ID: 1179107272

View in Genome Browser
Species Human (GRCh38)
Location 21:38413350-38413372
Sequence AAGTATGCAGAGAGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179107272 Original CRISPR AAGTATGCAGAGAGGGCTCT TGG (reversed) Intronic
900242193 1:1622417-1622439 ACGTCTGCAGAGTGAGCTCTCGG + Intronic
900315224 1:2052918-2052940 AAGTGTGCTCAGAGGGCCCTGGG - Intronic
901176486 1:7303220-7303242 AAGAAGGAAGAGAGTGCTCTAGG - Intronic
903674603 1:25055995-25056017 GAGCAGGCAGAGAGGGCTCCAGG + Intergenic
904611607 1:31728929-31728951 AAGGATGCAGGGTGGGCTCTAGG - Intronic
906141560 1:43536767-43536789 AAGCATGCAGAGAGGGCTGCGGG + Intronic
906350813 1:45057404-45057426 AAGTAAGTAGAGATGGCTCCTGG - Intronic
907182562 1:52583680-52583702 AAGAAAGCAGAGGGGACTCTGGG - Intergenic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
910762227 1:90745073-90745095 AAATATGCAGAGAAGGCATTGGG - Intergenic
911218289 1:95219352-95219374 CATTAGGCTGAGAGGGCTCTGGG + Intronic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
915243396 1:154539994-154540016 GAGTAGGCAGAGAGGTCACTGGG + Intronic
916475222 1:165162530-165162552 ACCTCTGCAGAGAAGGCTCTGGG + Intergenic
918805540 1:189036792-189036814 CAGTAAGCAGAGAGTACTCTGGG - Intergenic
920549057 1:206843086-206843108 AAGTAAGTAGAGAGGCCACTGGG + Intergenic
920685555 1:208106455-208106477 AAGTATTCAAAGAGGGCTGAGGG + Intronic
921971105 1:221150135-221150157 AAGTATAGATAGAGGGCTATGGG + Intergenic
922009599 1:221568944-221568966 AAGTATGCAGAGGGTGCTGAGGG + Intergenic
923628754 1:235635803-235635825 AAGTATGCATAGATGCCTTTGGG - Intronic
924013008 1:239686536-239686558 AAATATGAAGGAAGGGCTCTGGG - Intronic
1063368003 10:5502909-5502931 AAGTTTGCAGAGAAGGATCCAGG + Intergenic
1063397774 10:5707516-5707538 AAGTCTACAGAGAGAGTTCTGGG - Intronic
1068119340 10:52770521-52770543 AAGAATGAAGAGAGGGCTGAGGG + Intronic
1069808040 10:71138151-71138173 AAGGAGGCACAGTGGGCTCTGGG + Intergenic
1070819066 10:79344232-79344254 AACTTTGCAGAAAGGGCCCTGGG + Intergenic
1071358249 10:84819164-84819186 AGGTTGGGAGAGAGGGCTCTTGG - Intergenic
1071443174 10:85721987-85722009 AATAATGCAGAGAGGTCTCCTGG - Intronic
1071603307 10:86969425-86969447 AAGTGTGCTGAGAGGCCCCTGGG - Intronic
1074336850 10:112585576-112585598 AAGTTTGCAGAGAAGGCACAGGG + Intronic
1075060864 10:119255864-119255886 TGGGATGCAGGGAGGGCTCTGGG + Intronic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1082178729 11:49092613-49092635 CAGTATACAGAAAGGCCTCTAGG + Intergenic
1083236385 11:61353545-61353567 AAGTTAGCAGAGAGGGCTCTGGG + Intronic
1083883859 11:65561238-65561260 CAGTCTGCAGGGAGGGCGCTGGG + Intergenic
1084429019 11:69101171-69101193 AAGTGAGCAGAGGGGGCTCCTGG + Intergenic
1084955378 11:72688568-72688590 TAGTCTGCAGAAAGGGCACTGGG + Intronic
1086242018 11:84706305-84706327 AACTATACAGAGAGTGCTTTGGG + Intronic
1086699949 11:89889850-89889872 CAGTATACAGAAAGGCCTCTAGG + Intergenic
1086706221 11:89954666-89954688 CAGTATACAGAAAGGCCTCTAGG - Intergenic
1088342316 11:108782447-108782469 AAGCATGCAGAAAGGGATCTCGG - Intronic
1089527376 11:119106360-119106382 ATGTATGAAGAAGGGGCTCTTGG + Intronic
1090592976 11:128291918-128291940 AAGTCAACAGAGAGAGCTCTGGG + Intergenic
1092283061 12:7111922-7111944 AACTATGCATGGAGGGATCTAGG + Intergenic
1095198430 12:39352893-39352915 AAGGATTCAGAGAGTCCTCTAGG + Intronic
1095270227 12:40209992-40210014 AACTAGGAAGACAGGGCTCTGGG - Intronic
1100213330 12:92421101-92421123 ACATATGCAGAGATGGCTCTTGG + Exonic
1102734483 12:115146129-115146151 AATTATGGTGAGAGGGATCTGGG - Intergenic
1103054081 12:117804956-117804978 ACGGATGCTGAGTGGGCTCTGGG - Intronic
1104068721 12:125327015-125327037 AAGCCTGCAGAGAAGGCTCAGGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1111858565 13:93671663-93671685 AAGTGAGGAGAGAGGGCTGTGGG - Intronic
1113889964 13:113730559-113730581 CAGGATGGAGGGAGGGCTCTGGG - Intronic
1117458419 14:55920626-55920648 AAGCATGGAGAGTGGGCTATTGG + Intergenic
1118263028 14:64265901-64265923 AAGCATGCATAGAGGGTTTTGGG + Intronic
1120398660 14:84000794-84000816 AATTAAGGAGAGAGGGCTATTGG - Intergenic
1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG + Intronic
1126494121 15:49271438-49271460 AAGTATGCAGGGAAGGCTTTGGG + Intronic
1128561124 15:68668498-68668520 AAGTTTGCAGAGAGGTCCTTCGG - Intronic
1128578383 15:68791581-68791603 AAGGATACAGAGAGGGGCCTGGG + Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1129461711 15:75703081-75703103 GAGAAGGCAGAGAGGGCCCTGGG + Intronic
1129675257 15:77629904-77629926 AAGCAGGCAGAGAGGCTTCTTGG + Intronic
1129723141 15:77888765-77888787 GAGAAGGCAGAGAGGGCCCTGGG - Intergenic
1131046396 15:89319185-89319207 AAGGATGGAGGGAGGGGTCTGGG - Intronic
1132633114 16:929291-929313 CTGTATGGAGAGCGGGCTCTGGG - Intronic
1133235902 16:4387346-4387368 AAGTGTGTGGAGAGGGCTTTTGG - Intronic
1134625520 16:15720065-15720087 AAGTCAGCAGAGCGGGCTCCAGG - Intronic
1136280502 16:29206231-29206253 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1137750494 16:50858008-50858030 AAGCATGCAGGGAGGAGTCTGGG + Intergenic
1139955451 16:70690950-70690972 AAGAACCCAGAGAGGGCACTGGG + Intronic
1140453783 16:75092752-75092774 AAGGAGGCAGAGGGGGCTGTGGG + Intronic
1142084869 16:88172190-88172212 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1145113794 17:20189343-20189365 CAGTATGCAGAGAGAATTCTGGG + Intronic
1148374411 17:47129432-47129454 AAATTTGCATAGAGGGTTCTTGG + Exonic
1148386537 17:47238466-47238488 AGGTGTGCAGAGAGGGGCCTGGG - Intergenic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1149989338 17:61372698-61372720 AAGTATGCACAGAAGCCTCGCGG - Intronic
1150461960 17:65360970-65360992 AAGCATAGAGTGAGGGCTCTGGG - Intergenic
1151558917 17:74860657-74860679 GGGTAGGCAGAGAGGGCACTGGG - Intronic
1155383875 18:25255441-25255463 AAGAATGCATAAAGTGCTCTTGG + Intronic
1156297070 18:35802299-35802321 AAATCTTCAGTGAGGGCTCTGGG + Intergenic
1156844801 18:41652831-41652853 ACGTATGAAGAGAGTGGTCTTGG + Intergenic
1157605144 18:48921794-48921816 AGATATCCAGAGAGGGCTCCTGG + Exonic
1159028348 18:63206999-63207021 ACAGATGCAGAGAGGGCTCGTGG + Intronic
1160480959 18:79239188-79239210 AAGCATGCAGGGAGGTGTCTGGG + Intronic
1161812533 19:6478939-6478961 GAGGATGCAGAGACAGCTCTGGG + Exonic
1163745626 19:19044831-19044853 AAGTTGGAAGAGACGGCTCTGGG + Intronic
1163874061 19:19851473-19851495 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163903924 19:20134428-20134450 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163910231 19:20183101-20183123 GAGAATGCAGAGAAAGCTCTGGG - Intronic
1163932628 19:20411801-20411823 GAGAATGCAGAGAAAGCTCTGGG + Intergenic
1163936512 19:20449664-20449686 GAGAATGTAGGGAGGGCTCTGGG - Intergenic
1163970669 19:20790951-20790973 GAGAATGAAGAGAAGGCTCTGGG - Intronic
1164862397 19:31572520-31572542 AAGTATGCAAAGAGTCCCCTGGG + Intergenic
1165832566 19:38736761-38736783 AAGGATACAGAGAAGGCGCTGGG - Intronic
1167258947 19:48446856-48446878 GAGTATGCAGAGCAGGCTCCTGG - Intronic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1168587426 19:57604594-57604616 AGGTATGCAGTGAAGGGTCTGGG + Intronic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
926250502 2:11153172-11153194 AAGTAGCCAGGGAGGGGTCTAGG + Intergenic
926834765 2:17006279-17006301 AAATAGGCAGAGAGCTCTCTGGG + Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930765361 2:55079775-55079797 CAGTATTCAGACAGGGCTGTTGG - Intronic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
934581181 2:95440766-95440788 CAGTATACAGAAAGGCCTCTAGG - Intergenic
934598269 2:95635948-95635970 CAGTATACAGAAAGGCCTCTAGG + Intergenic
935465245 2:103389245-103389267 AAGTGTGAAGCCAGGGCTCTGGG - Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
938002947 2:127759978-127760000 AAGTATGAAGAGACAGCTGTTGG - Intronic
938719812 2:134056542-134056564 AATAATGCAGAGAGAGTTCTCGG - Intergenic
939893442 2:147764312-147764334 AACTATCCAGAGTGGACTCTGGG + Intergenic
940962955 2:159805687-159805709 CAGTATGCAGATAAGGGTCTTGG - Intronic
940988666 2:160075522-160075544 TAGCAGGCAGAGAGGGCTCTGGG + Intergenic
941441693 2:165545560-165545582 AAATATGTAGAGAGGTATCTGGG + Intronic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
944386197 2:199167689-199167711 CAGCTTGCAGAGAGGGTTCTGGG - Intergenic
945241315 2:207679458-207679480 AAGGAAACAGAGAGGACTCTGGG + Intergenic
945400721 2:209379250-209379272 AAGTGTCCAAAGAGGCCTCTGGG + Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
948258977 2:236589180-236589202 AAGTGGACAGAGAGGCCTCTGGG + Intergenic
948467144 2:238158113-238158135 AAGGTGGCAGAGAGGCCTCTGGG - Intergenic
948573740 2:238936469-238936491 AAGAAAGCGGAGAGGGTTCTGGG - Intergenic
1172481519 20:35274614-35274636 AAGTGGATAGAGAGGGCTCTGGG - Exonic
1172540066 20:35705806-35705828 AAAGATACAGATAGGGCTCTGGG + Intronic
1173615626 20:44401264-44401286 AGGAAGGCAGAGAGGGCACTGGG + Exonic
1175087775 20:56474718-56474740 AAATCTGCAGAAAAGGCTCTTGG + Exonic
1176051968 20:63124693-63124715 AAGCATGTAGAGAGGGCCTTGGG - Intergenic
1177046683 21:16179782-16179804 AAGTTTGAAGCGAGGGCTGTAGG + Intergenic
1178743631 21:35226611-35226633 AGGTGAGCAGAGTGGGCTCTGGG - Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1179382377 21:40911363-40911385 AAGTGAGCAGAGAGGGCTTCAGG - Intergenic
1179841520 21:44078709-44078731 AAGGAAGCAGAGAGGCTTCTCGG + Intronic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1181599725 22:23942346-23942368 AACCATGCTGAGAGGGCTCCTGG - Intergenic
1181608784 22:23998972-23998994 AACCATGCTGAGAGGGCTCCTGG + Intergenic
1183172955 22:36201494-36201516 GAGTATGCAGAGGGGCGTCTGGG + Intronic
1183180322 22:36255484-36255506 GAGTATGCAGAGGGGCGTCTGGG - Intronic
1183405225 22:37627202-37627224 ACTTGTGCAGAAAGGGCTCTAGG + Intronic
1183426429 22:37741868-37741890 AGGGCTGCAGAGAGGGCTCAGGG + Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
949656480 3:6226727-6226749 AGCTAAGCAGAGAGGGCCCTGGG + Intergenic
949896406 3:8770045-8770067 AAGGAGGCAGAAACGGCTCTTGG - Intronic
950218797 3:11178769-11178791 ACGTATGAAGGAAGGGCTCTCGG - Intronic
950521154 3:13498809-13498831 AAGTACGCAAAGAGGGGGCTGGG - Intronic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
955330334 3:58041925-58041947 AAGAAAGCAAAGAGGGCACTTGG - Intronic
956663381 3:71620266-71620288 TCCTATGCAGAGAGGTCTCTAGG - Intergenic
960874741 3:122285217-122285239 GAGAATGCAGAGAGGTTTCTTGG + Exonic
960965152 3:123099548-123099570 GAGTCTGCAGTGAGGGCTCGTGG + Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962810405 3:138954812-138954834 AGGTATGCAGAGAGGACTACAGG - Intergenic
964034983 3:152184622-152184644 AAATCTGCAGGAAGGGCTCTTGG - Intergenic
964385288 3:156140778-156140800 AAGTGTGAAGTGAGGGCTTTAGG + Intronic
966426626 3:179787038-179787060 AAGTATGCAGAAAAGACTATTGG + Exonic
967493057 3:190115205-190115227 AAGTTTCAAGAGAGGACTCTAGG + Intronic
971197951 4:24487228-24487250 GAGTAGGGAGAGAGGGGTCTTGG + Intergenic
973079603 4:45973044-45973066 AACTGTGCAGTGAGGGATCTAGG - Intergenic
975299262 4:72770575-72770597 AAATATACAGAGAGAGATCTTGG - Intergenic
981704034 4:147640552-147640574 AAGAATTCAGAGAAAGCTCTGGG - Intronic
983918828 4:173322499-173322521 AGGTATGGACAGAGGGCACTGGG - Exonic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
986709476 5:10478220-10478242 AAGTATCTGGAGAGGGCTCAAGG - Intergenic
991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG + Intergenic
991689358 5:69211609-69211631 AAGGATGCAGAAAGGATTCTTGG - Intergenic
992878685 5:81083329-81083351 AAGTCTGGACAGAGGTCTCTTGG - Intronic
993105540 5:83596319-83596341 AAGGAATCAGAGAGGGCTCAAGG - Intergenic
996461694 5:123752301-123752323 AAGTATTCAGAGAGTTCTCAAGG + Intergenic
997640976 5:135448712-135448734 AAGGATGCAGGCAGGGCTCAGGG - Exonic
999094202 5:148963839-148963861 AAGTCTTCAGAGAGGCTTCTAGG - Intronic
999678535 5:154032169-154032191 AAGGAAGAAGAGTGGGCTCTAGG - Intronic
1000118043 5:158171567-158171589 AAGGAAGCAGAGAGGATTCTGGG - Intergenic
1000815317 5:165914435-165914457 AATTATGCTGAGAAGGCTGTAGG - Intergenic
1001542377 5:172548652-172548674 AAGTATGCAGAGAAAGCACCTGG + Intergenic
1001765500 5:174242764-174242786 AAGAAGGCAGACTGGGCTCTGGG - Intronic
1002469171 5:179424719-179424741 AAGAAGGCATAGAGGTCTCTCGG + Intergenic
1002583499 5:180225631-180225653 AAGGACGCAGAGAGGCCTCTAGG + Intergenic
1002871452 6:1170298-1170320 ACCTATGGAGAGAGGGCTTTAGG - Intergenic
1003665307 6:8106363-8106385 AAGAATGCAGAGAAGGCACCTGG + Intergenic
1005366964 6:25088377-25088399 AGGTAGCCAGAGAGCGCTCTGGG + Intergenic
1006512322 6:34528416-34528438 AAGAATGCAGCGAGGGCTGCTGG + Intronic
1006573233 6:35022736-35022758 AAGTATGCATGGAGGGATGTGGG - Intronic
1006814728 6:36842371-36842393 AGGTAGGTAGAAAGGGCTCTGGG + Intergenic
1006847825 6:37075093-37075115 AAGGATGCAGAGAAAGATCTTGG - Intergenic
1011441968 6:87397181-87397203 AAGTCTGCAGAGAGTGCAATGGG + Exonic
1011808384 6:91099383-91099405 AAGAATGCAGATTGGCCTCTTGG - Intergenic
1013710413 6:112890643-112890665 AAGTATGTTGAGTAGGCTCTGGG - Intergenic
1016086619 6:139922583-139922605 AAATCTGCAGAGTGGGCTCCTGG - Intergenic
1016521808 6:144954579-144954601 AAGAATGGAGAGAAGGTTCTTGG + Intergenic
1017757427 6:157541435-157541457 TAGGAAGCAGACAGGGCTCTTGG - Intronic
1018621252 6:165731427-165731449 AAGTCTGCAGAGAGAGTTCCAGG + Intronic
1023464186 7:40435620-40435642 AAGCATGGAGAGTGAGCTCTGGG - Intronic
1025069203 7:55884270-55884292 ACGCATACAGAGTGGGCTCTGGG + Intergenic
1026487764 7:70836090-70836112 AAGTGTGCCCAGTGGGCTCTAGG - Intergenic
1027336485 7:77156051-77156073 AAGGGTGCTGAGAGAGCTCTAGG - Intronic
1029779304 7:102715050-102715072 AAGGGTGCTGAGAGAGCTCTAGG + Intergenic
1030616850 7:111746256-111746278 AACCATGCAGAGGGGGCTCTAGG + Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1033060405 7:138101047-138101069 AAGTATACAGAAAGAGCTATAGG + Intronic
1033460972 7:141547173-141547195 AAGTCTGCTGAGAGATCTCTAGG - Intergenic
1036726320 8:11224094-11224116 GGGTATGTAGAGAAGGCTCTAGG - Intergenic
1037587751 8:20289587-20289609 AGGAAAGCAGGGAGGGCTCTGGG + Intronic
1038484400 8:27923425-27923447 AAGTATTGAGACAGGGCTGTTGG - Intronic
1039581889 8:38673780-38673802 AAGGATGCAGAGAAGTTTCTTGG - Intergenic
1041928792 8:63265652-63265674 AAGTCTTCAGAGAGTGCTCCAGG + Intergenic
1046151466 8:110231850-110231872 AAGTTTGCAGAGAGTTTTCTGGG - Intergenic
1054473092 9:65553767-65553789 TAGTATCCAGTGAGGGCTGTGGG + Intergenic
1055528108 9:77155752-77155774 AAATTTGCAGGGAGTGCTCTTGG + Intergenic
1055681214 9:78717431-78717453 AAGTTGACAGAGGGGGCTCTTGG + Intergenic
1057454914 9:95199343-95199365 AAGGAGGCAGAGAGGGCTGTGGG - Intronic
1186032635 X:5386555-5386577 ACGTCTACAGAGAGGACTCTGGG + Intergenic
1186068821 X:5795477-5795499 AACTATGCAGAGAGGGAAATAGG - Intergenic
1187033534 X:15513296-15513318 AAGTTTGCAGGGAGGCTTCTGGG - Intronic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1198036979 X:132810557-132810579 AAGGATGTAGAGAGGTCACTGGG - Intronic