ID: 1179121245

View in Genome Browser
Species Human (GRCh38)
Location 21:38548145-38548167
Sequence TTGCTGTCATTGAACAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179121245 Original CRISPR TTGCTGTCATTGAACAGCAC AGG (reversed) Intronic
902584365 1:17429255-17429277 GTGCTGTCATTGGACAGCCTTGG - Intronic
904612090 1:31731401-31731423 TTGACCTCCTTGAACAGCACTGG + Exonic
904917435 1:33980330-33980352 TAGCTGTCAGTGCAAAGCACTGG + Intronic
907123086 1:52024784-52024806 TTGCTGTCATTAAACAAGCCAGG + Intronic
912439880 1:109689736-109689758 GTGCTGTCATTGACATGCACAGG + Intronic
912443241 1:109714418-109714440 GTGCTGTCATTGACATGCACCGG + Intronic
915048353 1:153039970-153039992 TTGCTGTCACAGATCATCACAGG + Exonic
915842905 1:159230854-159230876 TTCCTGTGATAGAACACCACTGG + Intergenic
916774348 1:167944735-167944757 TTTCTGTCATTCAACAGGATTGG + Intronic
917161781 1:172065346-172065368 TGGCTGTCATTGAATAGCTTGGG + Intronic
923022392 1:230175004-230175026 TGGGTGTCTTTGCACAGCACAGG + Intronic
923464798 1:234238663-234238685 TGGCTGTCATTGAATTTCACTGG - Intronic
923534179 1:234835987-234836009 TTACTGTCACTAAACAGTACTGG - Intergenic
923931426 1:238703112-238703134 TTGAAATTATTGAACAGCACTGG + Intergenic
1064422716 10:15204352-15204374 TTGCATTCATTGATCTGCACTGG - Intergenic
1064485387 10:15783183-15783205 CTGGAGTCCTTGAACAGCACTGG - Intronic
1064634976 10:17356341-17356363 TTGTTGTCATAGAAGAGAACAGG - Intronic
1072135188 10:92538418-92538440 CTGCCGTCATAGGACAGCACCGG - Intronic
1076196653 10:128523297-128523319 CTGCTGTCATTGACTTGCACTGG + Intergenic
1077258974 11:1605231-1605253 GTGCTCTCATTGTAGAGCACGGG + Intergenic
1077874437 11:6291933-6291955 TTGCTGGCAGTGAAGACCACAGG - Intergenic
1078022462 11:7666967-7666989 GTCCTGTGATAGAACAGCACTGG + Intronic
1083127381 11:60584643-60584665 TTGCTGTAATAGAACATCACAGG + Intergenic
1084739376 11:71129128-71129150 TGGATGGCATTGAACAGCATTGG + Intronic
1084964072 11:72734724-72734746 TGGCTGCTATTGGACAGCACAGG - Intronic
1085833695 11:79930261-79930283 GTTCTGTAATTGAGCAGCACTGG - Intergenic
1086860698 11:91921803-91921825 TTGTTCTCTTTGAATAGCACTGG + Intergenic
1087982888 11:104638724-104638746 TCCCTGTCATTGAAGGGCACAGG + Intergenic
1088639065 11:111853460-111853482 TAGCTGTCAATGACCACCACAGG + Exonic
1089320008 11:117619278-117619300 ATGCTGTCATGGTACAGCAGAGG + Intronic
1091281069 11:134381972-134381994 TTGCCCTCATTCACCAGCACTGG + Exonic
1091345680 11:134852206-134852228 TTGCTGTCATTGGCTGGCACTGG + Intergenic
1096463465 12:51835528-51835550 TGCCTGTCATTGGACAGTACAGG - Intergenic
1099319582 12:81129420-81129442 TTGCTGTTATTCAAGAACACAGG + Intronic
1099673157 12:85720221-85720243 TTGCTGGTAATGAAGAGCACAGG + Intergenic
1100358120 12:93851018-93851040 ATGCTTTCAATAAACAGCACAGG - Intronic
1102032713 12:109752306-109752328 TGCCTGTAATTGAAGAGCACAGG + Intronic
1103670180 12:122607759-122607781 TTGATGTTTTTGAAGAGCACAGG + Intronic
1104978315 12:132561857-132561879 TGGCTGGCATGGAGCAGCACTGG + Intronic
1106834432 13:33618683-33618705 TTTCCATCATTGAACAGCAGGGG + Intergenic
1108280526 13:48856739-48856761 TCGCTGTCATTTAAAAGTACTGG - Intergenic
1109416720 13:62050602-62050624 TTGCTATCAAAGAACAGCATCGG - Intergenic
1110753888 13:79148278-79148300 TTGCTGACATTCAGGAGCACTGG - Intergenic
1112930894 13:104736481-104736503 TTGCTTTGATTTAATAGCACTGG - Intergenic
1113731241 13:112642926-112642948 GTGCTGTCACTGAACAGCAGCGG + Intergenic
1113753481 13:112792297-112792319 TTGTTTTCATTTAACAGCTCAGG + Intronic
1113755307 13:112807366-112807388 TGGCTGTCATTGATTAGCAAAGG + Intronic
1115476091 14:33814222-33814244 TGGGTGTCATTGAACAAGACAGG + Intergenic
1115921796 14:38382496-38382518 TTGTTCCCATTGAACATCACAGG + Intergenic
1116130274 14:40847585-40847607 TTGCTGTAATAGAATAGCATAGG + Intergenic
1117440404 14:55753997-55754019 TAGGTATCATTGAACAGAACAGG + Intergenic
1118899623 14:69975539-69975561 GTCCAGTCAGTGAACAGCACTGG - Intronic
1120399816 14:84016472-84016494 CTGCTTTCATTGAACAACACCGG - Intergenic
1123801481 15:23825747-23825769 TTGCAGGTAGTGAACAGCACAGG - Intergenic
1124372239 15:29110446-29110468 GGGCTGTCAGTGAGCAGCACTGG - Intronic
1124466279 15:29942739-29942761 TGGGTGTCAGTGAACTGCACGGG - Intronic
1124837620 15:33210410-33210432 TTGCTGTAATTAAATACCACAGG - Intergenic
1126381998 15:48058381-48058403 CTGCTCACATGGAACAGCACTGG - Intergenic
1126990283 15:54366988-54367010 TGGCTGTCATTGAACCTCAGGGG + Intronic
1127396484 15:58547530-58547552 TTGCTGTAAAGGGACAGCACAGG - Intronic
1131587994 15:93716825-93716847 TGGGTGTCCTTGAAGAGCACAGG - Intergenic
1133596973 16:7303148-7303170 TTGCTCTCATTGAACAGCTCAGG + Intronic
1135508021 16:23055876-23055898 TTGATGTCATTTACCAACACAGG + Intergenic
1135997144 16:27259047-27259069 ATGCTGTTAAAGAACAGCACTGG - Intronic
1139652533 16:68369689-68369711 TTGCTGTGAATGAAGAGCAGAGG + Intronic
1142779208 17:2167781-2167803 TTGCTGCCACTGATGAGCACTGG + Intronic
1144033497 17:11342740-11342762 TTTCTGTCCATGAACACCACAGG + Intronic
1144287678 17:13794055-13794077 ATGTTTTCATTGGACAGCACTGG + Intergenic
1146093464 17:29905628-29905650 TGAGTGTCATTGAACAGCAGTGG + Intronic
1146586839 17:34090111-34090133 GAGCTCTCATTGAATAGCACTGG - Intronic
1146718695 17:35107545-35107567 GTTCTGTCTTTGAACATCACTGG + Intronic
1149588902 17:57812979-57813001 TTGATGTCAGTGATCATCACTGG - Intergenic
1149701801 17:58661535-58661557 TTGCTGGAATCGAACAGCTCGGG + Intronic
1158081937 18:53602726-53602748 TTGCTGACATTCCAAAGCACAGG - Intergenic
1162259265 19:9519097-9519119 GTGGTGTCACTGGACAGCACTGG - Intergenic
1165035786 19:33032623-33032645 TTGATGTCATTACACACCACAGG + Intronic
1166532494 19:43551516-43551538 TTCCTGGCATTGCCCAGCACAGG + Intronic
1168071044 19:53951997-53952019 TGCCTGTCCTTGAACAGCTCCGG + Intergenic
925385822 2:3461049-3461071 TCGCTGTCTTCGAACAGCCCAGG - Intronic
927214067 2:20656576-20656598 TTGCTATTGTTGAACAGCAGAGG + Intergenic
927389047 2:22572323-22572345 TTCCTGGCATTTAACAACACAGG - Intergenic
931064073 2:58564751-58564773 TTGCTATCATAGAATACCACAGG - Intergenic
931226313 2:60334905-60334927 CTGCTGTCATGGAACAGCCCAGG + Intergenic
931848324 2:66228053-66228075 CTGCTGTAATAGAGCAGCACAGG - Intergenic
938679639 2:133676564-133676586 TGGCTGGAATTGAAAAGCACTGG + Intergenic
942649942 2:178155780-178155802 TCACTATCATAGAACAGCACAGG + Intergenic
942651806 2:178177019-178177041 CTGCTCTCATTAAACACCACAGG - Intergenic
944340690 2:198594511-198594533 TTGATGTGATTAAATAGCACAGG + Intergenic
946461461 2:219872545-219872567 TTGCTGTCCTTCACCAGCACAGG + Intergenic
947824973 2:233099515-233099537 TTGTTGTTGTTGAAGAGCACAGG - Intronic
1170999090 20:21396122-21396144 TTGCCGTCCTTGACCAGCACAGG + Exonic
1171093941 20:22313532-22313554 TTGATGTCTTTGAAGAGCAGAGG - Intergenic
1173627160 20:44481468-44481490 TTGGTGTCATGGAAGAGAACAGG - Intronic
1174276839 20:49410019-49410041 TTGCTGTCAATGAAGATCCCAGG + Intronic
1174829372 20:53798423-53798445 TTGCTGTAAAGGAACACCACAGG - Intergenic
1175530418 20:59671137-59671159 TTCCTGTCATGGAAAATCACAGG + Intronic
1178060083 21:28843350-28843372 TTGCTATCCTAGAACAGCATGGG + Intergenic
1178907910 21:36651576-36651598 TTGCTGAGATGGAACAGCATAGG - Intergenic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
1179121245 21:38548145-38548167 TTGCTGTCATTGAACAGCACAGG - Intronic
1179350599 21:40607264-40607286 TTGCTGTGATTTCACAGCACAGG - Intronic
1182792143 22:32961715-32961737 TTGCCTTCATTGAACAGCGGAGG + Intronic
949411800 3:3773607-3773629 TTCCTGTCAATGAAAATCACAGG + Intronic
949863997 3:8532458-8532480 TTGCTGTTTTGAAACAGCACTGG + Intronic
949916984 3:8972709-8972731 TTACTGTCATTGACCAGATCTGG - Intergenic
950714857 3:14840582-14840604 TTGCAGTCATTAAAAAGAACGGG - Intronic
951579142 3:24143688-24143710 TTGCTGTCATCCAGCACCACTGG + Exonic
954365062 3:50141262-50141284 TTGCTCTCATTTAACAGCTGAGG + Intergenic
954775107 3:53010011-53010033 TAGTTGACCTTGAACAGCACAGG - Intronic
955044667 3:55348488-55348510 TGGCTGTAACTGAAAAGCACAGG - Intergenic
955094322 3:55782216-55782238 TTGCTGTCATCAAAGACCACAGG + Intronic
957337119 3:78845644-78845666 ATGCTGTCTTTGAATGGCACAGG + Intronic
960346007 3:116534129-116534151 TTGCTGCCCTTGGACACCACTGG - Intronic
961000255 3:123369341-123369363 TTGCTGTAACTGAACACCACAGG - Intronic
961726811 3:128936157-128936179 CTGCTGTCATTGCCCTGCACTGG + Intronic
961952187 3:130761848-130761870 CTGCTGTGATAGGACAGCACTGG - Intergenic
962669796 3:137693382-137693404 TTGCTGACAGGGGACAGCACAGG - Intergenic
964557790 3:157959701-157959723 TAGCTGTCACTGAACACCAGGGG - Intergenic
964676959 3:159293986-159294008 TTACTGTCTTTGGACAGTACTGG - Intronic
965929069 3:174019512-174019534 TTGCTATAACAGAACAGCACTGG - Intronic
966335892 3:178867755-178867777 TTGCTGTCTTAAAACAGCAGAGG - Intergenic
966479917 3:180395816-180395838 TTGTTGTCAATGAATACCACTGG + Intergenic
970561649 4:17287467-17287489 GTTCTGTCATTGAACTGAACTGG - Intergenic
972326460 4:38021231-38021253 TCACTATCATAGAACAGCACAGG + Intronic
974767803 4:66370703-66370725 TTTCTGTCATAGACCAGCAGAGG + Intergenic
978409496 4:108411642-108411664 TGGCTGTCTTTGAAGAGCACGGG - Intergenic
979108013 4:116712335-116712357 TTGTTGACATTTAACAGCACTGG + Intergenic
980990750 4:139736380-139736402 TTTATGTTATTGAGCAGCACAGG + Intronic
981810880 4:148772834-148772856 TTGGTGTCCTTTAACATCACTGG - Intergenic
984885699 4:184447318-184447340 TTTCTGTCATTGAACAAAATTGG + Intronic
985097274 4:186425696-186425718 TTGTTGTCATTGACCAGAAAGGG + Intergenic
985246803 4:187987111-187987133 GTGCAGTCTTTGAACAGCAAAGG - Intergenic
985854252 5:2412787-2412809 TTGCAGGCGCTGAACAGCACTGG - Intergenic
988694488 5:33606944-33606966 TTTCTGTTATTGAACTGTACTGG - Intronic
989693423 5:44171419-44171441 TTGCTGGCATGTAACTGCACAGG + Intergenic
991517272 5:67451435-67451457 TTGCTTTCATTGAGCATCATGGG - Intergenic
992029180 5:72703433-72703455 TTACTGTCACTGAACTGAACTGG - Intergenic
992768398 5:80024389-80024411 TGGCTCTCAATGAACAGCATTGG - Intronic
994575533 5:101574305-101574327 TTGCTGCCATGTCACAGCACTGG - Intergenic
994991982 5:107008714-107008736 ATGCTGTCATTGAAAAGGAAGGG - Intergenic
995873501 5:116766589-116766611 TTGCTGTCATGGAATACTACAGG + Intergenic
996475225 5:123910927-123910949 TTGCTGCAATGGAAAAGCACAGG + Intergenic
997911707 5:137880698-137880720 TGGCTGTATTTGAACAGCCCTGG - Intronic
1001995726 5:176156131-176156153 TCGCGGTCATTCCACAGCACTGG + Intergenic
1003746248 6:9005730-9005752 TTGCTGTCATAGCACAGAGCAGG + Intergenic
1005605276 6:27471174-27471196 TACCTGTCATTGAACAGATCAGG - Intronic
1005758260 6:28944792-28944814 TTGCTTTGATGGAACAGAACGGG + Intergenic
1006636963 6:35468083-35468105 ACGCTGTCAGTGAACATCACTGG + Intergenic
1008223193 6:48878761-48878783 ATGATGTCACTGAACACCACTGG + Intergenic
1008283397 6:49622171-49622193 TCACTGTCAGAGAACAGCACGGG - Intronic
1013550950 6:111207446-111207468 TTGCTGACAATCAACAGAACAGG + Intronic
1015805841 6:137107504-137107526 TGGGTGTCACTGAACACCACAGG + Intergenic
1016066597 6:139689371-139689393 TTACTATCATTCAAAAGCACTGG + Intergenic
1016680962 6:146828910-146828932 TTGCTGTTATCGAACAAAACTGG - Intergenic
1017989692 6:159475405-159475427 TTGCTGTGATGGAGCAGAACTGG - Intergenic
1020474659 7:8581498-8581520 TCACTGTCATGGAACAGCAAGGG + Intronic
1020715720 7:11673369-11673391 TTGCTATAGTTGCACAGCACAGG - Intronic
1021471089 7:21003096-21003118 GTCCTGTCATTGAAGTGCACAGG - Intergenic
1023339313 7:39202766-39202788 TTGCTGTCATTTAATAACAAGGG - Intronic
1026601283 7:71779391-71779413 AGGCTGTCATTGAACAGAACTGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030388283 7:108892835-108892857 TTGCTGTTAATTAACAGCACAGG + Intergenic
1033876232 7:145822349-145822371 TGGGGGTCATGGAACAGCACTGG + Intergenic
1034605136 7:152305875-152305897 TTCCTTTCATTGAAGAGCAATGG + Intronic
1036563228 8:9915180-9915202 TTGATGTGATGGAACAACACAGG + Intergenic
1040678224 8:49777332-49777354 TTGCTGTTTTTCAAGAGCACAGG - Intergenic
1040784290 8:51147500-51147522 TTGCAGTCATTGAAAACCAGAGG + Intergenic
1041670738 8:60489337-60489359 ATACAGTCATCGAACAGCACTGG + Intergenic
1042671052 8:71263594-71263616 TTGCTGTCATTGAATTGTCCCGG + Intronic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG + Intergenic
1044380804 8:91530952-91530974 TTGCAGTCATTGTACAGCAGAGG + Intergenic
1046280714 8:112026400-112026422 TTACAATCATTTAACAGCACTGG + Intergenic
1046430371 8:114117066-114117088 TTGCTGTCCTGGAAAATCACTGG + Intergenic
1047438075 8:124851828-124851850 TTGCTGTAACAGAACACCACAGG + Intergenic
1048112634 8:131485357-131485379 GGGCTGTCATTGATAAGCACTGG - Intergenic
1048271693 8:133033473-133033495 GCGCTGTCATAGAACAGCAAGGG - Intronic
1048290670 8:133179009-133179031 GTGCTGTGACTGAATAGCACGGG - Intergenic
1049920878 9:363005-363027 CTGCTGTAATTGAGCAGCTCTGG - Intronic
1050307315 9:4318288-4318310 GTGCTTTCAGTGAACAGAACTGG - Intronic
1051556645 9:18391090-18391112 TTGCTGTTATTAAATAGCAATGG - Intergenic
1055283223 9:74698624-74698646 TTGCTCTCAATAAACTGCACAGG + Intergenic
1057564314 9:96154417-96154439 TCACTGTCATTGAAAAGCTCTGG + Intergenic
1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG + Intronic
1059578598 9:115519251-115519273 TGGCTTTCATTGAACAGAAAGGG - Intergenic
1062200454 9:135300125-135300147 GAGCTGTCCTTGAGCAGCACAGG - Intergenic
1188652726 X:32651943-32651965 TTGCTGACATTTAACATCAAAGG - Intronic
1191058132 X:56265276-56265298 TTGATGTCATTAAACAGTGCTGG - Exonic
1198306242 X:135386091-135386113 TTGCTGTTATTAAACAACAGGGG + Intergenic
1198419420 X:136454773-136454795 TTAATGTCATTGGAAAGCACTGG + Intergenic
1200404369 Y:2794987-2795009 TTGGTGAAATTGCACAGCACTGG - Intergenic
1201144203 Y:11053965-11053987 TGGATGGCATTGAACAGCATTGG + Intergenic