ID: 1179109457 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:38433899-38433921 |
| Sequence | CAGAGGATTAGGAAGGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2141 | |||
| Summary | {0: 1, 1: 0, 2: 8, 3: 148, 4: 1984} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179109457_1179109462 | -5 | Left | 1179109457 | 21:38433899-38433921 | CCATCCTCCTTCCTAATCCTCTG | 0: 1 1: 0 2: 8 3: 148 4: 1984 |
||
| Right | 1179109462 | 21:38433917-38433939 | CTCTGAATTCCTCTTGCACCTGG | 0: 1 1: 0 2: 1 3: 26 4: 179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179109457 | Original CRISPR | CAGAGGATTAGGAAGGAGGA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||