ID: 1179113526

View in Genome Browser
Species Human (GRCh38)
Location 21:38468338-38468360
Sequence CTGAATATAGAGAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179113522_1179113526 29 Left 1179113522 21:38468286-38468308 CCTGGTAAACTATTCCGTAGCTC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG 0: 1
1: 0
2: 3
3: 31
4: 327
1179113523_1179113526 15 Left 1179113523 21:38468300-38468322 CCGTAGCTCTGTGCAATAGAAAA 0: 1
1: 0
2: 1
3: 27
4: 213
Right 1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG 0: 1
1: 0
2: 3
3: 31
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179113526 Original CRISPR CTGAATATAGAGAGGGAAAT TGG Intronic
900701211 1:4049684-4049706 ATGAGGAGAGAGAGGGAAATAGG + Intergenic
902496401 1:16874873-16874895 CAGAATGGAGAGGGGGAAATGGG - Intronic
903746825 1:25592706-25592728 CTGGATATAGAGCGGTAAACAGG - Intergenic
903965281 1:27084838-27084860 ATGAATCTAGAAAGGGAAATAGG - Intergenic
904588787 1:31595859-31595881 CTGAATACAGAATGGGAAAGTGG - Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG + Intergenic
905436203 1:37957015-37957037 CTGAGTGTTGAGAGGCAAATGGG + Exonic
907015401 1:51007228-51007250 CTAAATATAGAAAGGAAAAATGG + Intergenic
907911564 1:58831828-58831850 CTCATTATAGAGAGAAAAATAGG + Intergenic
907944581 1:59123594-59123616 CTGAAGAAAGTGAGGGGAATTGG + Intergenic
908769960 1:67586984-67587006 CTGAAGTTAGAGAGAGAAATGGG - Intergenic
908787870 1:67753133-67753155 CTGAATATAGAGTGGGTGTTTGG + Intronic
908853861 1:68400947-68400969 CTAAATATTGAGAAGGATATAGG + Intergenic
908883955 1:68766258-68766280 CTGAATATTTAGAGGGCTATAGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909091534 1:71232187-71232209 CTGAAGAAAGAGAAGAAAATGGG - Intergenic
909911589 1:81264953-81264975 TTTAATATAGAAAGTGAAATCGG - Intergenic
911839862 1:102667591-102667613 CTGAATATCAGGAGGGAAATAGG - Intergenic
912045399 1:105447843-105447865 CTGAATATGGAAAGGAAAAGTGG - Intergenic
912891380 1:113535771-113535793 CTGAATTTAGGGCTGGAAATTGG - Intronic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
915168129 1:153959922-153959944 CTGACTAATGAGAGGGAAGTGGG - Exonic
916673769 1:167048316-167048338 CTCAAAATAGGGAGGGAAAAGGG + Intergenic
916948121 1:169749780-169749802 CTGAGTAGAGGGAGGGAGATGGG + Intronic
918699884 1:187595577-187595599 CAGAAAAGAGAGAGAGAAATAGG - Intergenic
919055027 1:192559877-192559899 CTGAAGAGAGAGAGAGAGATGGG + Intergenic
920674300 1:208028764-208028786 ATGACTATAGAGCGGGGAATGGG + Intronic
920705326 1:208246368-208246390 CTGAATAAAGGGAGAGAAAGAGG + Intergenic
920919866 1:210289757-210289779 CTGACCATAGAAAAGGAAATGGG - Intergenic
921082513 1:211754139-211754161 CTTACTCTGGAGAGGGAAATAGG - Intronic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
923294116 1:232576482-232576504 CTGAGGAGAGAGAGAGAAATGGG - Intergenic
923892946 1:238235809-238235831 CTGAAGATGGAGAGGTCAATGGG + Intergenic
924045028 1:240020222-240020244 CTGGATATAGTGGGGGAAAGGGG - Intronic
924150064 1:241120750-241120772 CTCTAGATAGAGAGGAAAATAGG + Intronic
924265384 1:242276535-242276557 CTTAAGAGAGAGAGGGGAATTGG + Intronic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1066218660 10:33314082-33314104 CTGAAAATAGAGAGAGAGAGAGG - Intronic
1066719440 10:38321941-38321963 CTTAAGAGAGAGAGGGGAATTGG - Intergenic
1068440307 10:57046152-57046174 CTGAATATAGAAATGGGAGTTGG - Intergenic
1068599017 10:58936065-58936087 GTGAAGATAGACATGGAAATAGG + Intergenic
1068785441 10:60967653-60967675 ATGAATAAAGAGAGGGTAAGAGG + Intronic
1069024722 10:63527339-63527361 CTAAAGAGACAGAGGGAAATGGG - Intronic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1069254006 10:66309727-66309749 CCTTATATAGATAGGGAAATAGG + Intronic
1069423286 10:68266531-68266553 CTGAATTTAGTGGGGGAAAGTGG + Intergenic
1071971175 10:90908694-90908716 CTGAAGAGAGGGAAGGAAATGGG - Intergenic
1072351968 10:94565855-94565877 CTGCATACAGAGAGAGATATAGG + Intronic
1075316528 10:121457901-121457923 CTGAAACCAGAGAGGGAAACTGG + Intergenic
1077786362 11:5388593-5388615 GTGAATATACAGAGGAAATTAGG + Intronic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079370754 11:19849950-19849972 AAGAGTATGGAGAGGGAAATGGG - Intronic
1080490222 11:32754356-32754378 CTCAGTACAGAGAGGCAAATAGG + Intronic
1080501855 11:32878847-32878869 ATCAATATAGAGGGTGAAATAGG - Intergenic
1081206068 11:40277050-40277072 CTGTATATAGAACAGGAAATTGG - Intronic
1084728660 11:71059257-71059279 CTGAAAATCTAGAAGGAAATAGG + Intronic
1086692550 11:89804743-89804765 CTGAACATAGATCTGGAAATTGG + Intronic
1086713250 11:90034916-90034938 CTGAACATAGATCTGGAAATTGG - Intronic
1087195713 11:95302533-95302555 ATGGATTTGGAGAGGGAAATTGG + Intergenic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087695693 11:101373264-101373286 CTGATTTCAGAGAGGGGAATGGG + Intergenic
1087856907 11:103103274-103103296 CTGAAAATATACAGGGAAAGAGG - Intergenic
1087940963 11:104096493-104096515 CTGAATGAAGAAAGGGAATTTGG - Intronic
1089278083 11:117353110-117353132 CTGAAGAGAGGGAGGGACATAGG + Intronic
1089415254 11:118283773-118283795 CTGAGAATAGAGAGAGAGATGGG - Intergenic
1090078799 11:123596767-123596789 CTGAGTGTTGAGAGGCAAATGGG + Intronic
1090459636 11:126879145-126879167 CTAAATGTAAAGAGGGAAACTGG + Intronic
1090919834 11:131197957-131197979 CTGGATGAAGAGAGAGAAATAGG + Intergenic
1091055391 11:132413451-132413473 ATGAGTATAGAGATGGAAAAAGG + Intergenic
1092855448 12:12669019-12669041 CTGAATTCAGAGAGTCAAATTGG + Intronic
1095555438 12:43498416-43498438 CCAAATATAAAGGGGGAAATAGG - Intronic
1095858097 12:46884233-46884255 ATGAATTTAGAGAGGGAGGTAGG - Intergenic
1096889993 12:54760171-54760193 CTGGAGATAAAGAGGGAAAGTGG - Intergenic
1097362608 12:58674556-58674578 CTAAACATAGAGAGGGAGTTGGG - Intronic
1097366602 12:58721285-58721307 ATGAATAAAGAGCGGGAAAATGG - Intronic
1098428081 12:70389098-70389120 AAGAATAAAGAGAGGAAAATGGG - Intronic
1098763224 12:74451393-74451415 GTGAATTTAGAAGGGGAAATTGG - Intergenic
1101392721 12:104317111-104317133 CTTAAGAGAGAGAGGGATATAGG + Intronic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1101422982 12:104564600-104564622 CTTAATATTGGGAGGGAACTAGG - Intronic
1102856318 12:116297555-116297577 GTGAATGAAGACAGGGAAATAGG + Intergenic
1104367129 12:128187894-128187916 CTGAAAAGTGAGAGGAAAATAGG - Intergenic
1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG + Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1106674129 13:31939768-31939790 GTGTCTTTAGAGAGGGAAATGGG + Intergenic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106981668 13:35291454-35291476 CTGGCTATAAAGAGGAAAATGGG - Intronic
1107657960 13:42611090-42611112 ATGAATAGAGAAAAGGAAATAGG - Intergenic
1109600293 13:64618108-64618130 CTGAAAATAACTAGGGAAATTGG + Intergenic
1110950228 13:81477952-81477974 TATAATATAGAAAGGGAAATAGG + Intergenic
1111733740 13:92110565-92110587 CAGAATTTAAAGAGGAAAATTGG + Intronic
1112531069 13:100203917-100203939 CTGAATATAGTGATGTCAATAGG - Intronic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115015253 14:28603569-28603591 CTAAATATAGATAAGGAGATAGG + Intergenic
1116071318 14:40049121-40049143 CTTGAGATAGAGAGGGAAAGGGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116603215 14:46954844-46954866 GTGAATACAGAGAGGGTAAAAGG - Intronic
1118949806 14:70425841-70425863 CTAAATTTAGAGAGGGAAAGAGG + Intergenic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1120587082 14:86325586-86325608 CTGCATATGTAGAGAGAAATAGG + Intergenic
1120795889 14:88632491-88632513 ATGAATGTAGAGAGGGATAGTGG - Intronic
1120812524 14:88818861-88818883 CTGAATATGGGGAGGGCATTTGG - Intergenic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1124030922 15:26011000-26011022 TTGGAGATAGATAGGGAAATTGG - Intergenic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1126969719 15:54096821-54096843 ATACATATAGAGAGAGAAATAGG - Intronic
1128209227 15:65882168-65882190 GTGAATATAGAAAGGAAAAGTGG - Intronic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1130033516 15:80337114-80337136 CTGAATATAAAGTTGGGAATGGG + Intergenic
1131851191 15:96545111-96545133 CTGAATTTGGAGAGAGAATTTGG + Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1134515157 16:14881200-14881222 CTGAATATATGGAGTGAAAGAGG + Intronic
1135763950 16:25160798-25160820 CTGAATAGAGAAAAGAAAATGGG - Intronic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1139742012 16:69043557-69043579 GTGAATAAAGAAAAGGAAATGGG + Intronic
1140109794 16:71994262-71994284 TTGAGTAGAGAGAGGGAAGTGGG - Intronic
1140125504 16:72114667-72114689 AGGAATAGAGAGAGGGAAATGGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1141814382 16:86399836-86399858 CTGAATTGAGAGAAGAAAATGGG + Intergenic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1144004616 17:11088791-11088813 GTGAATATAGAGAGGGTTGTGGG - Intergenic
1144237287 17:13273936-13273958 CAGAATATAGGGAGGGAAGGAGG - Intergenic
1144931101 17:18859317-18859339 CTGCATACAGAGAGCAAAATAGG - Intronic
1148667617 17:49386615-49386637 AGGAATATAGAGAGGGGAGTGGG - Intronic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1152448648 17:80362046-80362068 CTGAATATTGAGAGGAGACTGGG - Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155759257 18:29544820-29544842 CTGAAGACAGAGAGGGGAAGAGG + Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157492442 18:48133800-48133822 ATGAATAGAGGGAGGGGAATCGG - Intronic
1158286132 18:55885380-55885402 CAGAAAATAGTGAAGGAAATGGG + Intergenic
1158728058 18:59992921-59992943 CTGTAAAATGAGAGGGAAATGGG - Intergenic
1159361430 18:67409173-67409195 GTGAATAGAGAGATGGAAACTGG + Intergenic
1159866911 18:73716475-73716497 GTGAATATTGGGAGGGACATAGG + Intergenic
1159958997 18:74541118-74541140 CTGAAAGTGGAGGGGGAAATGGG + Intronic
1160024354 18:75206086-75206108 CTGAGCATAGAGGGGGAGATGGG + Intronic
1160118934 18:76109597-76109619 CTGTATTTAGTGAGAGAAATAGG + Intergenic
1160484944 18:79282063-79282085 GTGAAAATAGGGAGGGAATTAGG + Intronic
1166639733 19:44485478-44485500 GTAAATATAAAGAGGAAAATGGG - Intronic
1202706663 1_KI270713v1_random:29396-29418 CAGAATGGAGAGGGGGAAATGGG + Intergenic
925761802 2:7191970-7191992 CTTATTATAGAGAGGAAAAGAGG - Intergenic
926425318 2:12734361-12734383 CTGAATAAAGTGAGGGGACTGGG + Intronic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927474378 2:23401299-23401321 CTGAATGGAGAGAGGGAAACCGG - Intronic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
928675928 2:33651265-33651287 TTGAATATAGAAAGGAAAAGTGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929054186 2:37861979-37862001 TTGAATAGACAGAGAGAAATGGG - Intergenic
930319442 2:49835797-49835819 CTCTACATAGAGAAGGAAATTGG - Intergenic
930532684 2:52609910-52609932 CTGTATATGGAGATGTAAATTGG - Intergenic
931015138 2:57968713-57968735 CTGAATAATGAGAAAGAAATTGG + Intronic
931116228 2:59169680-59169702 CTGAAAATAAAATGGGAAATAGG - Intergenic
931961504 2:67488129-67488151 CTGAAGATAGAGGCAGAAATTGG + Intergenic
932357199 2:71076621-71076643 CTGAAGATATAGCGGGAAAGGGG - Exonic
932549025 2:72747773-72747795 CTGAAAATTGAGAGGCAAATGGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938867487 2:135438170-135438192 CAGTATATAGAGAGAGATATAGG - Intronic
939232817 2:139452238-139452260 TTGTATATAGTGAGGGATATGGG + Intergenic
939819510 2:146938988-146939010 CTGCATAGAGAGGGGGAAATTGG - Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940717632 2:157245852-157245874 CTGAAAATAGGGTAGGAAATGGG - Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941504035 2:166318064-166318086 TTTAACATAGAGAGGGAAGTGGG - Intronic
941585514 2:167353207-167353229 CTGAATATATACAGGATAATTGG + Intergenic
942715951 2:178892383-178892405 GGGCATAGAGAGAGGGAAATGGG - Intronic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
944160884 2:196658129-196658151 TTGAAAATAGGGAGAGAAATTGG + Intronic
944608874 2:201379923-201379945 CTGAAAACAGAAAGGAAAATAGG + Exonic
945505641 2:210637148-210637170 CTAAATTTAGAGAGGGAGAGAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946345554 2:219107638-219107660 CTGAAGACAGAGAGAGAAGTGGG - Intronic
946448967 2:219763586-219763608 CTCAATGTAGAGAGGGCATTTGG + Intergenic
946564082 2:220943770-220943792 ATGACAATAGAGAGGAAAATTGG + Intergenic
948275250 2:236703452-236703474 CTCAAAATAGAGAGGGCACTGGG - Intergenic
948303301 2:236925458-236925480 CTGAAAATAGAGACTAAAATTGG + Intergenic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170066069 20:12311851-12311873 CTGAATATAGAGAAAGCAAATGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1173652540 20:44675989-44676011 CTGAATAAAAGGAGAGAAATAGG - Intergenic
1173966746 20:47118236-47118258 CTGAAAAGAGAGAGGGAAGGGGG - Intronic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175965622 20:62658739-62658761 CTGAATATCTACACGGAAATGGG + Exonic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178280464 21:31278050-31278072 CTGAAGATTGAGTGGGACATGGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180760231 22:18196789-18196811 CGGAATATGGAGGGGGAACTTGG + Intergenic
1180770543 22:18381087-18381109 CGGAATATGGAGGGGGAACTTGG + Intergenic
1180775437 22:18427907-18427929 CGGAATATGGAGGGGGAACTTGG - Intergenic
1180808507 22:18738962-18738984 CGGAATATGGAGGGGGAACTTGG - Intergenic
1180828486 22:18884045-18884067 CGGAATATGGAGGGGGAACTTGG + Intergenic
1181071436 22:20343926-20343948 CGGAATATGGAGGGGGAACTTGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182525544 22:30915584-30915606 TTGAATATAAAGGGGGAAAGTGG - Intergenic
1182854031 22:33501491-33501513 TTGAATATAGAGTGGGAGATGGG + Intronic
1183759628 22:39804502-39804524 CTGAGGTTAAAGAGGGAAATGGG - Intronic
1203232378 22_KI270731v1_random:122259-122281 CGGAATATGGAGGGGGAACTTGG + Intergenic
949175844 3:1061922-1061944 CTAAATATGGAAAGGAAAATTGG - Intergenic
950329213 3:12143031-12143053 CTGTAGGTAGAGAGGGTAATGGG + Intronic
952661458 3:35854616-35854638 CTGAATGAAGAGAGAGAAATAGG + Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953900535 3:46839115-46839137 ATGAAAATTGAGAGGGAAAATGG + Intergenic
956297776 3:67733146-67733168 CTGAGTATATTGAGGAAAATTGG + Intergenic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
958600128 3:96286878-96286900 ATGACTAAAGAGAGGCAAATTGG - Intergenic
959848859 3:111064811-111064833 CAGAACATAGAGAAGAAAATAGG - Intergenic
961062226 3:123839321-123839343 TTGAATATAAAGACAGAAATGGG + Intronic
961835401 3:129654119-129654141 CTGACCATAGCTAGGGAAATAGG - Intronic
962661546 3:137605950-137605972 TTAAACATAGAGAGTGAAATAGG - Intergenic
963249537 3:143090333-143090355 CCAAATATAGAGAAGGAAAGGGG - Intergenic
963255867 3:143144539-143144561 CTTAATCTACAAAGGGAAATTGG - Intergenic
963629093 3:147711298-147711320 CTAAATATAGAAAGGAAAAATGG - Intergenic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965548619 3:169940602-169940624 ATGAATAAAAAGAGGGAAAGAGG - Intergenic
965599779 3:170443179-170443201 CTGTATGTAGCTAGGGAAATTGG + Intronic
965776832 3:172240535-172240557 CTGTATATTGAGAAGTAAATAGG - Intronic
965828478 3:172754172-172754194 TTGAATATAGGAAGAGAAATTGG + Intronic
966959628 3:184921956-184921978 CAGAATATATAGAGGGATCTTGG - Intronic
967180703 3:186901189-186901211 CTTGATATTTAGAGGGAAATGGG - Intergenic
967549428 3:190773192-190773214 CCAAATCTAGGGAGGGAAATGGG - Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
967787676 3:193514936-193514958 CTGATTTTAGTGATGGAAATGGG + Intronic
968153595 3:196359328-196359350 CTGAATAGAGGGAGAGAGATGGG - Intronic
970326595 4:14931314-14931336 ATGAGTATGGAGAAGGAAATGGG - Intergenic
970591829 4:17566559-17566581 CTAAATCTAGAGGGAGAAATGGG - Intergenic
970592345 4:17570405-17570427 CTGCAGATAGAGAGGAAAAGGGG - Intergenic
971873707 4:32276487-32276509 CTGAACATTGAGAGGGGAAGAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972757590 4:42064340-42064362 CTCAAAATAGAGAAGAAAATAGG - Intronic
974160146 4:58128357-58128379 CTATATATAGAGAGAGAAATAGG - Intergenic
974700306 4:65435010-65435032 TTGCACATAGAGAGGGCAATGGG - Intronic
974703828 4:65486276-65486298 CTTCATATAGAGAGGGAAATGGG - Intronic
975090352 4:70394528-70394550 CTGATTACCGAGGGGGAAATTGG - Intergenic
976376917 4:84356044-84356066 CAAAAGCTAGAGAGGGAAATAGG + Intergenic
977540461 4:98312735-98312757 ATATATATAGAGAGAGAAATAGG + Intronic
978158607 4:105517934-105517956 GTGAATATAGTTTGGGAAATTGG - Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979287131 4:118938923-118938945 GTGAATATAGAGAGTAAAAAAGG - Intronic
979705491 4:123715042-123715064 CTGAATATGGAAGGGGAAACTGG + Intergenic
981088334 4:140706620-140706642 GTTAATGGAGAGAGGGAAATGGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982559538 4:156913569-156913591 CTCAAGAGAGGGAGGGAAATAGG - Intronic
984314689 4:178112966-178112988 CAGAATATAGGGAGGGAACTGGG + Intergenic
984594083 4:181647835-181647857 CTGAAGAGAGAGAGGGAAATAGG + Intergenic
986056808 5:4145965-4145987 ATCAATATATAGAAGGAAATGGG + Intergenic
986064958 5:4226540-4226562 ATGAAGAAAGAGATGGAAATAGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
987733259 5:21805181-21805203 GAGAAAGTAGAGAGGGAAATGGG - Intronic
988400678 5:30756035-30756057 CTGACTCTAGTGAGGGAAAAAGG + Intergenic
989270116 5:39522832-39522854 CTGAACATTGAGGGGGAAAGAGG - Intergenic
989949381 5:50279709-50279731 CTGAAAATAGAGTGTGAAAGAGG - Intergenic
990463127 5:56047836-56047858 CTGAATGTCGAGAGGAAAAGAGG + Intergenic
990522313 5:56591999-56592021 CTGAATAAAGAATGAGAAATCGG - Intronic
991032076 5:62092848-62092870 TTGACTATAGACAGGGAATTAGG + Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
993184509 5:84600428-84600450 CTGAATGAAGAGCTGGAAATGGG + Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998430761 5:142067964-142067986 CTGAATAGAGAGAGTAAACTTGG + Intergenic
1001094817 5:168767991-168768013 ATGCAGATACAGAGGGAAATGGG - Intronic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1004406580 6:15338688-15338710 CTGAAGCTAGATAGGGAAGTTGG - Intronic
1006535421 6:34695874-34695896 CTGAGGATAGATAGGGAAAAGGG - Intronic
1009224074 6:61007072-61007094 CATAATATCGAGAGGGAAAGAGG + Intergenic
1011876625 6:91970629-91970651 CCATATATAGAGAGGGAAAAGGG + Intergenic
1012067644 6:94568994-94569016 CTGAAAGTAGAGAGGTATATAGG + Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013127023 6:107193953-107193975 TTAAATAGAGAGAGGGAAAGGGG - Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1014002980 6:116385495-116385517 TTGGATATGGAGAGTGAAATAGG + Intronic
1014505956 6:122256488-122256510 CTGAATACAGAGAAGCAACTAGG + Intergenic
1014653262 6:124067911-124067933 CAAAATCTAGTGAGGGAAATGGG + Intronic
1015648290 6:135421043-135421065 CTGAAGAGAGGGAGAGAAATGGG + Intronic
1016299790 6:142617875-142617897 CAAAATGTAGAGAGGGAAGTAGG + Intergenic
1016951182 6:149581714-149581736 CTTAATATACAGAGAGATATCGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018879889 6:167867088-167867110 CTGAAGGTAAAGAGGGAACTGGG - Intronic
1019565546 7:1677129-1677151 ATGAATATAAATAGGAAAATGGG - Intergenic
1020338113 7:7080179-7080201 CTGATCATAGAGAAGGAAATGGG + Intergenic
1020396085 7:7720258-7720280 CTGAGAATAAAGGGGGAAATGGG + Intronic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021379122 7:19945504-19945526 TAGAATTTAGAGGGGGAAATAGG - Intergenic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1023130663 7:36999576-36999598 CAGAATAAAGAAAGAGAAATAGG + Intronic
1023149167 7:37183555-37183577 CAGAAGAGAGAGAGAGAAATAGG + Intronic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1026497164 7:70913200-70913222 CAGAACATAGAGAGAGGAATAGG - Intergenic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1027271314 7:76520661-76520683 CTGGATACTGAGAGGGGAATGGG - Intergenic
1027296309 7:76775577-76775599 CTGCAAATTGAGAGGGGAATGGG + Intergenic
1027321078 7:77010596-77010618 CTGGATACTGAGAGGGGAATGGG - Intergenic
1028111570 7:86948524-86948546 CTAAATATAAAAAGGGAAACAGG + Intronic
1029299802 7:99571665-99571687 CTGCTCATAGAGAAGGAAATGGG - Intronic
1029649389 7:101880482-101880504 CTGTATAAAGAGTGGGAACTGGG + Intronic
1030934333 7:115566113-115566135 TTGATTATAGCCAGGGAAATGGG - Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032103219 7:129000886-129000908 CTGAACCTAGAGTGGCAAATTGG - Intronic
1032209583 7:129901314-129901336 CTTGATAGAGAGAGGCAAATAGG - Intronic
1033488049 7:141811125-141811147 CTGAAAATAGAGTGGGAAGGTGG - Intergenic
1033772809 7:144572254-144572276 CTGAAAAATGAGAGAGAAATAGG - Intronic
1035906964 8:3522555-3522577 CTGAGAATAGAGAAAGAAATGGG + Intronic
1036579500 8:10060738-10060760 CAAAATTTAGAGAGTGAAATCGG + Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037796844 8:22002744-22002766 ATGAAAATAGATAAGGAAATGGG + Intronic
1039066684 8:33614688-33614710 CTGAATATTGGGAGTGATATGGG + Intergenic
1039915881 8:41859968-41859990 CTCACTAAAGAAAGGGAAATGGG + Intronic
1041120142 8:54578153-54578175 CTAATTATAGAGCGAGAAATGGG + Intergenic
1041301180 8:56413410-56413432 TTGAATATAGAAATGCAAATTGG + Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042683605 8:71413323-71413345 CTGAATATTGAGAGGGCAATTGG - Intronic
1042793348 8:72633255-72633277 TTGAAAATGGAGGGGGAAATGGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1046254690 8:111680707-111680729 CATAATATAGATAGGGAAGTTGG - Intergenic
1047730224 8:127721741-127721763 CTGAATATGTTGTGGGAAATGGG + Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1050760064 9:9058153-9058175 CAGAATATAAAGAGGGAATTAGG + Intronic
1051055915 9:12985558-12985580 CTGAATACAGAGGGGAAAATTGG - Intergenic
1052854054 9:33396077-33396099 CTGCATATAGAGAGAGGTATAGG + Intronic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1055518182 9:77054254-77054276 CTGACTCTAAAGAGGGAGATTGG - Intergenic
1056265711 9:84894858-84894880 CTCAATAGATAGAGGGAAATTGG + Intronic
1056937443 9:90927110-90927132 TTCAATCTAGATAGGGAAATTGG - Intergenic
1058033375 9:100224346-100224368 CTGAATAGGGAGAGATAAATAGG + Intronic
1058476128 9:105335040-105335062 CTGAATATACAAAGTTAAATGGG - Intronic
1059735231 9:117093735-117093757 TTGAATACAGAGAGTGAATTTGG - Intronic
1059888536 9:118774400-118774422 TTGAATAATGACAGGGAAATTGG + Intergenic
1059927791 9:119228806-119228828 CTGAAGCTAGAAAGGGAATTTGG + Intronic
1062111507 9:134784684-134784706 CTCAATTTAGAGAAGGTAATTGG + Intronic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1190148851 X:47923881-47923903 CTGGATATAGAGTGGAAGATAGG - Intronic
1193504790 X:82328894-82328916 CTATATATAGAGAGAGAGATAGG - Intergenic
1193702117 X:84776167-84776189 CTGAATATCTAGAGAGGAATGGG + Intergenic
1195318437 X:103701009-103701031 GTGAATAAAAAGAGGGCAATAGG + Intergenic
1195477915 X:105308164-105308186 ATGAATATGGAAAGGGAAAGGGG - Intronic
1195791471 X:108592358-108592380 CTGAATAGAGAGGGAAAAATTGG - Intronic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1196527849 X:116748312-116748334 CTGAAGAGAGAAAGGAAAATGGG - Intergenic
1196986223 X:121275116-121275138 CTAAATATAAAGAGAGAGATAGG - Intergenic
1197934766 X:131728952-131728974 CTGAAAAGAGACAGGGACATTGG + Intergenic
1199487358 X:148362669-148362691 TTGAATTTAAAGGGGGAAATTGG + Intergenic
1199578991 X:149342830-149342852 ATGAAAATGGAGAGGAAAATCGG + Intergenic
1199731668 X:150639260-150639282 CTTCATATAGGGAAGGAAATAGG - Intronic
1199943682 X:152648986-152649008 CTGAATGCAGAGACGGAAAGGGG - Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic