ID: 1179109462

View in Genome Browser
Species Human (GRCh38)
Location 21:38433917-38433939
Sequence CTCTGAATTCCTCTTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179109455_1179109462 25 Left 1179109455 21:38433869-38433891 CCTGTCGAAAATCTACCTATTCT 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 179
1179109458_1179109462 -9 Left 1179109458 21:38433903-38433925 CCTCCTTCCTAATCCTCTGAATT 0: 1
1: 0
2: 1
3: 34
4: 505
Right 1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 179
1179109456_1179109462 10 Left 1179109456 21:38433884-38433906 CCTATTCTTCTAGAGCCATCCTC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 179
1179109457_1179109462 -5 Left 1179109457 21:38433899-38433921 CCATCCTCCTTCCTAATCCTCTG 0: 1
1: 0
2: 8
3: 148
4: 1984
Right 1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179109462 Original CRISPR CTCTGAATTCCTCTTGCACC TGG Intronic
901718561 1:11176574-11176596 CTCTGAATTCCCCTGGCGCCAGG + Intronic
902738583 1:18418194-18418216 TTATGAATTCCCATTGCACCAGG + Intergenic
902881244 1:19373187-19373209 CTCTGAAGTCCACTAGCTCCTGG - Intronic
903301380 1:22380775-22380797 CTCTGAATGCCTCATCCCCCAGG + Intergenic
905206940 1:36348268-36348290 CTCTGGCTTCCCCTTGAACCAGG + Intronic
908123051 1:61003941-61003963 TTCTGTATTCCTCTAACACCCGG + Intronic
911143671 1:94532321-94532343 CTCTGAATTCCCCTTTCTCCTGG + Exonic
913458725 1:119060940-119060962 CCCTGAATTCCACATGCACGGGG + Intronic
915952508 1:160198879-160198901 CTCTGCACTCCTGTTTCACCTGG + Intronic
919022800 1:192129919-192129941 CTCTGAACTTCAGTTGCACCTGG - Intergenic
919919072 1:202157676-202157698 CTCTGAAGTTCTCTAGCCCCAGG + Intronic
921309143 1:213825466-213825488 CTCAGTATCCCTCTAGCACCGGG - Intergenic
924539599 1:244969711-244969733 CTCTGGTTTCCTCTTGCGCCCGG + Exonic
1062793609 10:325516-325538 CACTGATTTCCTCTTGCCCGGGG + Intronic
1065608822 10:27449710-27449732 CTCTGAATTCCCATTGCCCATGG - Intergenic
1066246730 10:33591204-33591226 TTCTGAATTCTTTTTGCTCCAGG + Intergenic
1067146668 10:43699196-43699218 CTCTGACTCCCTCTTCCCCCAGG + Intergenic
1067797577 10:49331943-49331965 CTCTGAGTTCTTCTTGCCCCAGG - Intergenic
1076335030 10:129701192-129701214 CTCTGAGTTCCTCTGGAATCTGG - Intronic
1076542316 10:131221989-131222011 CTCTAAATTCCTATTCCTCCAGG + Intronic
1077055858 11:592725-592747 CTCTGCATCCCTCCTGCGCCTGG - Intronic
1077443830 11:2581103-2581125 CTCTGGAGCCCTCTTGCTCCAGG + Intronic
1077716665 11:4587931-4587953 CTTAGAATTCCTGTAGCACCAGG - Intergenic
1078438011 11:11341316-11341338 ATCTGAATTCTCCTTGCACTTGG + Intronic
1078515574 11:12019204-12019226 CTCTGCATTCCTCCTGGCCCAGG + Intergenic
1078921645 11:15836310-15836332 CTCTGAGTTCCTGCTGCCCCAGG + Intergenic
1079674702 11:23211768-23211790 CTCTGAATTATGCTTGCACTTGG + Intergenic
1079717305 11:23764544-23764566 CTCTCAATTTCTCCTGGACCTGG + Intergenic
1079851558 11:25542071-25542093 CTCTGGATTCCTCTTGGATTTGG - Intergenic
1080122085 11:28689975-28689997 CTCTGACTTCTTCTTTCTCCTGG - Intergenic
1080376309 11:31716862-31716884 CTCTGAATTCTTACTGCACTTGG - Intronic
1080671564 11:34384111-34384133 CTCTGACTTCCTCTTGGGCCTGG + Intergenic
1081018978 11:37919561-37919583 ATGTGAATTCCTCTTCCCCCAGG + Intergenic
1081429990 11:42966371-42966393 CTCTGAAGTCCTCCTGCCCCTGG - Intergenic
1084498191 11:69517688-69517710 CCCTGATGTCTTCTTGCACCTGG + Intergenic
1087144249 11:94796517-94796539 CTCTCAATATCTCTTGCCCCTGG - Intronic
1087909179 11:103733285-103733307 CTCGGAATTCCTATTGTACTTGG - Intergenic
1087949528 11:104203508-104203530 CTCTGAATTCCTCTTTCACACGG - Intergenic
1088125793 11:106422068-106422090 CTCTGAATTCCAGATGAACCAGG - Intergenic
1088741518 11:112771247-112771269 CTCTGAGTTCCTTTTACCCCTGG - Intergenic
1088975408 11:114812130-114812152 CTTTAAATTCCTCCTGCCCCAGG + Intergenic
1090031862 11:123213235-123213257 CTCTGAATTTTTTTTGCACTGGG + Intergenic
1090873108 11:130765356-130765378 TTCTGCATTCCCCTTTCACCTGG - Intergenic
1091178689 11:133583722-133583744 CTCCCAATTCCTCTTTCTCCTGG - Intergenic
1091220851 11:133929360-133929382 CTCTGGATTCCTCTGGAGCCTGG - Intronic
1095752514 12:45728478-45728500 CTCTTAATTCATCTTGCCGCTGG - Intergenic
1097246199 12:57609107-57609129 CTCTCAGCTCCTCTTGCACCCGG - Exonic
1100192727 12:92209862-92209884 CTCTGCATTTCTCTGGCTCCAGG + Intergenic
1100452889 12:94724523-94724545 CTCAGATTTCCTGTTTCACCTGG + Intergenic
1102232537 12:111273468-111273490 TTTTAAATTCCTCTTGCAACTGG - Intronic
1102338904 12:112106551-112106573 CTCTGATTTCCTATTTCCCCGGG - Intronic
1102763700 12:115412527-115412549 CTCTGTATACCTCTTGCTCCTGG - Intergenic
1103328712 12:120138823-120138845 CTCTGAATCCCTCGTGCCCACGG - Exonic
1104211662 12:126694525-126694547 CACTGAATTCTTCTTGCTCTTGG - Intergenic
1104948666 12:132428861-132428883 CTCTGAATCCCTCCTGGGCCTGG - Intergenic
1104981094 12:132573430-132573452 CTCTGAATTCCTCAACCACGGGG - Intronic
1105908167 13:24834715-24834737 CACTGAATCCCTGTGGCACCAGG - Intronic
1106256279 13:28024917-28024939 ATCTGAACTTCTCTTGAACCAGG + Exonic
1106490636 13:30218240-30218262 CTCTGACTTCCTATTACATCAGG - Intronic
1108131085 13:47300970-47300992 GTCAGACTACCTCTTGCACCAGG - Intergenic
1110134051 13:72043476-72043498 CTCAGAATTCCTCTTGGGCTAGG + Intergenic
1110440422 13:75520127-75520149 CTCTCTCTTCCTCTTGCACCTGG + Intergenic
1112615359 13:100999163-100999185 CTCTGAATTCATCATTCACATGG + Intergenic
1119919794 14:78435980-78436002 CTCTGAATTCCAATTGCTCTGGG - Intronic
1125359331 15:38849112-38849134 CTCTGTATTCCTCTTGCTCATGG - Intergenic
1127723851 15:61728419-61728441 CTCTGAATGCCTACTGCTCCGGG + Intergenic
1129508264 15:76101236-76101258 CTCTGAAGCTCTTTTGCACCAGG - Intronic
1130290941 15:82600431-82600453 CTCTGAATTTCTCTTCCATGTGG - Intronic
1130422156 15:83758276-83758298 CTCTTCCTTCCTCTTCCACCAGG - Intronic
1131377461 15:91937392-91937414 CTCAGAAATCCCCTTGCACCTGG - Intronic
1131457901 15:92597567-92597589 CTTTGAATACTTCTTGCAGCAGG - Intergenic
1139603527 16:68001469-68001491 CATTGAGTTCCTCTTGCAGCTGG + Intronic
1140353530 16:74285251-74285273 CTCTCTCTTCCTCTTGCTCCTGG - Intergenic
1140626120 16:76796302-76796324 CTTTGAATTCTTCCTGCAACAGG + Intergenic
1140738764 16:77923067-77923089 CTCTCAATTCCTCCTTCAGCAGG + Intronic
1143684772 17:8504919-8504941 CTCTGAGTGCCTCTTGCGCCTGG - Intronic
1144575752 17:16428373-16428395 CTTTGAAATCCTCTTGTACGTGG + Exonic
1154122953 18:11666347-11666369 CCCTGAATCCCTCCTGCGCCTGG + Intergenic
1154154234 18:11931196-11931218 CTCTGAATTTCTCCTGCCCAAGG - Intergenic
1157240306 18:46003240-46003262 CCCTGACTTCCACCTGCACCGGG - Intronic
1158401276 18:57123388-57123410 CTCTTTATGCCTCTGGCACCTGG + Intergenic
1159896833 18:74005326-74005348 CTCTGCCTTCCTCTGGCATCTGG + Intergenic
1163784556 19:19268069-19268091 TTCTTTGTTCCTCTTGCACCTGG + Exonic
1166916025 19:46196594-46196616 CTCTGAACTCCTCCAACACCAGG + Intergenic
1167014909 19:46834837-46834859 CCCTCAATTCCCCTAGCACCTGG - Intergenic
927808663 2:26169961-26169983 CTGGCAATTCCTCTTCCACCAGG - Intergenic
927963599 2:27255849-27255871 CTCTGATTGCTTCTTGCATCTGG + Intronic
931702372 2:64919303-64919325 CTCTGAGTTCCTCAGGCACTAGG + Intergenic
932475996 2:72006277-72006299 CTCTGAATTCCTCTGGCCCTTGG - Intergenic
932506717 2:72240537-72240559 CTCTGAAGTTCTCTTGAGCCCGG + Intronic
932545033 2:72699747-72699769 CCCTCAAATCCTCTGGCACCAGG + Intronic
932633532 2:73367910-73367932 TTTTGTATTCCTCATGCACCTGG + Intergenic
935268917 2:101416855-101416877 CTCTGAATGCTGCTTCCACCAGG - Intronic
935316915 2:101843980-101844002 CTCTGAGTTCCTCTGACTCCAGG - Intronic
935484996 2:103642280-103642302 CTCTTACTTCCTCTTCCACCAGG + Intergenic
936228946 2:110682515-110682537 CTCTGAATACCCCTAGCACAGGG - Intergenic
938962238 2:136354297-136354319 CTCTGAATCCTTCTACCACCCGG + Intergenic
940601226 2:155863553-155863575 CTCCTATTTCCTCTTGCCCCTGG + Intergenic
943912791 2:193590320-193590342 CTATGAGTTCCTGTTGCATCTGG - Intergenic
943958752 2:194231121-194231143 CTCTGCATCCTTCTTGCACCTGG + Intergenic
944739719 2:202600037-202600059 CTATGAAAACCTCTGGCACCAGG + Intergenic
944754804 2:202750167-202750189 CTCTGGTGTCCTCTTGGACCGGG + Intronic
945010896 2:205462492-205462514 CTCTGAATTCCTCAGACACGTGG - Intronic
947349390 2:229226647-229226669 CTCTGATTTCCTCGTACACTTGG - Intronic
947955079 2:234182680-234182702 CTGTGTATTCCTCTTGCCCTTGG + Intergenic
947987786 2:234463697-234463719 GTCTGACTTCCCCTTGCTCCTGG + Intergenic
1169783392 20:9332894-9332916 CTGGGAATTCCTATTGAACCAGG - Intronic
1171136531 20:22699871-22699893 TTCTGAATTCCTCTGGCAAGGGG - Intergenic
1173173505 20:40746311-40746333 CTCTGATTTCCTCTGGGAGCTGG + Intergenic
1173707823 20:45125369-45125391 CTCAGAATTTCTCTCTCACCAGG - Intergenic
1174927643 20:54778094-54778116 CTATGAATTCCTCTGTCACCAGG - Intergenic
1176371211 21:6062220-6062242 CTCTGCCTTCCTCCTGCTCCTGG + Intergenic
1178357750 21:31922912-31922934 CACTGACTTCATCCTGCACCCGG + Intronic
1179109462 21:38433917-38433939 CTCTGAATTCCTCTTGCACCTGG + Intronic
1179752308 21:43476321-43476343 CTCTGCCTTCCTCCTGCTCCTGG - Intergenic
1182910229 22:33978068-33978090 CTCTGAGTCCCTCTTGTGCCAGG + Intergenic
1183242674 22:36669543-36669565 CTCTGAACTCCTGATGCACTTGG + Intronic
1183520852 22:38295318-38295340 TTCTCACTTCCTCCTGCACCAGG - Intronic
949522117 3:4867201-4867223 CTCTGAACTCCTGTAGCAACAGG + Intronic
949847498 3:8386644-8386666 CTCTTAATTCTCCTAGCACCGGG - Intergenic
951108355 3:18771715-18771737 CTCTGAATTCATCCTGCATCTGG + Intergenic
952196172 3:31077595-31077617 ATCTGCCTTCCTTTTGCACCTGG + Intergenic
952721538 3:36538917-36538939 CTCTCAATGCCTCTTTCTCCAGG + Intronic
953879195 3:46682970-46682992 CTCTTAAGTCCTCTTGGACTGGG - Intronic
955396771 3:58563169-58563191 CTCTGAATCCCTAGTGCACAAGG - Intergenic
957394828 3:79623008-79623030 ATCTGATTCGCTCTTGCACCTGG - Intronic
957530990 3:81440660-81440682 CTTTCAATTCCTCTTTCTCCAGG - Intergenic
960875986 3:122295794-122295816 CTCTAAATTCCTATTGCCCTGGG + Intergenic
966198639 3:177338766-177338788 CTCTGAATTTCCCTTCCCCCAGG - Intergenic
966421695 3:179740336-179740358 CCAGGAATTCTTCTTGCACCTGG + Exonic
966990946 3:185229482-185229504 AGCTGGGTTCCTCTTGCACCAGG + Exonic
967824238 3:193866036-193866058 CTCAGAATGCCTCTAGCACCTGG + Intergenic
969462178 4:7334610-7334632 CTCTGAATCCCTGTTGCTGCAGG - Intronic
974335118 4:60533504-60533526 CTCTGAATACCTATTGCATCTGG + Intergenic
976456846 4:85257573-85257595 CTTTGAATTTCTCTAGTACCAGG + Intergenic
977119103 4:93074121-93074143 CTTTGGATTCCTCTAGCAGCAGG - Intronic
977591472 4:98832170-98832192 CTCTGAAGGCCTCTGGCAACAGG + Intergenic
979011287 4:115373030-115373052 CTATGAATTCCTCCTTCCCCTGG - Intergenic
979576199 4:122294457-122294479 TTCTGAGTTCCTCCTGCACCAGG - Intronic
979628321 4:122871687-122871709 ATCTGATTTGCTCCTGCACCTGG - Intronic
980644129 4:135619836-135619858 CACTGAATTCCTCTTTCTCGAGG + Intergenic
982226045 4:153167644-153167666 CTCTTAATTCCCTTTGCCCCTGG + Intronic
982313685 4:154010370-154010392 CTCTAAGTTCCTCTTGCAAATGG + Intergenic
986124137 5:4869703-4869725 CTCTGAAACCCTCATGGACCTGG + Intergenic
988665372 5:33321451-33321473 CTCTTCATTCCTCTGCCACCTGG - Intergenic
988844506 5:35114697-35114719 CTCTGAGTCCCTCTTGCCTCAGG + Intronic
989814583 5:45720927-45720949 CTCAGACTTTCTCTTGCTCCTGG - Intergenic
991206027 5:64051245-64051267 CTCTGCATTCCGCTGGCACCTGG + Intergenic
993031403 5:82710140-82710162 CTCTTAATTCCTCTTTCATTAGG - Intergenic
994115164 5:96053493-96053515 CTTTCTATTCATCTTGCACCAGG - Intergenic
996005930 5:118420385-118420407 TCCTGGGTTCCTCTTGCACCTGG - Intergenic
996611508 5:125386239-125386261 CTCTCATTTCCTATTTCACCTGG + Intergenic
996900671 5:128538563-128538585 CGCTCATTTCCTCTCGCACCCGG - Intronic
1001383804 5:171321528-171321550 CTCTGCGTTCCTCTTGCTTCTGG - Intergenic
1001445124 5:171776914-171776936 CTGAGAATTCCTCAGGCACCTGG - Intergenic
1001906530 5:175478372-175478394 CTTGGAGTTCCTCTTGGACCCGG + Intronic
1003307256 6:4940789-4940811 CTCCCAAATCCTCTTGCCCCTGG - Intronic
1006417365 6:33912660-33912682 CTCTGAGTTCCTGTGGCTCCTGG + Intergenic
1006916733 6:37599577-37599599 CTCTGAACTCCTGTAGCACTCGG - Intergenic
1007190954 6:40017969-40017991 CTCTGAAGTCCTCTGGCAGATGG - Intergenic
1007603143 6:43096417-43096439 TTCTGAGTTCCTCTGGAACCTGG + Intronic
1008604481 6:53127190-53127212 CACTGACTTCCCCTTGCACAGGG - Exonic
1010331391 6:74627147-74627169 ATCTGATTTGCTCCTGCACCTGG - Intergenic
1011434239 6:87320706-87320728 CTTTGAATTCATCTTTGACCTGG - Intronic
1012858723 6:104533510-104533532 CTCAGCACTCCTCATGCACCAGG + Intergenic
1013810530 6:114039848-114039870 CTCAAGATTTCTCTTGCACCTGG + Intergenic
1015137838 6:129893651-129893673 CTCTACATTCTTCTTGCAACAGG + Intergenic
1015739931 6:136442878-136442900 CTTTGGATTCCTCTAGCACCTGG + Intronic
1017715447 6:157207777-157207799 CTCGGAATTCCTTTTGCACGAGG + Exonic
1021420928 7:20443804-20443826 CTCTCAATTCCTCCAGCAGCTGG + Intergenic
1026557427 7:71420625-71420647 TTCTGAACTCCTCTTGCTCCAGG + Intronic
1031804683 7:126293189-126293211 ATCTGATTTACTCCTGCACCTGG - Intergenic
1032057013 7:128691726-128691748 CCCTGAGTTCTTCTTGTACCAGG + Intergenic
1034069315 7:148167624-148167646 CTCTGAATTACTCTGGCTCACGG - Intronic
1036391247 8:8326002-8326024 CACTGAATTCCTCTTGTCCATGG - Intronic
1037837929 8:22225147-22225169 CTCTGGAGGCCTCTTGCTCCTGG - Intronic
1037932343 8:22889067-22889089 CTCTGCATTCCCATAGCACCAGG + Intronic
1038389580 8:27182829-27182851 CTGTCAATTACTCTTGTACCAGG - Intergenic
1039465665 8:37783620-37783642 CCCTGAATTCCTCTTGCTCATGG - Intergenic
1039816909 8:41102275-41102297 CTCTGAATTCTTCATGAACAGGG - Intergenic
1042962553 8:74320272-74320294 CTCTGAACTCCACCTGCATCAGG + Intronic
1043012676 8:74900537-74900559 ATCTGAATACCTCCTGCACAGGG - Intergenic
1043796754 8:84551902-84551924 CTCTGAATGCCTATTGCAAAGGG + Intronic
1046516225 8:115265115-115265137 GTCTGAATTTCTGTTGCACTAGG - Intergenic
1046604276 8:116353574-116353596 CTCTGCATTCCTATCTCACCTGG + Intergenic
1046862085 8:119105012-119105034 CTCAGTCTTCCTCTTGTACCTGG + Intronic
1048966017 8:139615084-139615106 CTCTTCCTCCCTCTTGCACCTGG - Intronic
1050110930 9:2215053-2215075 CTCTGAAATCCTCTTTCCCAAGG - Intergenic
1056270695 9:84945578-84945600 CTTTGCATCCCTCTTGCACAGGG - Intronic
1058535708 9:105957954-105957976 CTCTTGCTTCCTCTTTCACCAGG - Intergenic
1059174520 9:112156896-112156918 CTCTGAATTGAGCTTGAACCTGG + Intronic
1059351529 9:113668837-113668859 CTCTGAATGCCCCTGGCACATGG + Intergenic
1059725057 9:116999939-116999961 CTCTAAATTCCTCCTTCAGCTGG + Intronic
1060210490 9:121707177-121707199 CTCTAAATGCCTCTGGCACAGGG - Intronic
1061951801 9:133940357-133940379 CTCTGAACTGCTCTTGGAGCTGG - Intronic
1061989308 9:134149609-134149631 CTCAGAATTACTCATGGACCTGG + Intronic
1186038430 X:5449414-5449436 CTATTAAATCCTCATGCACCAGG - Intergenic
1193703107 X:84787949-84787971 CTGTGAATTCCTCTGGCCCTTGG + Intergenic
1195959259 X:110368835-110368857 CTTGGAATTCCTATTGCACTTGG - Intronic
1195959564 X:110371586-110371608 CTCTGAATTCTTCTTGGATATGG + Intronic
1197995451 X:132367761-132367783 CTCTCAAATCCTCTTGCTCAAGG + Intergenic
1198286588 X:135197230-135197252 CTCTTTATTCCTCTGGCATCAGG + Intergenic
1198699789 X:139384108-139384130 ATTTGAATTTCTCTTGCACTTGG + Intergenic
1198757306 X:139995237-139995259 CTTTGGATTCCTCGTGCCCCAGG + Intergenic
1199850804 X:151723853-151723875 CTCTGCAGGCCTCCTGCACCAGG - Intergenic
1200031184 X:153297136-153297158 CACTGGATTTCTCTTGCACCAGG + Intergenic
1200870085 Y:8088490-8088512 CTATTAATTACTCTTGTACCTGG - Intergenic