ID: 1179118584

View in Genome Browser
Species Human (GRCh38)
Location 21:38520450-38520472
Sequence TCTCATCTGTGTCCATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179118579_1179118584 9 Left 1179118579 21:38520418-38520440 CCGAGGAACAGACACAAGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 290
Right 1179118584 21:38520450-38520472 TCTCATCTGTGTCCATGAGGTGG 0: 1
1: 0
2: 3
3: 26
4: 166
1179118582_1179118584 -9 Left 1179118582 21:38520436-38520458 CCAGGGCTGAACAATCTCATCTG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1179118584 21:38520450-38520472 TCTCATCTGTGTCCATGAGGTGG 0: 1
1: 0
2: 3
3: 26
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179118584 Original CRISPR TCTCATCTGTGTCCATGAGG TGG Intronic
901940639 1:12659068-12659090 TCTCGTATGTGTCCATGCGTCGG - Intronic
903032825 1:20476072-20476094 TCTCATCTGTGACCCTGGGGTGG - Intergenic
903785626 1:25859349-25859371 TCTCCTCAGCGGCCATGAGGCGG - Exonic
904301405 1:29557021-29557043 TGTCATCTGTGTCCCTGATGCGG + Intergenic
904340028 1:29828545-29828567 TGTCATCTGTGTCCCTGATGCGG + Intergenic
904403771 1:30273331-30273353 TGTCATCTGTGTCCCTGATGTGG - Intergenic
905392845 1:37649026-37649048 TCTCATCTACCTCAATGAGGAGG + Intergenic
905433863 1:37943725-37943747 GCTCATCTTTGTCCTTGATGGGG - Intronic
906305393 1:44715137-44715159 TCTCATATGTGTCCAGTAGGTGG + Intronic
910001715 1:82349982-82350004 TCTCATCTGTCTTCATGGGCTGG + Intergenic
910510534 1:87999220-87999242 TATCATCTGTGTCCAGCTGGTGG + Intergenic
915022602 1:152795771-152795793 TCTCATCTGTGACCATCATCCGG + Intronic
916450700 1:164917719-164917741 CCTCATTTATGTCAATGAGGTGG + Intergenic
919796742 1:201325508-201325530 TCTCCTCAGGGGCCATGAGGTGG - Intronic
920956554 1:210624931-210624953 CCACATCTGGGTCCCTGAGGAGG + Intronic
922171603 1:223160078-223160100 TCTCAGCTGTGTGCCTAAGGAGG - Intergenic
922476596 1:225911042-225911064 CCTCATCTCAGCCCATGAGGTGG + Intronic
924741626 1:246797457-246797479 TCTCATCAGTGTCCAGGTGTTGG + Intergenic
1063463944 10:6231401-6231423 GCTCATCTGTCTCCATGCCGAGG + Intronic
1063654229 10:7971138-7971160 TCTCAGCTGTCTACATGGGGTGG + Intronic
1065275618 10:24082544-24082566 CTTCATCTGTGTCCATGCAGAGG + Intronic
1066453849 10:35555551-35555573 TCTCACATTTATCCATGAGGTGG + Intronic
1066545402 10:36494561-36494583 TCTCATCTTTGTCCATTAGTAGG - Intergenic
1067692383 10:48510118-48510140 TCTCAGCTGTCCCCACGAGGGGG - Intronic
1070412584 10:76156528-76156550 TGTCATCTGTGGCCATCAGAAGG - Intronic
1072189350 10:93067517-93067539 TCTCATCTGTGAACTGGAGGTGG - Intronic
1074267379 10:111918099-111918121 TTTCATCTGTTTCCCTGAGCTGG - Intergenic
1075973517 10:126674659-126674681 TCTCCTCTATGCTCATGAGGAGG - Intergenic
1077309522 11:1882214-1882236 AGTCATCTGTGGCCATGATGGGG + Intronic
1078427298 11:11262112-11262134 GCTGAGCTTTGTCCATGAGGGGG + Intergenic
1080389668 11:31833411-31833433 TCTTATCAGTGTCCATGAGAAGG + Intronic
1081601042 11:44494483-44494505 TCTCATCTATGTCTATATGGAGG + Intergenic
1081638553 11:44737253-44737275 TGTCCTTTGGGTCCATGAGGTGG - Intronic
1082909039 11:58349017-58349039 TTTCATCTGTGTCCATGGAATGG + Intergenic
1088177073 11:107065863-107065885 TCTTATCTTTCTACATGAGGTGG + Intergenic
1089628670 11:119769961-119769983 TCTCATCTGGCTTCATGGGGAGG + Intergenic
1091223596 11:133945088-133945110 TCTCACATGTGGCAATGAGGAGG + Intronic
1091286400 11:134411033-134411055 TCCCATGTGTGTGCATGTGGGGG + Intronic
1091533480 12:1383243-1383265 TTTCTTCTGTGTCCATCAGGTGG + Intronic
1093382138 12:18506132-18506154 TCTCATGGATCTCCATGAGGTGG - Intronic
1097229422 12:57500444-57500466 TCCCTTCTGTGGCTATGAGGAGG + Exonic
1097778335 12:63673915-63673937 TATTTTCTGTGTCCATGAGGGGG + Intergenic
1099528053 12:83740566-83740588 TCTCTTCTGTGTCCCAAAGGTGG + Intergenic
1100776100 12:97976419-97976441 TCTCACCTGTACCCATGGGGAGG - Intergenic
1102992695 12:117326613-117326635 TCTCAACTGTGACCGTGATGAGG - Intronic
1103470848 12:121179654-121179676 TCTCATCTTGGGCCATGAAGTGG - Intronic
1105791149 13:23800260-23800282 TCTCAACTGTGTCAGAGAGGAGG + Intronic
1107888051 13:44891004-44891026 TCTGGTCTGGGTGCATGAGGAGG - Intergenic
1108522848 13:51260701-51260723 TCTCTACTGGGTCCATGAGTTGG - Intronic
1109219178 13:59624161-59624183 TCTCATCTGTGCCCATGAAAGGG - Intergenic
1110054293 13:70945672-70945694 TCTCATTTTTGTCCATCAGCAGG + Intergenic
1111454354 13:88460651-88460673 TCTCATTTCTCTCCATGAGAGGG + Intergenic
1112470442 13:99683700-99683722 ACTCATGTGGGTCCTTGAGGAGG - Intronic
1113821407 13:113216130-113216152 TCTCATCTGTGTGGCTGTGGAGG + Intronic
1115517695 14:34202485-34202507 TCTCATCTATGTTCCAGAGGGGG + Intronic
1115887062 14:37984280-37984302 TCTACTCTGTTTCCATGAGTTGG - Intronic
1116217383 14:42035743-42035765 TCTCACCTGTTTGGATGAGGTGG - Intergenic
1121139877 14:91531994-91532016 TCCCATCTGTTTCCATGCCGTGG - Intergenic
1124065368 15:26338281-26338303 TCTCCTCTGTCTCCATGCTGAGG + Intergenic
1124238770 15:28013119-28013141 TCTGGCCTGTGTCCAGGAGGAGG - Intronic
1130813154 15:87403670-87403692 TCTCATCTCTGCCCATAAAGGGG - Intergenic
1132746472 16:1438389-1438411 ACTCAGCTGTGGCCATGGGGAGG - Intronic
1133118772 16:3593666-3593688 TCCCATATGTGTCTATCAGGAGG - Intronic
1133580901 16:7143610-7143632 TCTTTTCTGTGTCCTTGAAGGGG + Intronic
1136609942 16:31360121-31360143 CCTCATCTGTCTCCACGAGAAGG + Intronic
1137759020 16:50925586-50925608 TTTCATATGTGTCCATGATGTGG - Intergenic
1137822969 16:51463314-51463336 CCTCATCTGTTTCCAAGATGTGG + Intergenic
1139261841 16:65601706-65601728 TCTCATTTATTTCCATGTGGTGG - Intergenic
1139927279 16:70496606-70496628 TCACATCAGTGTCCTTGACGGGG - Intronic
1141414679 16:83861207-83861229 TGTCAGCTTTGTCCATGAGCTGG - Intergenic
1143167398 17:4903743-4903765 TATCATCTGTGACCACAAGGTGG - Intergenic
1143653067 17:8276201-8276223 CCTCATGTGTGTCCCTCAGGAGG - Intergenic
1144607604 17:16681459-16681481 ACTGATCTGTCTCCATGAGCTGG - Intergenic
1145197230 17:20904653-20904675 ACTGATCTGTCTCCATGAGCTGG + Intergenic
1149301152 17:55305510-55305532 TCTCTTCTGCCCCCATGAGGAGG + Intronic
1150703355 17:67466664-67466686 TTTCCTCTGTGTCCAAGAGTGGG - Intronic
1151034036 17:70777723-70777745 TGTCATTTGTTTCCATGAAGGGG + Intergenic
1151810749 17:76439861-76439883 TCTCAACTGTGTCCTGCAGGTGG + Intronic
1151813743 17:76460708-76460730 TCCCTTCTTTGTCCAGGAGGTGG + Intronic
1152340710 17:79722556-79722578 TTTCCTATGTGTCCATAAGGAGG + Intergenic
1152997099 18:417938-417960 TCCCATTTTTGTCCCTGAGGAGG + Intronic
1153819899 18:8824274-8824296 CCAAATCTGTGTCCATCAGGTGG + Intronic
1156459879 18:37315724-37315746 TCTCCCCTGTGTCCCTGGGGAGG - Intronic
1158571257 18:58598521-58598543 CCTCAGCTGAGTGCATGAGGAGG + Intronic
1158844040 18:61421878-61421900 TCTGATTAGTGTCAATGAGGGGG + Intronic
1166520814 19:43479109-43479131 TGTTATCTATGTCCCTGAGGAGG + Intronic
1167246017 19:48373672-48373694 TCTCCTGTGTGTCCAGGACGAGG - Exonic
1167915842 19:52739672-52739694 CCTCAGCTGGGTCCATGATGTGG - Intergenic
925027317 2:620269-620291 TCTCCTCCCTGACCATGAGGAGG + Intergenic
925564544 2:5235903-5235925 TTCCATCTGTGCCAATGAGGTGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928177281 2:29043306-29043328 TCTCCTCTGTATCCCTCAGGAGG + Intronic
930660016 2:54044049-54044071 TCTCGTCTCTGTCCTTGATGGGG - Intronic
932400951 2:71481027-71481049 TCTCAGCAGTGTCCTTGAGGTGG + Intronic
932818752 2:74881935-74881957 GCTCATCTGTGACCCTGGGGAGG + Intronic
933675015 2:85047421-85047443 TCTGAAATGTGTCCATGTGGTGG - Intronic
935806540 2:106754259-106754281 TCCCATCTGTGTCTATGAGGAGG - Intergenic
939725484 2:145715804-145715826 TCTAATTTGAGTCAATGAGGGGG - Intergenic
942546801 2:177073827-177073849 TCTCATCTTTGTCCATTATGTGG - Intergenic
943480999 2:188417717-188417739 TCTACTCTTTGTCAATGAGGAGG - Intronic
944405690 2:199380951-199380973 TCCCATCTGTGTCTATGAATGGG - Intronic
945049291 2:205807828-205807850 TCTCCTCTGCATCCATGTGGTGG - Intergenic
945619056 2:212110520-212110542 TCTCATCTATTTCAGTGAGGCGG - Intronic
946321884 2:218959402-218959424 TCTCAACTCTGACCCTGAGGAGG + Intergenic
946599217 2:221340944-221340966 TCTCTTCTGTGTGGATGAGGAGG - Intergenic
947948655 2:234128682-234128704 TCTCATCTGGGTCCTTGACTGGG + Intergenic
948564174 2:238873124-238873146 TCCCTACTGTGTCCAGGAGGAGG - Intronic
948747646 2:240107890-240107912 TCTCTTCTGAGTCCAGGAGATGG + Intergenic
1170123263 20:12934840-12934862 TCTCATCTGTGTCCCTGTGTTGG - Intergenic
1171027545 20:21644816-21644838 TATCATCTGTGACCATGATGGGG + Intergenic
1172080125 20:32333800-32333822 ACTCAGCTGTGTTCATGTGGTGG + Exonic
1172792363 20:37514595-37514617 TGTCACCTGTGTCCATTTGGTGG - Intronic
1173784826 20:45784999-45785021 TCTTATCTGAGTGCATGTGGTGG - Intronic
1177403560 21:20637489-20637511 TCTCATTTGTGTCTTTGTGGAGG - Intergenic
1178877623 21:36424956-36424978 TAGCATGTGTGCCCATGAGGGGG - Intergenic
1179118584 21:38520450-38520472 TCTCATCTGTGTCCATGAGGTGG + Intronic
1179574818 21:42301467-42301489 TCTGCTCTGTGTCCCAGAGGTGG - Intergenic
1180112067 21:45663425-45663447 TCTCATCTCTGTGCATAGGGAGG + Intronic
1181907406 22:26210215-26210237 TCTGATCTGAGACCATCAGGTGG + Intronic
1183506534 22:38212339-38212361 TCTCATCTGTCTCCAAGGGGAGG - Intronic
1183591958 22:38784384-38784406 CCTCCTGTGTGCCCATGAGGAGG - Intronic
1183646286 22:39128869-39128891 TCTCAGCTGGGTCCATGCAGAGG - Intronic
1184246839 22:43240160-43240182 GCTCAGCCGTGACCATGAGGAGG - Intronic
951098592 3:18660254-18660276 ACTCATCTGTGTAAATGAGTGGG + Intergenic
952204280 3:31164289-31164311 CCTCATCTGTTTCCTTGGGGTGG - Intergenic
953137726 3:40197453-40197475 GCCCATCTATGTCCATCAGGGGG - Intronic
958474069 3:94558245-94558267 TCTCATTTCTGTCCATTAGGAGG - Intergenic
959140113 3:102475598-102475620 TCCCACCTGTTTCCATGAGAAGG + Intronic
959937120 3:112040733-112040755 ACTGATCTGTTTCCATGAAGTGG - Intronic
961731089 3:128965412-128965434 TCTCATGTGGGGCCATCAGGAGG + Intronic
963136835 3:141913402-141913424 TCTCTTCTGTCACCATTAGGTGG - Intronic
963316775 3:143767303-143767325 TCTCATCTGTGTATATGATAGGG - Intronic
965711824 3:171563400-171563422 TCTCACCTGTACCCATGATGAGG - Intergenic
968077411 3:195824140-195824162 CCTCACCTGCCTCCATGAGGCGG + Intergenic
969563980 4:7966873-7966895 GCTTCTCTGTGTCCATGGGGTGG - Exonic
970383468 4:15531910-15531932 TCTTATCTGTCACCATCAGGTGG - Intronic
972657292 4:41076677-41076699 TGTCATCTTTATTCATGAGGAGG - Intronic
979046419 4:115871825-115871847 TCTCATGTGTTTTTATGAGGAGG + Intergenic
985706194 5:1402810-1402832 GGTCATCTGTGACCAAGAGGAGG - Intronic
986358379 5:6951015-6951037 TTTCCTCGGTGGCCATGAGGTGG + Intergenic
992897447 5:81257754-81257776 TCTCATCTGGATAAATGAGGAGG + Exonic
995459121 5:112384560-112384582 TCCCATCTGTTTCCATGAGAAGG - Intronic
996030229 5:118696599-118696621 TGTCATCAGTGTCAATGTGGTGG - Intergenic
997628404 5:135347409-135347431 TCTCAGCTGTGTCCGAGAGAGGG + Intronic
998325702 5:141278150-141278172 TCCCACCTGTGGCCATAAGGAGG + Intergenic
1001370186 5:171192177-171192199 TATCAACTGTGTCCATGACTTGG + Intronic
1007019234 6:38502974-38502996 TCTCATCTGTTTCCATAGTGTGG - Intronic
1014159640 6:118153045-118153067 TTCCATCTGCTTCCATGAGGAGG - Intronic
1014696592 6:124629099-124629121 TCCCATCTTTTTCCCTGAGGAGG + Intronic
1015878297 6:137845975-137845997 TCACATCTGAGGCCATGTGGAGG + Intergenic
1020972497 7:14963193-14963215 TCTCTTCTGTGGCCAAGAGGGGG + Intronic
1022937266 7:35191587-35191609 TATTTTCTGTGTCCATGAGGGGG + Intergenic
1024550453 7:50558765-50558787 TCTCATCTCTGGCCATGGTGAGG - Intronic
1026765602 7:73157577-73157599 GCAGTTCTGTGTCCATGAGGGGG - Intergenic
1027042075 7:74967270-74967292 GCAGTTCTGTGTCCATGAGGGGG - Intronic
1027081566 7:75235084-75235106 GCAGTTCTGTGTCCATGAGGGGG + Intergenic
1028372858 7:90114016-90114038 TATTTTCTGTGTCCATGAGGGGG - Intergenic
1029390153 7:100269669-100269691 GCAGTTCTGTGTCCATGAGGGGG + Intronic
1029833428 7:103284228-103284250 TATTTTCTGTGTCCATGAGGGGG + Intergenic
1032518611 7:132525612-132525634 TCTCACCTGTGTCCATGAACTGG - Intronic
1037747795 8:21660854-21660876 TCTCATTAGTGTCCCTGGGGAGG - Intergenic
1039326561 8:36491428-36491450 TCTGTTCTGTGCCCATGATGTGG - Intergenic
1039456366 8:37710087-37710109 GCTCAACTGTGACCATCAGGAGG - Intergenic
1039734190 8:40313098-40313120 TCTCACCTATGTAAATGAGGAGG + Intergenic
1041243684 8:55871168-55871190 TCTCATCTGTGTATATCAAGTGG - Intergenic
1047863651 8:128996719-128996741 TCTCATCTTTGTCTATTCGGTGG - Intergenic
1048936318 8:139360286-139360308 TTTCATATGTATCCTTGAGGAGG - Intergenic
1049664730 8:143837849-143837871 TGTCCTGTGTGTCCCTGAGGAGG - Intronic
1050483174 9:6107001-6107023 GCTCACTTGTGTCTATGAGGTGG + Intergenic
1051130031 9:13850405-13850427 TCTCATGTTTGTCTAAGAGGTGG + Intergenic
1051215337 9:14791721-14791743 TCTCATCTTTGTCGCTGAGCAGG - Intronic
1051505690 9:17825182-17825204 TCTCATCTCTTTCCTTCAGGAGG + Intergenic
1059823792 9:118003691-118003713 TCTCATCTCTCTTCATGAGCTGG - Intergenic
1062384199 9:136302631-136302653 TCTGAGCTGGGTCCATGATGAGG - Intronic
1062487208 9:136785048-136785070 TCTCATCTCTGCACATGAAGAGG - Intergenic
1062690028 9:137836945-137836967 TCACGTCTGCGTCCGTGAGGAGG + Intronic
1186280756 X:7990142-7990164 TTGCATCTGTGTGCATGAGATGG + Intergenic
1187026565 X:15441508-15441530 TCTCATCTCTTTCCTTGAGGAGG + Intronic
1187527506 X:20067364-20067386 TCTCATGTGTGTCCATGAGAGGG - Intronic
1188370182 X:29360004-29360026 TCTCATCTCTATATATGAGGGGG + Intronic
1188703546 X:33297032-33297054 TTTCATCTCTGTAGATGAGGTGG + Intronic
1189142379 X:38620294-38620316 TCCCATCTGCTCCCATGAGGAGG - Intronic
1190265743 X:48826533-48826555 GCTCACCTGTGTCCGTGGGGAGG - Intergenic
1190449507 X:50564244-50564266 TATCATATATGTCCAGGAGGTGG + Intergenic
1190691260 X:52915444-52915466 GCTCATCTGTGGCAATGTGGAGG + Intergenic
1190694723 X:52940348-52940370 GCTCATCTGTGGCAATGTGGAGG - Intronic
1192029556 X:67494626-67494648 TTTCATCTGTGTCCCTTATGCGG - Intergenic
1192182036 X:68922165-68922187 TCCCAGCTGTCTGCATGAGGAGG + Intergenic
1193454576 X:81714492-81714514 TTTCATCTATGTCCATGGGAGGG + Intergenic
1197454355 X:126659416-126659438 TCTCATCTGTATCCAGGAGTTGG - Intergenic
1198962592 X:142198240-142198262 GCACATGTGTGTTCATGAGGAGG + Intergenic
1200329155 X:155277315-155277337 TCTCATCTCTGACCATGAGGTGG + Exonic
1202167128 Y:22001578-22001600 TATCATCTGTGCCCATGCAGAGG - Intergenic
1202224232 Y:22584795-22584817 TATCATCTGTGCCCATGCAGAGG + Intergenic
1202318882 Y:23610865-23610887 TATCATCTGTGCCCATGCAGAGG - Intergenic
1202551887 Y:26059192-26059214 TATCATCTGTGCCCATGCAGAGG + Intergenic