ID: 1179117491

View in Genome Browser
Species Human (GRCh38)
Location 21:38507443-38507465
Sequence CAGTGTCAGCACTGGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179117491_1179117500 -7 Left 1179117491 21:38507443-38507465 CCGGAGCCCCAGTGCTGACACTG 0: 1
1: 0
2: 1
3: 35
4: 289
Right 1179117500 21:38507459-38507481 GACACTGGGAGGGGAACCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 271
1179117491_1179117506 20 Left 1179117491 21:38507443-38507465 CCGGAGCCCCAGTGCTGACACTG 0: 1
1: 0
2: 1
3: 35
4: 289
Right 1179117506 21:38507486-38507508 CCTCATGACTGTGTCAGTGATGG 0: 1
1: 0
2: 1
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179117491 Original CRISPR CAGTGTCAGCACTGGGGCTC CGG (reversed) Intronic
900176279 1:1292750-1292772 CAGGGGCAGGGCTGGGGCTCAGG + Exonic
900269725 1:1780911-1780933 CAATGGCAGCCCTGGGGCTGAGG - Intergenic
900380135 1:2379875-2379897 CAGTCTCACCTCTGGGGCTGTGG + Intronic
900404191 1:2485360-2485382 CCCTGTCCCCACTGGGGCTCCGG - Intronic
900428900 1:2592774-2592796 CAGGGCCAGGGCTGGGGCTCCGG + Intronic
900469534 1:2846826-2846848 CAGTGTGAGCCATCGGGCTCGGG - Intergenic
900972249 1:5998162-5998184 CTGTGACCGCACTGGGCCTCTGG - Intronic
902774340 1:18664984-18665006 CAGAGTCAGGACTGGAGCTTGGG - Intronic
903223788 1:21883801-21883823 CACTGCCTGGACTGGGGCTCAGG - Intronic
905259191 1:36705674-36705696 CAGAGTTAGGACTGGGACTCAGG + Intergenic
905286031 1:36880916-36880938 AGGGGTCAGCACTGGGGCTGTGG + Intronic
905450902 1:38055509-38055531 GACTGTGAGCTCTGGGGCTCCGG + Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907330758 1:53669669-53669691 CAAAGGCAGCACTGGGGCTATGG - Intronic
907407093 1:54260348-54260370 CAGGGCGAGCAGTGGGGCTCTGG + Intronic
907936461 1:59046537-59046559 CAGTAGCAGGACTGAGGCTCAGG - Intergenic
908787626 1:67750691-67750713 CAGTGTTATAACTGGGGCTTAGG + Intronic
912797262 1:112700775-112700797 CAGGGTCAGCTTAGGGGCTCAGG - Intergenic
915073255 1:153289411-153289433 CCCTGTCAACAATGGGGCTCCGG + Intergenic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
916029576 1:160864044-160864066 CAGAGGCAGCAGCGGGGCTCTGG + Intergenic
917618593 1:176771503-176771525 AAGTGTCTGCACTGGGGACCAGG - Intronic
917968025 1:180190705-180190727 GAGAGTCAGCCTTGGGGCTCTGG + Intronic
919061755 1:192642606-192642628 TAGGCTCAGCACTGTGGCTCAGG - Intronic
920670950 1:208003309-208003331 CACTGACAGGACTGGGGCTGGGG + Intergenic
921224129 1:213000163-213000185 CAGAGTCAGGACTGGAACTCAGG + Intronic
922602024 1:226863695-226863717 CAGTGCATGCACTGGGGCTGTGG - Intergenic
1065561491 10:26968414-26968436 CAGGGTGAGCACAGGGGCTGTGG - Intergenic
1066185879 10:33010091-33010113 CAGTGCCAGGACAGGAGCTCTGG + Intergenic
1067443455 10:46326319-46326341 AAGTGCCAGCTGTGGGGCTCAGG - Intronic
1067497483 10:46773642-46773664 CAGTGGCTGGACTGGGGCTCTGG + Intergenic
1067597169 10:47566773-47566795 CAGTGGCTGGACTGGGGCTCTGG - Intergenic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1069874014 10:71550688-71550710 GAGTAACAGCACTGGGGCCCTGG - Intronic
1069997681 10:72353126-72353148 GAGTGTCCTCTCTGGGGCTCAGG - Intronic
1070140520 10:73734384-73734406 CAGTGGCTGGACTGGGGCTCTGG - Intergenic
1070948394 10:80411556-80411578 CAGTGGCTGCACTGGGACTCAGG - Intronic
1071475122 10:86019240-86019262 CATTGTCAGCGCTGGGGATGCGG - Intronic
1072124719 10:92435219-92435241 CAATGTCAGCAGTGGTTCTCTGG + Intergenic
1072252937 10:93595885-93595907 CAGTGTCAGAGGTGGGGCTGAGG + Intronic
1073248654 10:102108393-102108415 CAGGGTGGGTACTGGGGCTCTGG - Intronic
1075874377 10:125794313-125794335 CAGTGTCTGTCCTTGGGCTCTGG + Intronic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076716170 10:132364968-132364990 TTCTGTTAGCACTGGGGCTCAGG - Intronic
1077249753 11:1555726-1555748 CTGTGGCTGGACTGGGGCTCTGG + Exonic
1077257992 11:1597709-1597731 CAGTGTAAGATCTGAGGCTCTGG - Exonic
1077261089 11:1621399-1621421 CAGTGTAAGATCTGAGGCTCTGG - Exonic
1077460127 11:2704936-2704958 CAGTGACAACTCTGTGGCTCTGG + Intronic
1077536849 11:3128669-3128691 CCCTGCCAGGACTGGGGCTCAGG + Intronic
1077854617 11:6110625-6110647 AAGTGGCAGTACTGAGGCTCAGG + Intergenic
1078104358 11:8349465-8349487 CAGAATCATCACAGGGGCTCTGG + Intergenic
1081687032 11:45049932-45049954 CAGTGTCAGCACTGAGACTGTGG + Intergenic
1082813334 11:57491886-57491908 CAGTGGAAGGTCTGGGGCTCAGG - Intronic
1083420105 11:62547510-62547532 CAGAGGAAGCGCTGGGGCTCTGG - Intronic
1083463701 11:62831900-62831922 CCGTGTCAGCTCTGGGGCAGTGG - Intronic
1083838097 11:65285814-65285836 CAGTGTAAGCAGTGAGTCTCTGG - Intronic
1083881989 11:65553406-65553428 CAGTGTGAGTGCTTGGGCTCAGG - Exonic
1083892193 11:65601123-65601145 GAGTCTCAGGACTGGGGCTGCGG - Intronic
1083899287 11:65635957-65635979 CACTGTCAGCTCTGGGGGTAAGG - Intronic
1084013896 11:66367641-66367663 CAGTGTCTTCTCTGGGGGTCAGG + Intronic
1084798852 11:71527784-71527806 CAGTGTAAGATCTGAGGCTCTGG + Exonic
1084806423 11:71582359-71582381 CAGTGTAAGATCTGAGGCTCTGG - Exonic
1087086212 11:94221148-94221170 ACGTGTCAGCACTGTGTCTCCGG - Intergenic
1091804556 12:3346652-3346674 CAGTGCCACCACTGAGGCACAGG + Intergenic
1091807604 12:3366986-3367008 CATTGAGAGCACTGGTGCTCTGG - Intergenic
1092590251 12:9946692-9946714 CAGTGTCAAGTCTGGGCCTCTGG + Intergenic
1093069162 12:14690565-14690587 CAGAGTCTGCACTGTTGCTCTGG + Intronic
1095864277 12:46954565-46954587 CAGTGTCAGGACTGGACCACTGG + Intergenic
1096179688 12:49543875-49543897 GGGAGTCAGCACTGGGGCTGGGG - Intronic
1096606313 12:52768919-52768941 CAGTGGCAGCACTGGGGGCAGGG - Exonic
1097492716 12:60290809-60290831 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1099810120 12:87569749-87569771 CACTGTCATCCCTGGGGCTAGGG - Intergenic
1101509863 12:105383243-105383265 CTGTGTTAGCGCTGGGGATCAGG - Intronic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1103808892 12:123597652-123597674 CAGTGTCAGCATTAGGGTTTTGG + Exonic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1104727352 12:131086167-131086189 CAGTGTCTGCACTGGGCCAGAGG + Intronic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1105008308 12:132736926-132736948 CAGGGTCAGTACCGGGTCTCTGG + Exonic
1108487367 13:50940579-50940601 CAGTGTGAGCACTGGCTCTGAGG + Intronic
1109935860 13:69283313-69283335 GATTGGCAGCACTGGGGCTGAGG - Intergenic
1110343651 13:74420782-74420804 CTATGACAGCAATGGGGCTCAGG - Intergenic
1113671618 13:112179372-112179394 CAGAGTGGGCACAGGGGCTCAGG + Intergenic
1113892474 13:113743670-113743692 CAGTGTCCACTGTGGGGCTCAGG - Intergenic
1113911246 13:113842458-113842480 CAGTGTCAGGGATGGGGCCCCGG - Intronic
1113944335 13:114035411-114035433 CAGTGTCACCCATGGGGCCCTGG + Intronic
1114065911 14:19059794-19059816 CAGAGCCAGCAGTGTGGCTCAGG + Intergenic
1114096357 14:19340231-19340253 CAGAGCCAGCAGTGTGGCTCAGG - Intergenic
1114590585 14:23861001-23861023 CAGTGTCAGCAATGGTGATGTGG + Intergenic
1114673987 14:24429265-24429287 CAGTGACAGCAGTTGGGCTTTGG + Exonic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1116898371 14:50338858-50338880 CAGGGTGAGCCATGGGGCTCAGG + Intronic
1118753531 14:68822775-68822797 AACAGTCTGCACTGGGGCTCTGG + Intergenic
1118980182 14:70710004-70710026 CGGAGTCAGGACTGGGTCTCTGG - Intergenic
1119676882 14:76562478-76562500 AAGTGCCTGCACTGGGGCGCAGG + Intergenic
1119720144 14:76884841-76884863 CAGTGTCTGGGCTGGGCCTCAGG - Intergenic
1119789877 14:77340596-77340618 CTGTGTCACCCCTGAGGCTCAGG - Exonic
1120707685 14:87761439-87761461 CAGTGTCCCCACTGGGGCACTGG + Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125590876 15:40853892-40853914 GAGAGGCAGCTCTGGGGCTCAGG + Exonic
1125591313 15:40856193-40856215 CAGTGTGAGGTCTGGGGCACTGG + Intronic
1125715134 15:41815402-41815424 CAGTGTGAGCCCTGAGGCTGTGG + Exonic
1127732349 15:61812489-61812511 CAGTGGCAGGGCTGGGGCCCAGG + Intergenic
1128114634 15:65097511-65097533 CAATGGCAGCACTGGGGTTGAGG - Intronic
1128240630 15:66098839-66098861 CTGTGTCTGTAGTGGGGCTCAGG + Intronic
1128311491 15:66633907-66633929 CAGTGACAGGACTGAGACTCAGG - Intronic
1128342868 15:66834946-66834968 CAAAGTCAGGGCTGGGGCTCAGG - Intergenic
1129539355 15:76338210-76338232 CGGTGTCAGCGCTGGGCCTGCGG - Intronic
1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG + Intronic
1130531328 15:84749152-84749174 CAGGGTCAGAACTTGGGCTCAGG - Intronic
1132051234 15:98609419-98609441 CAGTGTGAACGCTGGGGCTCAGG - Intergenic
1132607972 16:801359-801381 CAGCTGCAGCACTTGGGCTCGGG + Intergenic
1132689430 16:1175900-1175922 CAGAGCCTGCACTGGGGGTCCGG - Intronic
1132724038 16:1331181-1331203 CAGAGTGAGGCCTGGGGCTCAGG + Intergenic
1132725857 16:1338086-1338108 CAGAGTCGGCACGGGGGCTGGGG + Intronic
1133430543 16:5733462-5733484 CACTGACAGCACTGCTGCTCGGG - Intergenic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1136509081 16:30724766-30724788 CAGTGTCTGCACTGAAGCTGGGG - Exonic
1138599336 16:58045784-58045806 CAGTTACAGCCCTGGGGTTCAGG - Exonic
1139558742 16:67728720-67728742 CAGAGGCAGCACTGGGGCAAGGG - Intronic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1141574920 16:84957720-84957742 CATTCTCAGCACTGAGGCCCCGG - Intergenic
1142044644 16:87917977-87917999 CAGTGTCGGGACTGGGACTGTGG - Intronic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1142340605 16:89519788-89519810 CAGGGTCAGCTGTGGCGCTCGGG + Intronic
1142963611 17:3566775-3566797 CACTGTCAACACTGGGCCTTAGG - Exonic
1143254547 17:5546005-5546027 AAGTGTCTTCACTGGGGCTTGGG - Intronic
1144669973 17:17127339-17127361 CAGTGGCAGCAGAGTGGCTCGGG - Intronic
1145317724 17:21744847-21744869 TAGTGCCGGCACTGGGTCTCTGG - Intergenic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1145961081 17:28886858-28886880 CAGTGCCAGCCCTGGGGCACTGG + Intronic
1146619357 17:34385611-34385633 CAGGGTCAGGACTGGGGTTTGGG - Intergenic
1147385776 17:40081079-40081101 CAGAGTCAGAACTGGGCCTCAGG - Intronic
1149571533 17:57675652-57675674 CAGTGGCAGCGCTGGAGCCCGGG + Intronic
1150439774 17:65181713-65181735 AAGTGGCAGAGCTGGGGCTCAGG - Intronic
1152115262 17:78382556-78382578 CTGTGGCAGAACTGGAGCTCAGG + Intronic
1155359377 18:24984839-24984861 CGATGTCAGCACAGGGACTCTGG - Intergenic
1156982308 18:43305115-43305137 AGGTGTCAGCTCTGGGGCCCTGG - Intergenic
1160152765 18:76407473-76407495 CAATGTCGGGACAGGGGCTCGGG + Intronic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161238186 19:3208204-3208226 CAGTGCCAGCCCTGGGGTTCTGG + Exonic
1161251228 19:3281356-3281378 CAGTGACAGCTTCGGGGCTCCGG + Intronic
1161290417 19:3491023-3491045 CAGGGGCAGAGCTGGGGCTCTGG - Exonic
1161317688 19:3625816-3625838 CTGAGCCAGCACTGGGGCCCCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1162517117 19:11155318-11155340 CAGGGTTTGAACTGGGGCTCAGG - Intronic
1162731358 19:12721007-12721029 CGGGGTCAGCGCTGGGTCTCTGG + Intronic
1163365355 19:16873074-16873096 CTGTGTCCTCCCTGGGGCTCAGG + Intronic
1163500751 19:17674773-17674795 AGGGGTCAGCGCTGGGGCTCAGG + Intronic
1164614724 19:29660182-29660204 CAGTGTCAGCCTTTGGGGTCTGG - Intergenic
1164985796 19:32647534-32647556 CAGTGTCCTCACTGGGGCAGGGG + Intronic
1165892454 19:39122115-39122137 CCTTGTCAGCACTGGGGGCCAGG - Intergenic
1166647242 19:44541212-44541234 AGGTGTCAGTGCTGGGGCTCTGG + Intergenic
1166759265 19:45214247-45214269 CAGTTTCAGCACTGAGGGTGGGG - Intronic
1166806317 19:45489302-45489324 TAGGGTCAGGACAGGGGCTCAGG + Intronic
1167308769 19:48724205-48724227 CAGTGTCTGAGCTGGGGCTGGGG + Intronic
1167510890 19:49894895-49894917 CAGCGCCAGCCCTGGGCCTCTGG - Intronic
1168024752 19:53635862-53635884 CAGGGGCTGCTCTGGGGCTCAGG - Intronic
1168353239 19:55688081-55688103 CAGGGTCCGCCCTGGGGCTTTGG + Intronic
925807738 2:7667908-7667930 CAGAGTCAGCACTGGAGGTATGG + Intergenic
926146324 2:10399023-10399045 CACTGTCAGCACGGGTGCACAGG + Intronic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
926705615 2:15835364-15835386 CCATGTCAGCTCTGAGGCTCTGG + Intergenic
927562709 2:24084813-24084835 CAGAGGCAGTCCTGGGGCTCTGG - Exonic
927702634 2:25277506-25277528 CTGTGTCAGCCCTGCGGCTAGGG + Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
927808479 2:26168950-26168972 CTGGGTCAACACTGGGCCTCTGG + Intergenic
928137019 2:28695456-28695478 CAGGGTGAGGCCTGGGGCTCTGG - Intergenic
929006217 2:37395472-37395494 CAGTGTCTGTTTTGGGGCTCTGG + Intergenic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
930093320 2:47547561-47547583 CAATGTCAGCTAGGGGGCTCTGG - Intronic
931079473 2:58753040-58753062 CAGAGTCCCCACTGGGGCACTGG + Intergenic
931207516 2:60162529-60162551 CAGAGTCAATACAGGGGCTCTGG - Intergenic
933587553 2:84195824-84195846 CAGTGTCAGGACTGAGTCCCAGG + Intergenic
933995265 2:87663542-87663564 CAGGGTCAGGACTAGGGCTAGGG + Intergenic
934520144 2:95014979-95015001 CAGCGTCAGCACTGAGGCCAGGG - Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
935363001 2:102263581-102263603 CAGTCCCAGGACTGGGGCTATGG - Intergenic
936298595 2:111287371-111287393 CAGGGTCAGGACTAGGGCTAGGG - Intergenic
937296934 2:120815081-120815103 CAGGCTCATCCCTGGGGCTCAGG - Intronic
938293463 2:130162468-130162490 CTGTGCCAGACCTGGGGCTCAGG + Intronic
938463090 2:131510493-131510515 CTGTGCCAGACCTGGGGCTCAGG - Intergenic
940863631 2:158795335-158795357 CAGTGCCAGTGCTGGTGCTCTGG - Exonic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
944219249 2:197285965-197285987 CAGAGTTAGCTCTGGGGCTCAGG - Intronic
946011909 2:216572163-216572185 CTTTGTCAGAACTGGTGCTCAGG + Intronic
947987995 2:234465281-234465303 CACTGTGGGCAGTGGGGCTCAGG + Intergenic
948127856 2:235577950-235577972 CAGTGTCTGCACAGGGGGTCTGG + Intronic
948295977 2:236860992-236861014 TAGATACAGCACTGGGGCTCAGG + Intergenic
948530799 2:238602568-238602590 CAGTGGCAAGACTGGGGCACAGG + Intergenic
948628325 2:239284364-239284386 CTGGGTCAGCACAGTGGCTCAGG - Intronic
1169166839 20:3431441-3431463 CAGGTTCAGCTGTGGGGCTCTGG - Intergenic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1170874144 20:20234941-20234963 AAGTGTCAGCACTAGGCCTTTGG - Intronic
1173724545 20:45288343-45288365 GAGTGGCAGCCCTGGGGCTTTGG - Intergenic
1174817080 20:53696438-53696460 AAGTGGAAACACTGGGGCTCAGG - Intergenic
1174910339 20:54601152-54601174 CAGAGTGAGCACTGGGGCTGAGG + Intronic
1175696942 20:61109613-61109635 CAGGGTGAGCACTGCTGCTCCGG + Intergenic
1175927067 20:62476097-62476119 CAGGGTCAGCGCTGGGGCTCCGG + Intergenic
1178518027 21:33265038-33265060 CAGTTTAAGGACTGGGACTCAGG + Intronic
1178599415 21:33983217-33983239 CAGGATCAACACTGTGGCTCTGG - Intergenic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179505384 21:41836412-41836434 CAGGGCCAGGACTGGGGCTGGGG - Intronic
1179716431 21:43291082-43291104 CAGTGTCAGCACCCGGGCACGGG - Intergenic
1179887967 21:44322489-44322511 CACTGTCAGCACTCTGGCTGAGG + Intronic
1180226304 21:46394402-46394424 CAGCGTCAGCAGCAGGGCTCTGG - Intronic
1180484391 22:15782386-15782408 CAGAGCCAGCAGTGTGGCTCAGG + Intergenic
1181054248 22:20252657-20252679 CTGTGTCATCCCTGGGGCTCAGG - Intronic
1182096222 22:27627752-27627774 CAGTTTCCTCAGTGGGGCTCAGG - Intergenic
1182273670 22:29171540-29171562 CAGCGTCACCCCTGGGCCTCTGG + Intergenic
1182551392 22:31102718-31102740 CATTGTTTACACTGGGGCTCAGG - Intronic
1183408325 22:37641011-37641033 CAGTGGAAGCACTGGGGTCCAGG + Intronic
1185318498 22:50189557-50189579 CAGTGCCAGCACTGGGGATTTGG + Intronic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
950153368 3:10705555-10705577 CAGTGCAAGCACTTGGACTCTGG + Intronic
951619283 3:24583312-24583334 CAGTGTCAGCCTCGGGGATCTGG - Intergenic
951753368 3:26061656-26061678 CAGTGTCAGGCTTGGGGCCCAGG + Intergenic
954643494 3:52116420-52116442 CAGTTCAAGCACTGAGGCTCTGG + Intronic
956639805 3:71404993-71405015 CAGTGTCAGTCCTTGGGCTGGGG - Intronic
956973997 3:74559146-74559168 CAGTGTCAGAACTGGGGTTTAGG - Intergenic
957765712 3:84621677-84621699 CAGAGTCCCCACTGGGGCACTGG - Intergenic
958738630 3:98040877-98040899 CAGTGGCAGCACTGGAGCCCAGG - Intergenic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
961569217 3:127786107-127786129 CAGGGGCAGCAGTGGGGCACTGG + Intronic
961845334 3:129758143-129758165 CAGTTTCAGGACTGTGGATCTGG - Intronic
962910246 3:139841769-139841791 CAGAGTCAGTACTTGGGTTCAGG + Intergenic
963368645 3:144369384-144369406 CAGTGTTATGACTGGGGCTCTGG - Intergenic
964391392 3:156201565-156201587 CAGTGTCAGCGCAGGGGCGGGGG + Intronic
966512155 3:180776318-180776340 CAGAGTCCCCACTGGGGCACTGG - Intronic
967228870 3:187318804-187318826 CAGAGCCAACACTGGGGCTTAGG - Intergenic
968489602 4:882956-882978 CAGTGGCAGCCCTGGTGCTCAGG - Intronic
968982723 4:3859270-3859292 CAGTCTAAACACTGCGGCTCAGG + Intergenic
968982742 4:3859390-3859412 CGGTCTAAGTACTGGGGCTCAGG + Intergenic
969352651 4:6606566-6606588 CATTTCCAGCACTGGAGCTCAGG + Intronic
969371325 4:6733288-6733310 CAGGGCCAGGACTGGGCCTCAGG - Intergenic
969691928 4:8708634-8708656 CACTCTCCCCACTGGGGCTCTGG + Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
973179968 4:47255136-47255158 CAGAGTCAGGACTGGAACTCAGG - Intronic
974702728 4:65472396-65472418 CAGTGTCCCCACTGGGGAACTGG - Intronic
976478643 4:85513297-85513319 CAGTGCCTGAAATGGGGCTCAGG - Intronic
976917628 4:90397587-90397609 CACTGTCATCACAGGGGCTATGG - Intronic
977637392 4:99315168-99315190 TAGTCTCAGCACTGAGGCTTTGG + Intronic
982674532 4:158360474-158360496 AAGTCTCAGCAATGGGGCTGTGG - Intronic
984304884 4:177975836-177975858 GATTGTCATCACTGGGGCACGGG + Exonic
987711802 5:21510397-21510419 CACCTTCAGCACTGGGGATCTGG + Intergenic
989747912 5:44853209-44853231 TTCTGTCAGCACTGGGTCTCTGG + Intergenic
990166916 5:53004528-53004550 GAGTGTCAGGCCTGGGGCACTGG + Intronic
991409411 5:66331677-66331699 CAGAGTCACCACTGGGCCACTGG + Intergenic
991519691 5:67482149-67482171 CAGGGTCAGCTCTGAGGCTCAGG + Intergenic
991762165 5:69929535-69929557 CACCTTCAGCACTGGGGATCTGG + Intergenic
991785163 5:70188565-70188587 CACCTTCAGCACTGGGGATCTGG - Intergenic
991841393 5:70804584-70804606 CACCTTCAGCACTGGGGATCTGG + Intergenic
991877610 5:71188963-71188985 CACCTTCAGCACTGGGGATCTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
998253364 5:140567264-140567286 CAGTGCCAGCAATGGGGCATGGG - Exonic
998550922 5:143077444-143077466 CATTGTCCTCACTGGGGCTTTGG + Intronic
999982610 5:156972290-156972312 CAGTTTCAGCAATTGGGCTGTGG + Intergenic
1000206520 5:159065519-159065541 GGGTGTGAACACTGGGGCTCAGG - Intronic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1002619216 5:180475068-180475090 CAGAGCCAGCACAGTGGCTCAGG + Intergenic
1003092273 6:3114269-3114291 CAGTATCAGCCCTGAGGTTCTGG - Exonic
1003155276 6:3588698-3588720 CAGTGTTAGCCGTGGGGCCCTGG + Intergenic
1003585791 6:7388134-7388156 CACTCTCAGCTCTGGAGCTCTGG - Intronic
1003777802 6:9388893-9388915 CAGAGTCAGCACTATGTCTCAGG - Intergenic
1007145738 6:39628445-39628467 CTGTGTCTTCACTGTGGCTCTGG - Intronic
1010162081 6:72868488-72868510 CAGTGCCAGAATTGAGGCTCAGG - Intronic
1011849103 6:91603739-91603761 CAGAGTCCTCACTGGGGCACTGG - Intergenic
1014017518 6:116550360-116550382 AAGTGCCAGGACTGGGACTCAGG - Intronic
1017869442 6:158474351-158474373 CAGTGCCAGCACAGGGTTTCTGG - Intronic
1019154592 6:170030706-170030728 CACTGTCACCACTGTGTCTCTGG + Intergenic
1019192658 6:170262210-170262232 CAGTGGCGGCCCTGGCGCTCTGG - Intergenic
1019285831 7:222487-222509 CAGTGCCAGCCCTGGGCCTGGGG - Intronic
1019352156 7:559391-559413 CAGGGCCAGGACGGGGGCTCAGG + Intronic
1019693635 7:2432358-2432380 CAGGGTCATTACTGGTGCTCGGG + Intronic
1019990442 7:4686665-4686687 CAGTGCCTGCACTAGGTCTCTGG - Intronic
1020023812 7:4884308-4884330 CCAGGTCAGCTCTGGGGCTCTGG + Intergenic
1020069631 7:5217854-5217876 AAGTGTCAGCCCTGGGGCGTGGG + Intronic
1020117982 7:5487096-5487118 CAGTGTCAGCCCTGCAGCTCTGG - Intronic
1022758595 7:33322333-33322355 CAGTGAAATCACTGGGTCTCAGG + Intronic
1024002399 7:45199330-45199352 CATTGACATCACTGGGGCCCAGG - Intergenic
1024219805 7:47278574-47278596 GTATGTCAGGACTGGGGCTCAGG - Intronic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1026870263 7:73846740-73846762 CAGTGTCTGCTCTGTTGCTCAGG - Intergenic
1032015942 7:128380511-128380533 CAATGTCAGCACTGGGGGCTTGG + Intergenic
1033560865 7:142529169-142529191 CAGTGACATCACTGAGCCTCAGG - Intergenic
1034063503 7:148114870-148114892 AAGGGTGATCACTGGGGCTCAGG - Intronic
1034540366 7:151754505-151754527 CTGGGCCAGCACTGGGGCTTAGG + Intronic
1038210795 8:25517589-25517611 CAGTGTCAGCACTCTGTCTAAGG + Intergenic
1044703418 8:94985203-94985225 CACTGTGAGCACTGGAGCTATGG + Intronic
1046455742 8:114458345-114458367 CAGTGACTGGAATGGGGCTCAGG - Intergenic
1046628215 8:116597860-116597882 CAGTTCCAGCTTTGGGGCTCTGG + Intergenic
1046916577 8:119683981-119684003 TAGTTTCAGCACTGGGTCCCTGG + Intergenic
1048952174 8:139505316-139505338 AGGTGCCAGCACTGGAGCTCCGG + Intergenic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049101588 8:140583252-140583274 GAGTGTCAGTAGCGGGGCTCAGG - Intronic
1049562079 8:143316966-143316988 CTGGGGCAGCACTGGGGCTGTGG - Intronic
1049708485 8:144053403-144053425 CAGTGTCATCACTGAGCCCCTGG + Intronic
1051285563 9:15492599-15492621 CCGAGTCCGCACTGGGGCACTGG - Intronic
1052832512 9:33227994-33228016 CAGAGTCAGAAATGGGGCACAGG + Intronic
1053296949 9:36922129-36922151 AAGGGTCAGCACTGAGGCTCAGG - Intronic
1055615742 9:78070364-78070386 AATTGTCAGCACTAGGACTCAGG - Intergenic
1056103842 9:83327464-83327486 CAGTGTCATCCCTGGCTCTCTGG + Intronic
1057130353 9:92650465-92650487 CAGAGTTTTCACTGGGGCTCAGG - Intronic
1059992866 9:119881698-119881720 CAGTGGCAGAGCTAGGGCTCAGG + Intergenic
1060063492 9:120482484-120482506 AAATGACAGCACTGGGTCTCAGG - Intronic
1061007255 9:127935210-127935232 CAGGACCAGCCCTGGGGCTCAGG - Exonic
1061438008 9:130579087-130579109 CAGTGTAAGAACTGGGGCCCGGG + Intronic
1061534292 9:131238202-131238224 CGGAGCCAGCACTGGGGCCCGGG + Intergenic
1062405490 9:136394345-136394367 CAGCATCATCACTGGGGGTCTGG + Intronic
1062725369 9:138070279-138070301 CAGGGTCAGGCCTGGGGTTCAGG + Intronic
1186382627 X:9076978-9077000 CAGTGACTGGTCTGGGGCTCAGG - Intronic
1186587193 X:10887902-10887924 CAGAATCAGCCCTGGGGATCAGG - Intergenic
1191133604 X:57040944-57040966 CAGTGTCAGCACTCAGGCACAGG - Intergenic
1191640273 X:63424153-63424175 CAGTAGCTGCACTGGGTCTCTGG + Intergenic
1194982355 X:100453426-100453448 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1198695191 X:139328880-139328902 CAGTGACATCACTGGGTCTGAGG - Intergenic
1199083741 X:143606112-143606134 CAGAGTCCCCACTGGGGCACTGG + Intergenic
1200122473 X:153797651-153797673 CAGTGTCGGCACTGGTGGTCAGG + Intronic
1200151824 X:153954930-153954952 CAGTGTGGCCACTGGGGCGCTGG - Exonic
1201283446 Y:12360139-12360161 GTGTGGAAGCACTGGGGCTCGGG + Intergenic
1201650150 Y:16276145-16276167 CAATGTCAACACTGGGACTTAGG - Intergenic