ID: 1179119307

View in Genome Browser
Species Human (GRCh38)
Location 21:38528221-38528243
Sequence GGGTTATTGCAGATGTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179119307_1179119313 5 Left 1179119307 21:38528221-38528243 CCCTACTACATCTGCAATAACCC 0: 1
1: 0
2: 2
3: 15
4: 139
Right 1179119313 21:38528249-38528271 CCAAATAAGGTCACATTTTGAGG 0: 29
1: 431
2: 1055
3: 2055
4: 2903
1179119307_1179119314 6 Left 1179119307 21:38528221-38528243 CCCTACTACATCTGCAATAACCC 0: 1
1: 0
2: 2
3: 15
4: 139
Right 1179119314 21:38528250-38528272 CAAATAAGGTCACATTTTGAGGG 0: 4
1: 19
2: 51
3: 129
4: 445
1179119307_1179119309 -8 Left 1179119307 21:38528221-38528243 CCCTACTACATCTGCAATAACCC 0: 1
1: 0
2: 2
3: 15
4: 139
Right 1179119309 21:38528236-38528258 AATAACCCTATTTCCAAATAAGG 0: 7
1: 165
2: 750
3: 1519
4: 2246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179119307 Original CRISPR GGGTTATTGCAGATGTAGTA GGG (reversed) Intronic
900502114 1:3011464-3011486 GGGTCTTTGCAGATGTAACAAGG - Intergenic
901339142 1:8479456-8479478 GGGTCTTTGCAGATGTGCTAAGG + Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
904489355 1:30848751-30848773 GGGTCTTTGCAGATGTAATCAGG - Intergenic
906953076 1:50350077-50350099 GGGTGAATGCAGATGAAGTCAGG - Intergenic
907068537 1:51511823-51511845 TTCTTATTGCAGATTTAGTAAGG + Intronic
911565500 1:99458583-99458605 GGCCTATTGCAGTGGTAGTAAGG - Intergenic
912321835 1:108720826-108720848 GGGTCATAGCAGATGTAATCAGG - Intronic
918060871 1:181060296-181060318 GGGTTGTTGCAGATGTAATTTGG - Exonic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
919306785 1:195850473-195850495 GAGGTGTCGCAGATGTAGTAGGG - Intergenic
919516727 1:198534176-198534198 GGGTCTTTGCAGATGTAATCAGG + Intronic
921153228 1:212418135-212418157 GGGTCATTGCAGATGTAACTAGG + Intergenic
922530023 1:226338133-226338155 TGGTTAATGGAGATGTAATATGG - Intergenic
923496391 1:234529232-234529254 GGATTTTTGCAGATGTAATTAGG + Intergenic
923678444 1:236100140-236100162 GGATTGTTGCAGATGGAGGAGGG - Intergenic
1064923968 10:20549945-20549967 GTGTGATAGCAGATGTAATAGGG + Intergenic
1065225405 10:23538566-23538588 AGGTTATTGAAGAGGTAGTAAGG - Intergenic
1068514416 10:58008356-58008378 GGGCTCTTGCAGATGTAATTAGG + Intergenic
1068653001 10:59543131-59543153 GGGTAATTGTAGATGTAATTAGG - Intergenic
1069880928 10:71592694-71592716 GGGACTTTGCAGATGTAGTTTGG - Intronic
1072813383 10:98481287-98481309 GGGTTGTTGTACATGTGGTAAGG - Intronic
1073079676 10:100851147-100851169 GGGCTGTTGCAGCTGTAGGAAGG - Intergenic
1073882726 10:108002143-108002165 GGGTTATTATAGATGTACTTAGG - Intergenic
1074443959 10:113503046-113503068 GGGCTATTGCAAATGAGGTACGG - Intergenic
1076690336 10:132220561-132220583 GGGTTAATGCTGTTGTAGAAGGG - Intronic
1079682740 11:23319124-23319146 GGGATTTTGCAGATGTAATTAGG - Intergenic
1082623672 11:55457092-55457114 GGTTTATTGTACATGTAATATGG - Intergenic
1083964469 11:66034947-66034969 GGATTAAGGCAGATGTTGTAGGG + Intergenic
1085393673 11:76195282-76195304 GGGTCTTTGCAGATGTAATGGGG + Intronic
1094545065 12:31396961-31396983 GGATTTTTGCAGATGTGATAGGG - Intronic
1096885541 12:54715544-54715566 AGGTTATTGCAGCAGTAGAAAGG - Intergenic
1097689347 12:62719833-62719855 GGGTTATTAAAGAGGTAGAATGG - Intronic
1100240487 12:92706460-92706482 AGGTTATTGCATCTGTAGTGAGG - Exonic
1102889039 12:116543865-116543887 GGGTTTTTGCAGATGTAATTAGG - Intergenic
1103836447 12:123824852-123824874 GGGTCTTTGCAGAGGTAGTTAGG - Intronic
1104005084 12:124886134-124886156 GGGTCATTGCAGATGAGTTAAGG - Intergenic
1104737308 12:131143763-131143785 GCATTAGTGCAGATGTAGTCAGG - Intergenic
1107340097 13:39396418-39396440 AGGTTGTTGCAGATGTAATTAGG + Intronic
1109368667 13:61392606-61392628 GGGTCACTGTAGATGAAGTAGGG - Intergenic
1112023749 13:95393925-95393947 GGGTCATTGCATATGTAATTAGG - Intergenic
1115131096 14:30053050-30053072 AGGTTATTTCATATGTAGTAAGG + Intronic
1115246269 14:31299163-31299185 GGGTTATTTCAAAAGTAGTCTGG - Intronic
1115439207 14:33412481-33412503 GGAATATTGCAGATGAAGAAGGG - Intronic
1119334246 14:73819195-73819217 AGGTCATTGCAGATGTAATGAGG - Intergenic
1124636520 15:31368109-31368131 GGGTCTTTGCAGATGTAATCAGG - Intronic
1132174320 15:99697939-99697961 GGTTTTTGGCAGAGGTAGTAAGG + Intronic
1135169426 16:20170123-20170145 GGGTCCTTGCAGATGTAATGAGG - Intergenic
1135545992 16:23367155-23367177 GGGTCCTTGCAGATGTGCTAAGG - Intronic
1140644770 16:77017716-77017738 GGGTCTTTGCAGATGTAATCAGG + Intergenic
1141205608 16:81931220-81931242 GGGTCGTTGCAGATGTACTTAGG - Intronic
1141731363 16:85825175-85825197 GGGTCTTTGCAGATGTAATCAGG - Intergenic
1146239437 17:31203834-31203856 GGGTTTGTGTAGAAGTAGTAAGG + Intronic
1146517326 17:33499357-33499379 GGGTCTTTGCAGATGTAATTAGG + Intronic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1151447873 17:74178954-74178976 GGGTCTTTGCAGATGTAGTTAGG + Intergenic
1152458248 17:80428140-80428162 GGGTTACTGCTGATCTAGTCAGG + Intronic
1152588248 17:81198645-81198667 GGGTTTTTGCAGATGTCCTGGGG - Intronic
1153787406 18:8546879-8546901 GTTTTCTTGCAAATGTAGTATGG + Intergenic
1157451316 18:47791312-47791334 GGGTCATTGCAGATGGAATTAGG - Intergenic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
925773911 2:7313078-7313100 CGGTAATTGCAGATGTTGTATGG - Intergenic
925867660 2:8243299-8243321 GGGTCTTTGCAGATGTAATCAGG + Intergenic
925887943 2:8409832-8409854 GGTGTATTGTAGATGTAGGATGG - Intergenic
927691005 2:25208154-25208176 GGGTCTTTGCAGATGTAATCAGG + Intergenic
930107426 2:47651088-47651110 GGGTCTCTGCAGATGCAGTAAGG - Intergenic
930526094 2:52531354-52531376 TGGTTATTGCTGATGGAGAAGGG + Intergenic
932072385 2:68634345-68634367 GGGTATTTGCAGATGTAATTGGG + Intergenic
932202172 2:69839794-69839816 GGGATATGGAAGATGTAGGATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
945561022 2:211340442-211340464 TGGTCATTGCAGATGTACTTAGG - Intergenic
946132252 2:217615747-217615769 GGTTTATTTCAGATGTACAAAGG - Intronic
946809297 2:223506287-223506309 GGGTTTTTGCAGATGAGATATGG + Intergenic
947928330 2:233940922-233940944 TGGTTTTTGCAGGTGTAGTCAGG + Intronic
948387994 2:237593579-237593601 GGGATTTTGCAGATGTAATTAGG - Intronic
948557456 2:238823238-238823260 GGGTCTTTGCAGATGTAATTAGG + Intergenic
1168815325 20:732838-732860 GGGTTTAGGCAGATGTAGTCAGG + Intergenic
1169788196 20:9383152-9383174 GGATAAATGCATATGTAGTAAGG + Intronic
1170461331 20:16579372-16579394 GGGCTTTTGCAGCTGTAGTTGGG + Intergenic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1176423722 21:6535062-6535084 GGGTCTTTGCAGATGTAATGAGG - Intergenic
1177352878 21:19967670-19967692 AGGTCATTGCAGATGTAGTTAGG + Intergenic
1178501129 21:33126320-33126342 GAGTTATTTCAGATGCTGTATGG - Intergenic
1179119307 21:38528221-38528243 GGGTTATTGCAGATGTAGTAGGG - Intronic
1179261936 21:39765217-39765239 GGGTCTTTGCAGATGTAATTAGG - Intronic
1179699215 21:43143377-43143399 GGGTCTTTGCAGATGTAATGAGG - Intergenic
1180784616 22:18539844-18539866 GGGTCTTTGCAGATGTAATTAGG + Intergenic
1181128194 22:20713897-20713919 GGGTCTTTGCAGATGTAATTAGG + Intronic
1181241519 22:21479201-21479223 GGGTCTTTGCAGATGTAATTAGG + Intergenic
1185012889 22:48325630-48325652 GGCTTTTTGAAGATGTAATAAGG + Intergenic
953974972 3:47375570-47375592 GGGTGGTTGCAGATGGAGTTGGG - Intergenic
955999433 3:64713105-64713127 GTAATATTGCAGAAGTAGTATGG + Intergenic
956552302 3:70474909-70474931 GGGTCTTTGCAGATGTAATCTGG - Intergenic
957124012 3:76134453-76134475 GGGATTTTGCAGATGTATTAAGG + Intronic
957245512 3:77711447-77711469 GGGTCTTTGCAGATGTAATTAGG - Intergenic
957862843 3:85979249-85979271 TGGTTGTTGCAGATGTGGTTGGG - Exonic
963773967 3:149419987-149420009 GGGTTATTACAGAGGTATTAAGG + Intergenic
965499014 3:169434671-169434693 GGGTTGAGGTAGATGTAGTAAGG + Intronic
967552850 3:190819372-190819394 GGGTGATTGCAGCTGTTGCATGG - Intergenic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
969336733 4:6515035-6515057 GGGTCTTTGCAGATGTAATCAGG - Intronic
970232302 4:13923202-13923224 GGGTTTTTGTAGATGTAATAAGG - Intergenic
972832852 4:42833981-42834003 GGGTTATTGTGAATGAAGTAAGG - Intergenic
980175976 4:129345208-129345230 GATTTATTGCAGATGAAGTGAGG + Intergenic
980484539 4:133438742-133438764 GGGGTTTTGCAGATGTAATTTGG + Intergenic
981977299 4:150746466-150746488 AAGTTATTGCAGAGGTAGAATGG - Intronic
984195143 4:176650136-176650158 GTGTTCTTGCAGATGTAATTAGG - Intergenic
984381839 4:179002975-179002997 GGGTTATGGCAGGTATAGTCAGG - Intergenic
985034492 4:185824408-185824430 GGGTCATTGCAGATGTAACAAGG - Intronic
993452071 5:88084353-88084375 GAGTTTTTGCAGATGTAATTAGG + Intergenic
995014747 5:107297494-107297516 GGGAAATTGATGATGTAGTAAGG - Intergenic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
1001154702 5:169262968-169262990 GGGTCTTTGCAGATGTAATCAGG + Intronic
1001929735 5:175664443-175664465 TGGGTATTCCAGATGTAGAAAGG + Intronic
1005437237 6:25827711-25827733 GGGGTTTTGCAGATGTATTATGG - Intronic
1005708237 6:28478600-28478622 GGTTTATTGCAAAATTAGTAGGG - Intergenic
1007420967 6:41719487-41719509 GGGTTGTTGAAGATGTTGGATGG - Intronic
1007952867 6:45887504-45887526 GGGTTTTTGCAGATGTCATTAGG - Intergenic
1009661231 6:66613665-66613687 GGGTTATTGTTGATGTTGGATGG + Intergenic
1009951067 6:70396776-70396798 GGGTTATTGCAGAATTAAAAAGG - Intergenic
1010048682 6:71477793-71477815 GGGGAATTGCAGAACTAGTAGGG - Intergenic
1015858270 6:137648764-137648786 TGGTTTTTGCAGCTGTGGTATGG + Intergenic
1022304022 7:29129420-29129442 GGGTCTTTGCAGACGTAGTAAGG + Intronic
1022637111 7:32146603-32146625 GGGTCTTTGCAGATGTATTTAGG - Intronic
1026139620 7:67694493-67694515 GGATTCTTGCAGAAGTAGGAGGG + Intergenic
1030136550 7:106257178-106257200 GTGTTAATGCAGATGTACTCAGG - Intronic
1030183195 7:106732133-106732155 GGTTTATTGCACATGTAATGAGG - Intergenic
1030971800 7:116066434-116066456 GGGTTAGTGGAGATGAAATAGGG + Intronic
1033547982 7:142419696-142419718 GGAATATTGCAGAAGTTGTATGG - Intergenic
1034032550 7:147784186-147784208 AGGTCATTGCAAATGTAGTTAGG - Intronic
1037597130 8:20363603-20363625 GGGTCCTTGCAGATGTAATCGGG + Intergenic
1038740883 8:30215667-30215689 GGCTTATTGTAGATCTAATAAGG - Intergenic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1041904829 8:63020945-63020967 TGGTTAATGCTGATGTAGCAAGG + Intronic
1042315013 8:67417014-67417036 GGGTCATTGCAGATGTAGTTAGG + Intergenic
1046404726 8:113757917-113757939 GGGTCTTTGCAGATGTTATAAGG + Intergenic
1049345645 8:142137145-142137167 GGGCTTTTGCAGATGTTATAAGG - Intergenic
1052159162 9:25234124-25234146 GGGTTCTTACAAATGAAGTAAGG - Intergenic
1052621236 9:30912698-30912720 GGGTTTTTGAAGATGAAGAAAGG + Intergenic
1053037664 9:34839033-34839055 GGATTATGGCTGATGTGGTAGGG + Intergenic
1053276342 9:36786469-36786491 GGGCTATTGCAGTTGTAGATGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055891088 9:81124123-81124145 GGCTTATTTCATATGTTGTATGG - Intergenic
1057633975 9:96745966-96745988 GGGTGTTTGCAGATGTAATTAGG + Intergenic
1058452729 9:105112312-105112334 GGGTATTTGCAGATGTAATGAGG - Intergenic
1060676309 9:125518330-125518352 GTGGGATTACAGATGTAGTATGG - Intronic
1185512547 X:674236-674258 GGGTGTTTGCAGATGTAATGAGG - Intergenic
1185544018 X:927071-927093 GGGTCTTTGCAGATGTAATTAGG - Intergenic
1189743965 X:44150869-44150891 GGGTTTTTGCAGATGTAATTAGG + Intronic
1191770543 X:64752717-64752739 GTGTAATTGAAGATGAAGTAGGG + Intergenic
1193758180 X:85434498-85434520 GGGATTTTGCAGATGTATTAAGG - Intergenic
1194011189 X:88564331-88564353 TGGTTGTTGATGATGTAGTAAGG - Intergenic
1199981286 X:152921907-152921929 GGGTCTTTGCAGATGTAATCAGG - Intronic