2283698-2283720 TGCGTATCAGAATCACCTGGTGG + Intronic
1019846688 7:3509879-3509901 TGCACGTTAGAATCACCTAGTGG + Intronic
1019901992 7:4028211-4028233 TGGGTGTTAGAGTCACCTGGAGG - Intronic
1020971869 7:14953821-14953843 TGTGCAGTAGAGTCAACTGGGGG - Intronic
1021089125 7:16461273-16461295 TGCTCATTATAATCACCCGGAGG - Intergenic
1021459102 7:20865720-20865742 TTCTCATTAGGATCACTTGGTGG + Intergenic
1021521783 7:21545893-21545915 TGAACATTAGGATCACCTGGGGG + Intronic
1021619283 7:22535554-22535576 TGTGTATTAGAATCACCTGGGGG + Intronic
1021619589 7:22538037-22538059 TGCCCATTAGAGTCATCTCACGG - Intronic
1021816365 7:24451207-24451229 TGTACATTAGACCCACCTGGGGG + Intergenic
1021856794 7:24864930-24864952 TGCACATTAGAATCACCCAGAGG - Intronic
1022127429 7:27371959-27371981 GGCGCATTAGAATCACCTGGAGG - Intergenic
1022190570 7:28013417-28013439 TGTGCATCAGAATCACCTGGAGG + Intronic
1022415064 7:30170397-30170419 GGCTCCTAAGAATCACCTGGTGG + Intergenic
1022531404 7:31069101-31069123 TACACTTTAGAATCACCTGGAGG - Intronic
1022537273 7:31106096-31106118 TACACATTAGAATTACCTGGGGG - Intronic
1022562304 7:31362493-31362515 TACTCATGAGAGTCCCCTGAGGG + Intergenic
1022939031 7:35213369-35213391 TGCTCATTGGAATCACCAGGGGG - Intronic
1023827210 7:44017623-44017645 TGTGCATTAGAATCACCTGAAGG - Intergenic
1024291558 7:47807974-47807996 TGCCCCTTAGCGTCCCCTGGAGG + Intronic
1024796209 7:53024397-53024419 TGTTCATTAAAATCAACTGGAGG - Intergenic
1024894827 7:54245888-54245910 TGCACATTGGAATCATCTGGGGG - Intergenic
1024938776 7:54740539-54740561 TGCACATTAGAATCACCTGGGGG + Intergenic
1026068526 7:67097116-67097138 TACACATTGGAATCACCTGGGGG + Intronic
1026573478 7:71552741-71552763 TGCCCTTAAGAGTAACCTGGTGG - Intronic
1026708386 7:72715196-72715218 TACACATTGGAATCACCTGGGGG - Intronic
1027702916 7:81491168-81491190 TGCATATTAGAGTCACCTGAGGG + Intergenic
1027729435 7:81851367-81851389 TATTCATCAGAATCACCTGGAGG - Intergenic
1028229977 7:88295502-88295524 TGTACATTTGAATCACCTGGGGG - Intronic
1028371978 7:90102036-90102058 TGTGTATTAGAATCACCTGGGGG - Intergenic
1028841378 7:95433447-95433469 TGTACATTAGAATCTCCTGGAGG - Intronic
1029738362 7:102477370-102477392 TGTGCATTAGAATCACCTGAAGG - Intronic
1029755492 7:102571026-102571048 TGTGCATTAGAATCACCTGAAGG - Intronic
1029773441 7:102670106-102670128 TGTGCATTAGAATCACCTGAAGG - Intronic
1029812745 7:103065831-103065853 TGCTCACTAGTGTGAGCTGGTGG - Intronic
1030124180 7:106138979-106139001 GGCACATTAGAATCACCTGAGGG + Intergenic
1030317180 7:108127705-108127727 CGTTCATCAGACTCACCTGGAGG - Intronic
1031514578 7:122686476-122686498 TACGCATTAGAATCAGCTGGAGG + Intronic
1031618942 7:123912836-123912858 TGCACTTTAGAGTCGTCTGGGGG - Intergenic
1031793121 7:126135344-126135366 TGTACATTAGAATCACCTGGGGG - Intergenic
1032023991 7:128426932-128426954 TGTACATTAGAAACACCTGGAGG - Intergenic
1032215725 7:129955676-129955698 TGTTCTTCAGAATCACCTGGGGG + Intergenic
1032677391 7:134143981-134144003 TGCACATTGGAATCACCTGAGGG + Intronic
1032677462 7:134144455-134144477 AGCACATTAGAGCCACCTGATGG - Intronic
1032848636 7:135773309-135773331 TGATCATTAGACTCACCTGGTGG - Intergenic
1033140015 7:138817658-138817680 TGCTCATAAAAGTCGCCAGGAGG + Intronic
1033991462 7:147292625-147292647 TGCACATGAGAGTCATTTGGGGG - Intronic
1034872808 7:154698878-154698900 TGCTCATTAGTGCCTCCTAGAGG - Intronic
1035714451 8:1743408-1743430 TGCTCTTTAGTGTCCTCTGGAGG + Intergenic
1037020773 8:13967483-13967505 TGCTCATTAGAATCTGGTGGAGG + Intergenic
1037311183 8:17558391-17558413 TCCTCAGGTGAGTCACCTGGTGG + Exonic
1038905396 8:31896570-31896592 TGTTCATTAGAATAACCTGGAGG + Intronic
1039011840 8:33102139-33102161 TGCACGTTAGAATCACCTGTAGG - Intergenic
1039254730 8:35706561-35706583 TGCTCTTTAGTATCACCTGTAGG + Intronic
1039593717 8:38771620-38771642 TGCGCATGGGTGTCACCTGGAGG + Intronic
1041397331 8:57404966-57404988 TGGGCATTAAAGTCACCTGGGGG + Intergenic
1041798041 8:61767655-61767677 TTTTCCTGAGAGTCACCTGGTGG + Intergenic
1042510561 8:69607185-69607207 GGAGCATCAGAGTCACCTGGAGG - Intronic
1043457112 8:80423462-80423484 AGTGCATTATAGTCACCTGGAGG - Intergenic
1044376161 8:91473585-91473607 TACACATTAGAATCACCTGGAGG - Intergenic
1044738210 8:95300655-95300677 TGGACATCAGAATCACCTGGAGG - Intergenic
1045282336 8:100759846-100759868 TGCGCATCAAAATCACCTGGAGG - Intergenic
1045362706 8:101448010-101448032 AGCACGTTAGAATCACCTGGAGG - Intergenic
1045382377 8:101640103-101640125 TGCACAATCGAATCACCTGGGGG + Intronic
1045481125 8:102593134-102593156 TGCTCACTATAGTGATCTGGAGG + Intergenic
1045868148 8:106892908-106892930 TGCTCATTGGAATCATTTGGAGG - Intergenic
1045944355 8:107778884-107778906 TGCTCAACAAAATCACCTGGAGG + Intergenic
1046645494 8:116781554-116781576 TGCACATTAGAAACACCTGGAGG - Intronic
1046775909 8:118163498-118163520 TGTGCATTAGAACCACCTGGGGG + Intergenic
1047156493 8:122325237-122325259 TGCTCATGAGGGTTTCCTGGTGG - Intergenic
1047692203 8:127367190-127367212 TGCTCAGTAGAGTCCCCTGAAGG + Intergenic
1047723043 8:127659899-127659921 TGCACATGAGAATCATCTGGGGG + Intergenic
1047976581 8:130136537-130136559 TGCACATTACAATCACCTAGTGG + Intronic
1048329358 8:133461514-133461536 TGCTCCTTAGAATCATCTGTGGG - Intronic
1049165166 8:141121213-141121235 TGCACATCCGAGTCACCTGGGGG + Intronic
1050072032 9:1825239-1825261 TGCACATTAGAATCACCTGGGGG + Intergenic
1050113180 9:2237567-2237589 TACTCATTGGAATCACCTTGAGG + Intergenic
1050153355 9:2639652-2639674 TGCTCATTTGAGAGACTTGGAGG - Intronic
1050529445 9:6575517-6575539 TGTGCATGAGAATCACCTGGAGG - Intronic
1051402047 9:16693528-16693550 TGCTCATCAGCATCACGTGGAGG - Intronic
1051467467 9:17396647-17396669 TGCATATTAGAAGCACCTGGAGG + Intronic
1051481742 9:17569219-17569241 TACACATCAGAATCACCTGGAGG + Intergenic
1051669062 9:19492471-19492493 TGGACATCAGAATCACCTGGAGG + Intergenic
1053226698 9:36364733-36364755 TGTGCATTAGAATCACCTGGAGG + Intronic
1053466953 9:38315786-38315808 TGCTCCTTGGAGGCCCCTGGGGG - Intergenic
1053674582 9:40411331-40411353 TGCACATTAGAGTCACCTTGGGG + Intergenic
1053924374 9:43037695-43037717 TGCACATTAGAGTCACCTTGGGG + Intergenic
1054385688 9:64551395-64551417 TGCACATTAGAGTCACCTTGGGG + Intergenic
1054510038 9:65964960-65964982 TTCACATTAGAGTCACCTTGGGG - Intergenic
1054764561 9:69032758-69032780 AGCACATTAGAATCACCTGGAGG + Intergenic
1054970339 9:71078994-71079016 TGCTCATTCTATTCAACTGGTGG - Intronic
1055143781 9:72908073-72908095 TGTTCATTAGAATCATCTCGGGG - Intronic
1055561131 9:77522761-77522783 TGCACATTGGAATCACCTGTGGG - Intronic
1056304698 9:85278251-85278273 TGTGCATTAGAATCACCTGAAGG - Intergenic
1056367759 9:85922813-85922835 TTCACATCAGAATCACCTGGTGG + Intergenic
1056742078 9:89266159-89266181 TGATTCTTAGAGTCACCAGGAGG + Intergenic
1057038603 9:91831434-91831456 TTTTCCTTAGAGGCACCTGGGGG + Intronic
1057431387 9:94997613-94997635 TGCTTATTAGAGTCACCAGAAGG - Intronic
1058079509 9:100687344-100687366 TGCACACTAAAGTCACCTGGGGG + Intergenic
1058127253 9:101209179-101209201 TGCTTGTTACAATCACCTGGAGG - Intronic
1058424569 9:104865168-104865190 TGCCCGTTAGACTCAGCTGGGGG + Intronic
1059082179 9:111261770-111261792 TGGCCATTAGAATCACCTGGGGG - Intergenic
1059454208 9:114389375-114389397 TGCTTATCAGAATTACCTGGAGG - Intronic
1060188929 9:121580106-121580128 TGCCCCTTAGAGTCACCTGGTGG - Intronic
1061010224 9:127950343-127950365 TGCTCATCAGAATCCTCTGGAGG - Intronic
1061594435 9:131619779-131619801 TGCTCATTACACACACCTGTTGG - Intronic
1186810961 X:13188048-13188070 TGAGCATCAGAGTCACCCGGAGG + Intergenic
1186849451 X:13566307-13566329 TGTTCATTAGAATCACCAGAGGG + Intergenic
1187412143 X:19060868-19060890 TGCACATTGGAATCACCTGGGGG - Intronic
1187516288 X:19974333-19974355 TGTGCATTAGAATCGCCTGGAGG + Intergenic
1187571742 X:20510907-20510929 TGCTCATTGGAATCAGCTGGGGG + Intergenic
1187638042 X:21254690-21254712 TGTACATTAGTATCACCTGGAGG + Intergenic
1187991160 X:24874636-24874658 TGCACATTAGAATCACTTGGGGG + Intronic
1188055709 X:25538789-25538811 TATGTATTAGAGTCACCTGGAGG - Intergenic
1188229086 X:27638796-27638818 TGCACATCAGAATCATCTGGAGG + Intronic
1188362686 X:29275287-29275309 TGTGCATCAGAATCACCTGGAGG - Intronic
1188460982 X:30426868-30426890 TGTACATTAGAATCACCTGGAGG - Intergenic
1188690817 X:33126493-33126515 TGGGCATCAGATTCACCTGGAGG - Intronic
1189055664 X:37697132-37697154 TGATGATTAGAGTTACCTGGGGG + Intronic
1189128149 X:38469918-38469940 TGTACATTAGAATCACCTGGGGG + Intronic
1189488864 X:41454175-41454197 TGAACATTAGAATCACCTTGTGG - Intronic
1189925466 X:45948888-45948910 TGTTCATCAGAATCACCTGGAGG + Intergenic
1190118062 X:47638601-47638623 TGCTCATCAGAATCACCTGTAGG - Intronic
1190399363 X:50016191-50016213 TGTGCATCAGAATCACCTGGAGG - Intronic
1190760170 X:53432101-53432123 TGCCCATGAGATTCACCTGTAGG + Exonic
1192198499 X:69048302-69048324 TGCTCACTGGAATCCCCTGGGGG - Intergenic
1193148002 X:78097314-78097336 TGTGCATTAGATTCACCTGGGGG + Intronic
1195039314 X:100999768-100999790 TGCAAATTAGAATCACCTTGGGG + Intergenic
1195334987 X:103843958-103843980 TGATCATATGAATCACCTGGGGG + Intergenic
1195567140 X:106353982-106354004 TGCTCATTTGAGTGAGCTGTGGG + Intergenic
1195770460 X:108345831-108345853 TGCACATTAGAATCACTTGGGGG + Intronic
1195965603 X:110427467-110427489 TGCTCATCAGAATCACCTGTAGG - Intronic
1196938550 X:120753261-120753283 AGTACATTAGAGTCACCTGGGGG - Intergenic
1197253828 X:124241878-124241900 TGCACGTGAGAGACACCTGGAGG + Intronic
1197331367 X:125157059-125157081 TGCACATTAGAATCACCTGGGGG + Intergenic
1197981619 X:132223415-132223437 TGTACATCAGAATCACCTGGAGG + Intergenic
1199373503 X:147080293-147080315 TGCTCATTAAAATCACCTGTAGG + Intergenic
1199472733 X:148212580-148212602 TGCTAAATAGAATCATCTGGGGG + Intergenic
1199504459 X:148545711-148545733 TCCACATCAGAGTTACCTGGAGG + Intronic
1201499841 Y:14629820-14629842 TGCTCATTCCAGACACCTTGTGG - Intronic
1202305978 Y:23471532-23471554 TGTTCATTATACTCACCTTGTGG + Intergenic
1202564831 Y:26199057-26199079 TGTTCATTATACTCACCTTGTGG - Intergenic