ID: 1179109457

View in Genome Browser
Species Human (GRCh38)
Location 21:38433899-38433921
Sequence CAGAGGATTAGGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2141
Summary {0: 1, 1: 0, 2: 8, 3: 148, 4: 1984}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179109457_1179109462 -5 Left 1179109457 21:38433899-38433921 CCATCCTCCTTCCTAATCCTCTG 0: 1
1: 0
2: 8
3: 148
4: 1984
Right 1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179109457 Original CRISPR CAGAGGATTAGGAAGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr