ID: 1179123941

View in Genome Browser
Species Human (GRCh38)
Location 21:38575064-38575086
Sequence CTGAGGCTCTGGAGGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 626}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179123941_1179123953 21 Left 1179123941 21:38575064-38575086 CCCTCTCACCTCCAGAGCCTCAG 0: 1
1: 0
2: 1
3: 48
4: 626
Right 1179123953 21:38575108-38575130 CCAGGGCAGGTGTGAGGTGATGG 0: 1
1: 0
2: 2
3: 66
4: 613
1179123941_1179123950 8 Left 1179123941 21:38575064-38575086 CCCTCTCACCTCCAGAGCCTCAG 0: 1
1: 0
2: 1
3: 48
4: 626
Right 1179123950 21:38575095-38575117 GGTCAGAAAGCAGCCAGGGCAGG 0: 1
1: 0
2: 0
3: 48
4: 577
1179123941_1179123949 4 Left 1179123941 21:38575064-38575086 CCCTCTCACCTCCAGAGCCTCAG 0: 1
1: 0
2: 1
3: 48
4: 626
Right 1179123949 21:38575091-38575113 TGCAGGTCAGAAAGCAGCCAGGG 0: 1
1: 0
2: 3
3: 36
4: 320
1179123941_1179123951 15 Left 1179123941 21:38575064-38575086 CCCTCTCACCTCCAGAGCCTCAG 0: 1
1: 0
2: 1
3: 48
4: 626
Right 1179123951 21:38575102-38575124 AAGCAGCCAGGGCAGGTGTGAGG 0: 1
1: 0
2: 7
3: 73
4: 527
1179123941_1179123948 3 Left 1179123941 21:38575064-38575086 CCCTCTCACCTCCAGAGCCTCAG 0: 1
1: 0
2: 1
3: 48
4: 626
Right 1179123948 21:38575090-38575112 GTGCAGGTCAGAAAGCAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179123941 Original CRISPR CTGAGGCTCTGGAGGTGAGA GGG (reversed) Intronic
900099749 1:956737-956759 CTGAGGCTGTGCTGGTGGGAGGG - Intronic
900175707 1:1290542-1290564 CCCAGGCCCTGCAGGTGAGACGG + Exonic
900236530 1:1594264-1594286 GCCAGGCTCTGGAGGTGAGCAGG + Intergenic
900573715 1:3372813-3372835 CTCAGGCTCTGGAGGAGGGTGGG - Intronic
900733121 1:4276030-4276052 CGGCGTATCTGGAGGTGAGAAGG + Intergenic
900976255 1:6018432-6018454 GTGGGGCTCTGGGGGTGATAAGG + Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901799787 1:11701353-11701375 CCGAGGCTCTGGGGGCGAGGGGG - Intronic
901857037 1:12051261-12051283 TGGAGGCTCTGGACTTGAGAAGG - Intergenic
901879307 1:12184789-12184811 CTCAGGCCCTGGAGGAGTGAGGG + Intronic
902808263 1:18874122-18874144 CTGAGGCTCAGGAGGAGCAATGG - Intronic
903302026 1:22386014-22386036 CTGAGGCCCTGGAGTAGAGGGGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905562806 1:38940922-38940944 CTGAGGCTCAGGAGGTAAACAGG + Intronic
906531311 1:46525571-46525593 CCAAGGGGCTGGAGGTGAGATGG - Intergenic
907327800 1:53652266-53652288 CTGAGGATGTGGAGATGAGTTGG + Intronic
907377353 1:54054511-54054533 TTGAATCTCTGAAGGTGAGAGGG + Exonic
907986376 1:59535085-59535107 GTGTGTCTCTGCAGGTGAGATGG - Intronic
908787691 1:67751483-67751505 TTGAGGCTCTGGAGGAGACTGGG - Intronic
909370632 1:74879243-74879265 CTGTGTCTCTGCACGTGAGATGG - Intergenic
909674456 1:78223719-78223741 CTGAGAATTTGAAGGTGAGATGG + Intergenic
911516971 1:98879481-98879503 GTGTGTCTCTGGATGTGAGATGG + Intergenic
912179710 1:107204998-107205020 CTGAGGCTCTGGCAGAGGGAAGG - Intronic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912751296 1:112290228-112290250 CTGTGTCTCTGCATGTGAGATGG - Intergenic
912951755 1:114125089-114125111 CTGATGCACTTGAGGTGGGAGGG - Intronic
912997827 1:114549332-114549354 CTGAGGCTGTGGAATTGAGAGGG - Intergenic
913109384 1:115643328-115643350 CCCAGGCTCTGCAAGTGAGATGG + Intronic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913517345 1:119615825-119615847 CTGAGGCCTGGGAAGTGAGATGG + Intergenic
913589873 1:120313353-120313375 CATAGGCTCTGAAGGCGAGAAGG - Intergenic
913618312 1:120585013-120585035 CATAGGCTCTGAAGGCGAGAAGG + Intergenic
914255510 1:145958992-145959014 CTGAGCCACTGTAGGAGAGATGG - Intergenic
914333936 1:146698197-146698219 CTGGGGCTCCAGAGGTGATAGGG - Intergenic
914571902 1:148925210-148925232 CATAGGCTCTGAAGGCGAGAAGG - Intronic
914600934 1:149205050-149205072 CATAGGCTCTGAAGGCGAGAAGG + Intergenic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915862050 1:159455066-159455088 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
916459965 1:165013481-165013503 CTGAGAATCTGGAGTTGGGATGG + Intergenic
916533778 1:165683398-165683420 CTGAGGCTCTGAAAGTCACAGGG + Intronic
917712018 1:177694757-177694779 CTGTGTCTCTGCATGTGAGATGG - Intergenic
917741414 1:177964941-177964963 ATGGGCTTCTGGAGGTGAGATGG + Intronic
918968012 1:191376673-191376695 GTGAGTCTCTGCACGTGAGATGG + Intergenic
919339000 1:196279378-196279400 CTCAGACTCAGGAGGAGAGACGG + Intronic
919767218 1:201135181-201135203 CTGAGGCGCTGGGGCTGGGAGGG + Exonic
921065466 1:211619511-211619533 TTTGGGCTCTGGAGGTGGGAAGG - Intergenic
921894187 1:220381810-220381832 CTAAGGCGCTCCAGGTGAGAGGG + Intergenic
921976564 1:221209152-221209174 GTGAGACTTTGGACGTGAGATGG - Intergenic
923783778 1:237048732-237048754 CTGATGCTCTGTGGGTGAGTTGG + Intronic
923860160 1:237885223-237885245 CTGAAGCGCTGGTGGTGAGAGGG + Exonic
924383501 1:243483510-243483532 AGGAGGCACTGGAGGAGAGAGGG - Intronic
1063528553 10:6808032-6808054 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1063554116 10:7061922-7061944 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1064113313 10:12556915-12556937 CAGAAGCTCTGGAGTTGGGATGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1065077123 10:22091524-22091546 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1066264964 10:33767589-33767611 CTAAGGGGCTAGAGGTGAGAAGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067514663 10:46927920-46927942 CTGAGGTTCAGGAGGTTGGAGGG + Intronic
1067559522 10:47295187-47295209 CTGATGCTGTGGTGGTGAGTTGG - Intergenic
1067647596 10:48123893-48123915 CTGAGGTTCAGGAGGTTGGAGGG - Intergenic
1068149453 10:53113496-53113518 GTGTGGCTCTGCACGTGAGATGG - Intergenic
1068165620 10:53328373-53328395 CTGAAGCTCATGAGGAGAGATGG - Intergenic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1069636096 10:69925859-69925881 ATGAGGCTCTCCAGGTGAGCAGG + Exonic
1069695439 10:70382346-70382368 CGGAGGCTCTGGCGGTGCCAAGG - Intronic
1069833982 10:71297153-71297175 CTCAGACTTGGGAGGTGAGAGGG - Intronic
1069900266 10:71702814-71702836 CAGAGGCTCTGGAGATGTGGAGG + Intronic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1071165252 10:82798946-82798968 CAGAGGCTCTGCAGGTGACTGGG + Intronic
1072388575 10:94958520-94958542 GTGAGTCTCTGCATGTGAGATGG + Intronic
1072568947 10:96641948-96641970 CAGTGGCTCTGTAGGTGACAAGG - Intronic
1072743960 10:97927190-97927212 AGGAGGAACTGGAGGTGAGAAGG - Intronic
1072852037 10:98906110-98906132 CTGAAGCTCTGGAGCTGGGATGG - Intronic
1073653811 10:105390519-105390541 CTGAATCTCTGGGGGTGGGAAGG + Intergenic
1074162247 10:110844657-110844679 TGGAGGCTGTGGGGGTGAGAAGG - Intergenic
1074597599 10:114881695-114881717 CTGAGGCTCTGCGGGTGATCAGG - Intronic
1075165438 10:120063901-120063923 CTGAGAAGCTGGAGGTGAGTTGG + Intergenic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077616274 11:3676285-3676307 CTGAGGGTCTGGTGTTGAGTCGG + Exonic
1077658635 11:4046441-4046463 CAGAGGCATGGGAGGTGAGAAGG - Intronic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1079545131 11:21624684-21624706 CTGTGGCACTGGACATGAGATGG + Intergenic
1081646476 11:44793823-44793845 CTGAGGCCCTGGAGAGGAGGAGG + Intronic
1082957385 11:58885011-58885033 CTGAGTCCCTGAAGGTGAGGGGG + Intronic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083254080 11:61485732-61485754 CTGAGCCTCTGGAGGACACATGG + Intronic
1083307863 11:61770231-61770253 GTGGGGCTCTGCAGGAGAGATGG - Exonic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1083637585 11:64128819-64128841 CTGGGGATCTGGAGGTGTGGAGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085297056 11:75437255-75437277 TGGCGGCTCTGGAGGTAAGAGGG - Intronic
1085618732 11:78021923-78021945 GTGAGCTTCTGGAGGTGAGGGGG - Intronic
1086434157 11:86764823-86764845 CAAAGGCTCTGGAGGTGATCTGG - Intergenic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1086519766 11:87656450-87656472 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1088884121 11:113993896-113993918 ATGAGGCTGTGGTGGGGAGACGG + Intergenic
1089043335 11:115475077-115475099 CTGAGGATTTGGGTGTGAGAAGG - Intronic
1089647478 11:119889706-119889728 CTGAGGCTCTGGAGCCTGGAAGG - Intergenic
1089754741 11:120678340-120678362 CTGAGGCTGTGGTGCTCAGAAGG + Intronic
1090183602 11:124721607-124721629 GTGAGCACCTGGAGGTGAGAGGG - Intergenic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1091347515 11:134864964-134864986 CTGAGGCTCTGAAGGTGGTGGGG + Intergenic
1091412567 12:253763-253785 CTGAGGCTCTGAAGAGGAGTTGG + Intronic
1092099908 12:5874424-5874446 CTGCAGCTCTGGAGTTGGGAAGG - Intronic
1092173110 12:6385391-6385413 CTGAGGGGCTGGATGTGAAAAGG + Intronic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1092937320 12:13376215-13376237 CAGAGGCTGTGGAGGTGAGTGGG - Exonic
1093275368 12:17118599-17118621 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1093399508 12:18727469-18727491 CTGAGTCTTCAGAGGTGAGAAGG + Intronic
1093782065 12:23148084-23148106 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1094709617 12:32948439-32948461 CTGATGTACTGGGGGTGAGATGG + Intergenic
1095406524 12:41872404-41872426 GTGAGTCTCTGCATGTGAGATGG - Intergenic
1095845467 12:46739224-46739246 GTGTGGCTCTGCACGTGAGATGG - Intergenic
1096357348 12:50952548-50952570 CTGTGGCTCTTGAGGTGGGTCGG - Intergenic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096548137 12:52355439-52355461 CTGACACTTTGGAGATGAGATGG + Intergenic
1097321428 12:58230827-58230849 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1099538359 12:83873200-83873222 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100271454 12:93029237-93029259 CTGGAGCCCTGGGGGTGAGAGGG - Intergenic
1100329651 12:93571558-93571580 CTGCGACCCTGGAGGTGGGAAGG - Intronic
1100373963 12:93995001-93995023 CTCAGCCTCTGGAGGTGACTAGG - Intergenic
1100854268 12:98745274-98745296 CAGATGCTTTGGAGGTGGGAGGG + Intronic
1101768342 12:107724327-107724349 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1102028875 12:109728648-109728670 GTGGGGCTCTGGAGGTGAGCAGG - Intronic
1102545336 12:113650414-113650436 GTGGGGCTCTGCAGGTGAGGGGG + Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1103203412 12:119108708-119108730 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1103973803 12:124688934-124688956 ATGAGGCTTTGGAGATGTGAGGG + Intergenic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104573944 12:129949513-129949535 GTGAGCCTCAGGAAGTGAGAAGG - Intergenic
1105018176 12:132798803-132798825 CTGAGCCCCTGTAGGTGAGGAGG + Intronic
1105306408 13:19172111-19172133 GTGAGACTCTGGCGGTCAGAAGG + Intergenic
1105417490 13:20225980-20226002 CTGAGGCTCAGGCTGTGTGAAGG + Intronic
1105620333 13:22060425-22060447 ATGAGGCACGGGAGGAGAGATGG + Intergenic
1106501879 13:30336684-30336706 TGGAGGCACTGGAGGGGAGAAGG - Intergenic
1106857843 13:33872228-33872250 CAAAGGCACTGGAGGGGAGAAGG + Intronic
1106961641 13:35005396-35005418 GTGAGACTTTGGAGGAGAGAGGG + Intronic
1107660560 13:42635038-42635060 CTGAGGCTCTGGATTTAGGATGG - Intergenic
1111041686 13:82757239-82757261 CTCAGGCTCTCCAGGTGAGTGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112373540 13:98816887-98816909 ATGAGGCTGTGGAGGTGGGAAGG + Intronic
1112415981 13:99203797-99203819 CTGAGGCTCAGATGGTGTGAAGG + Intronic
1112506501 13:99979526-99979548 CAGAGGCTGCGGAGGTGTGAAGG - Intergenic
1113638397 13:111938117-111938139 CCGAGGGCCTGGAGGTGGGAAGG + Intergenic
1115394945 14:32897831-32897853 ATGTGGCTCTGGAAGTGAGAGGG + Intergenic
1116223357 14:42115343-42115365 CTGAGGCACTGGAGATCAGGTGG - Intergenic
1118104165 14:62638796-62638818 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1118592233 14:67410392-67410414 CTGCGGCTTGGGAGGTGGGAGGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1120693351 14:87617881-87617903 ATGAAGCTCTGGATCTGAGATGG + Intergenic
1120778060 14:88459602-88459624 GTGAGTCTCTGCATGTGAGATGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121659025 14:95620902-95620924 CTGATGCTCAGGAAGTGAGTCGG + Intergenic
1122099341 14:99394784-99394806 CTGCTGCTCTGGAGGTGAGCAGG - Intergenic
1122181535 14:99958607-99958629 CAGAGGCACAGGAGGTCAGAGGG + Intergenic
1122638525 14:103142567-103142589 CTGAGGATCTGGCGATAAGATGG - Intergenic
1124822355 15:33059045-33059067 CAGAGGCTGGGGATGTGAGACGG - Intronic
1125329186 15:38565210-38565232 GAGAGGCCCTGGAGGGGAGAAGG - Intronic
1125365399 15:38909548-38909570 CTGTGTCTCTGGAGGTGAAGTGG + Intergenic
1125747879 15:42009567-42009589 CTGAGGCTGGGGAAGTGAGCAGG - Intronic
1126086829 15:45018901-45018923 GTGAGTCTCTGCAGGTGAGATGG + Intergenic
1127057355 15:55145415-55145437 GTGAGTCTCTGCACGTGAGATGG - Intergenic
1127193936 15:56563650-56563672 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127980176 15:64029313-64029335 CAGAGGCTGTGGATGAGAGAGGG - Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128339620 15:66811875-66811897 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128758444 15:70198673-70198695 GTGAGGCTGTGCAGCTGAGAGGG + Intergenic
1128767874 15:70262060-70262082 CTGATGGCCTAGAGGTGAGAAGG - Intergenic
1129467194 15:75730837-75730859 CTGAGGCTGTGTCCGTGAGAGGG + Intergenic
1129468403 15:75737244-75737266 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1129696280 15:77742223-77742245 CAAAGCCTCTGAAGGTGAGAAGG + Intronic
1129720034 15:77872882-77872904 CTGAGGCTGTGTCAGTGAGAGGG - Intergenic
1129727165 15:77907253-77907275 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130270486 15:82443794-82443816 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1130275482 15:82474032-82474054 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130462830 15:84171113-84171135 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1130467842 15:84201427-84201449 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130485844 15:84398081-84398103 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1130489844 15:84423674-84423696 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130496423 15:84472115-84472137 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1130501435 15:84502424-84502446 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1130590134 15:85206025-85206047 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1130923369 15:88367218-88367240 CTGAGGCTCAGGGGGTGGGGTGG + Intergenic
1131024780 15:89130998-89131020 CAGAGGCACTGAAGGAGAGATGG - Intronic
1131523512 15:93134719-93134741 CTGAAACTCAGGGGGTGAGAAGG - Intergenic
1132256938 15:100384238-100384260 TTGAGGCTCTGAAGGGGACATGG + Intergenic
1132287139 15:100671462-100671484 CTGAGTCTCTGGGAGTGAGGTGG - Intergenic
1132575820 16:663526-663548 CTGAGGCTCAAGAGGTCAGGAGG + Intronic
1133381080 16:5331052-5331074 CTGAGGATCTGGAGGTGATGTGG + Intergenic
1133416120 16:5608356-5608378 GGGAAGCTCTGGAGGTGTGAGGG + Intergenic
1133528733 16:6632585-6632607 ATGAGTCTCTTGAGGTTAGAAGG + Intronic
1133928265 16:10211270-10211292 CTGAGGCACTGGAGTGGAGGAGG + Intergenic
1135922434 16:26663315-26663337 CTGAGTCTCTGAAGGAGAGCAGG + Intergenic
1136050132 16:27644354-27644376 AGGAGGCTCTGGAGCTAAGAGGG - Intronic
1136092149 16:27928242-27928264 CTGAGGCTCAGGAGGTTGAAAGG + Intronic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137074578 16:35945940-35945962 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1137075595 16:35957246-35957268 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1137585071 16:49659482-49659504 CTGAGGCCCTTGAGGTCTGAGGG + Intronic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137778218 16:51074192-51074214 GTGAAGCTATGAAGGTGAGAGGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138436708 16:57004867-57004889 CTGAGTCTGAGGAGGTGCGAGGG - Intronic
1138495310 16:57405313-57405335 CTGAGCCAGTGGAGATGAGAAGG + Intronic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139657754 16:68399308-68399330 GTGAAGGTCAGGAGGTGAGAAGG + Intronic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1139999682 16:71013052-71013074 CTGGGGCTCCAGAGGTGATAGGG + Intronic
1140684416 16:77419395-77419417 ATGGGGCTCTAGGGGTGAGAAGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141713452 16:85713691-85713713 CTGAGGCCCTGGGGGCGAGGAGG + Intronic
1141717012 16:85732743-85732765 CTGGGTCTCTGGAGGTGATGAGG - Intronic
1141774253 16:86111584-86111606 CTGAGGCACTGGGAGGGAGAGGG + Intergenic
1141803555 16:86327333-86327355 CTGAGGCTCAGGAGGTGATGAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142283815 16:89162896-89162918 CAGAGGCTCAGGAGGCCAGAGGG - Intergenic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1143730517 17:8880299-8880321 CTGAGGCTCTGGTGCTCAGGGGG - Exonic
1144388281 17:14770387-14770409 CTCAGGCTCTGTTGGGGAGAGGG - Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144688810 17:17245435-17245457 CTTAGGCTTTGGAGGTCATATGG - Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144735902 17:17555376-17555398 CCGAGGCTCGGGAGGTGGGCCGG - Intronic
1144885703 17:18458470-18458492 CTGAGGAATTGGAGTTGAGATGG + Intergenic
1145146510 17:20485901-20485923 CTGAGGAATTGGAGTTGAGATGG - Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146154048 17:30504782-30504804 CTGAGGAACTGGAGTTGAAATGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146472391 17:33134967-33134989 AGAAGGCCCTGGAGGTGAGAGGG + Intronic
1146519480 17:33515187-33515209 CTGAAGCTCTGGGGTTGGGAGGG + Intronic
1147164795 17:38587370-38587392 CTCAGACTCTGGTGGTGAGGTGG + Intronic
1147370989 17:39992851-39992873 CTGAGGCCCAGGTGGTGAGAAGG - Intronic
1147532372 17:41291906-41291928 CTGAGGCCCTGGATAAGAGATGG + Intergenic
1147862788 17:43533341-43533363 CATAGGCACTGGAGTTGAGAAGG + Exonic
1148190545 17:45675714-45675736 CTGAGGCTCAAGAGGTTATAAGG + Intergenic
1149308247 17:55369981-55370003 CTGAAGCCCTAGAAGTGAGATGG + Intergenic
1149686600 17:58539103-58539125 CTGACTCTCTGGAGGTAGGATGG - Exonic
1150655223 17:67034758-67034780 CTGAGGCTCAGGTGCAGAGATGG - Intergenic
1151393938 17:73807459-73807481 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152097002 17:78278318-78278340 CTGAGGCCCTGGGGGTGGGCAGG - Intergenic
1152163032 17:78681367-78681389 CTGAGGCTTCAGAGGTGAGTGGG - Intronic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1153058764 18:974751-974773 GTGAGTCTCTGCACGTGAGATGG + Intergenic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1154120880 18:11651638-11651660 ATGAGTCACTGGGGGTGAGAGGG + Intergenic
1154351073 18:13583959-13583981 CTGAGGCTGCGGAGATGGGAAGG - Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156521848 18:37728571-37728593 AGGAAGCTCTGGAGGTGAAAGGG - Intergenic
1157817217 18:50738334-50738356 TGGGGGCTCTGGCGGTGAGAAGG + Intergenic
1158539701 18:58341784-58341806 CTGCCCCGCTGGAGGTGAGACGG + Exonic
1159602989 18:70446297-70446319 CTGAGGCTAAGAGGGTGAGAAGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159844286 18:73440143-73440165 CTGAGGCTCTGGCAGTGACCTGG + Intergenic
1159903173 18:74066867-74066889 CTGAGCCTCAGTAGATGAGAGGG + Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1159995780 18:74962563-74962585 CTGAGGCGCAGGATGTGGGAAGG - Intronic
1160165059 18:76503863-76503885 CTGCGCCTCTGGAAGAGAGAGGG + Intergenic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1162154002 19:8664461-8664483 CTGAGGCTCAGGAGGTGCCGGGG + Intergenic
1162779345 19:12998556-12998578 CTGAGTCTCAGGCGGAGAGAGGG + Intronic
1162947864 19:14054612-14054634 GGGAGGCTCTGGAGGAGAGGAGG - Exonic
1163165329 19:15493594-15493616 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1164091248 19:21954722-21954744 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1164111050 19:22159413-22159435 GTGTGTCTCTGGATGTGAGATGG + Intergenic
1164132942 19:22382562-22382584 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1164165875 19:22674171-22674193 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164550849 19:29211397-29211419 CTTGGGACCTGGAGGTGAGAAGG - Intronic
1164971108 19:32533265-32533287 GTGTGGCTCCGGAGGTAAGAGGG - Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165739137 19:38195339-38195361 CAGAAGCTCTGGAGTTGAGATGG - Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166282961 19:41807460-41807482 CTGAGTCCCTGGACTTGAGAGGG - Intronic
1167745739 19:51350815-51350837 CTCAGGCTCTGCAGGTCATACGG + Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1168481915 19:56727328-56727350 CAGGGGCTTTGGAAGTGAGATGG - Intergenic
1168635897 19:57996625-57996647 CACAGGCTGTGGAGATGAGAGGG + Intronic
1202673822 1_KI270710v1_random:22214-22236 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
927631207 2:24775705-24775727 TTGAGGTGCTGGAGGTGGGAGGG - Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
929012614 2:37460278-37460300 GTGAGAATTTGGAGGTGAGAGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930268778 2:49231578-49231600 GTGAGTCTCTGCACGTGAGATGG + Intergenic
931066812 2:58596834-58596856 CAGAGGCTTTGGGGGTCAGATGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931477843 2:62607475-62607497 CTGTGTCTCTGCACGTGAGATGG - Intergenic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
931985971 2:67742853-67742875 CTGTGTCTCTGCATGTGAGATGG + Intergenic
932337231 2:70938234-70938256 CTCAGGCTCTGGGAGTGGGAGGG + Intronic
932453318 2:71830003-71830025 CTGAGTCCCAGGAAGTGAGAGGG + Intergenic
933919514 2:87030594-87030616 CTGAGGCTCTGGAGGGGCCCTGG - Intergenic
934003480 2:87739308-87739330 CTGAGGCTCTGGAGGGGCCCTGG + Intergenic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934571862 2:95377565-95377587 CAGAGGCTGTGGATGTGACAGGG + Intronic
934877478 2:97938282-97938304 GTGTGTCTCTGCAGGTGAGATGG - Intronic
934926892 2:98388448-98388470 CTTCGGCCCTGGAGGGGAGAGGG + Intronic
935018015 2:99202402-99202424 CTGAGACTCTGGAGCAGAGGTGG - Intronic
936047382 2:109197956-109197978 GTGAGGCCCAGGAGGTCAGAGGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
938384367 2:130853822-130853844 GTGTGGCTCAGGAGGTGAGCCGG + Intronic
938567376 2:132531107-132531129 ATGTGTCTCTGCAGGTGAGATGG - Intronic
939777832 2:146407857-146407879 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
941548634 2:166886411-166886433 ATGAGTCTTTGGAGATGAGAGGG + Intergenic
941625289 2:167824634-167824656 CTTAGGCTCTGGAGGCTTGAGGG - Intergenic
941625488 2:167826295-167826317 CTTAGGCTCTGGAGGCTTGAGGG - Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
942611515 2:177746781-177746803 CAGAGACTCTGAGGGTGAGAGGG + Intronic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942865620 2:180670864-180670886 ATGGGACTCTGGAGCTGAGAGGG - Intergenic
944714018 2:202361114-202361136 CTGAAGCTTTGTAGGGGAGAGGG - Intergenic
945355421 2:208833824-208833846 GTGTGTCTCTGCAGGTGAGATGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945776487 2:214112709-214112731 GTGTGTCTCTGCAGGTGAGATGG + Intronic
946190917 2:218007551-218007573 CTGAGGCTCGGGGGGTGGGGGGG + Intergenic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
948029506 2:234805476-234805498 CTTAGCCTCAGGAGGGGAGAAGG - Intergenic
948532234 2:238616617-238616639 CTGAGGGTCTTGAAGTGAGGAGG + Intergenic
948698391 2:239745597-239745619 CTGAAGCTCTGGGGCTGGGATGG - Intergenic
949058612 2:241943567-241943589 CTGAGGCCCAGGAGTTAAGAGGG + Intergenic
1168983501 20:2027275-2027297 CTGAGCCTGTGGGGGTAAGAGGG + Intergenic
1169260109 20:4131498-4131520 CAGGGGCTCTGGAGGAGGGAGGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169305652 20:4488151-4488173 CTCAGGCTCTGGAGGTGCCAGGG - Intergenic
1169426169 20:5498905-5498927 GTGGGGCTTTGGAGGTGAGGAGG + Intergenic
1170111035 20:12804908-12804930 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1171054193 20:21889771-21889793 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1171371647 20:24666111-24666133 CTGAGGCTGGGGTGGTGTGAAGG - Exonic
1171514402 20:25717542-25717564 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1171791308 20:29528014-29528036 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1171935039 20:31266919-31266941 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1171977777 20:31606253-31606275 CTGAGGCACTGGCGAGGAGAGGG + Exonic
1172175605 20:32970287-32970309 CTGAGGCGCAGGAGGTGATGAGG + Intergenic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173252852 20:41373819-41373841 CTGGGGCTCTGGGTGTGGGAAGG + Intergenic
1173430388 20:42982649-42982671 ATGAGGCCATGGAGGTGAGCAGG + Intronic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1174379318 20:50146563-50146585 CTGAGGCTCAGGGAGAGAGAAGG + Intronic
1175723863 20:61303654-61303676 CAATGGCGCTGGAGGTGAGAAGG - Intronic
1176257351 20:64159247-64159269 CTGAGGGTCTGGATGTGGTAGGG - Intronic
1176638115 21:9268160-9268182 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1177025932 21:15921405-15921427 ATGAGTCTCTGCACGTGAGATGG + Intergenic
1177142637 21:17374307-17374329 GTGAGTCTCTGCATGTGAGATGG - Intergenic
1178274272 21:31222451-31222473 CTGCCGCTCTAGAGGTCAGATGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179502659 21:41819886-41819908 CTGAGGACCTGGAGGGGTGAGGG + Intronic
1179880953 21:44293162-44293184 CTGAGGGTCAGCAGGTGAGCGGG + Exonic
1179974656 21:44857618-44857640 CCCAGCCCCTGGAGGTGAGACGG - Intronic
1180422155 22:12875657-12875679 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1180502106 22:15939344-15939366 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1180712851 22:17851429-17851451 CAGAGGCTCTGCTGGGGAGAGGG + Intronic
1181266041 22:21631507-21631529 CCGAGGGTCTGCAGGTGGGAAGG + Intergenic
1182453231 22:30433401-30433423 CAGAGGCTCCAGAGGTGAAAGGG - Intergenic
1183185225 22:36288093-36288115 CTGAGTCTCTGTCAGTGAGATGG + Intronic
1183248092 22:36709483-36709505 CTGCTGCCCTGGAGGTGATATGG - Intergenic
1183376119 22:37466468-37466490 CTGAGGCACAGAAGGGGAGAAGG - Intergenic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184073445 22:42161336-42161358 GTGAGACTGTGGAGATGAGAAGG - Exonic
1184261046 22:43316575-43316597 GTGGGGCTGTGGAGGTGAGCAGG - Intronic
1184316109 22:43690644-43690666 GTGAGGCTAGGGAGGTGAGCAGG - Intronic
1184512326 22:44940893-44940915 GTGGGGCTGTGGAGGTGAGTGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1185285562 22:49998284-49998306 CTGAGGCACTGGAGGTGCTGTGG - Exonic
949337127 3:2987058-2987080 CTGAGATCCTGAAGGTGAGAAGG + Intronic
949482800 3:4510106-4510128 CTGGGGCTGTGAAGGTGAGTGGG + Intronic
949518651 3:4829860-4829882 CTGAGGCTCAGGGGGAGGGAGGG - Intronic
949570190 3:5285217-5285239 CTTCAGCTCTAGAGGTGAGATGG + Intergenic
950082613 3:10234371-10234393 TTGCAGCTCTGGAGGTGAGTGGG + Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952893487 3:38060535-38060557 CTGGGGCTTGGGAGCTGAGAAGG + Intronic
953035465 3:39206843-39206865 CACAGGCCCTGGAAGTGAGATGG - Intergenic
953742808 3:45551821-45551843 ATGAGGCCCTGGAGGGGAGGTGG + Intergenic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955030445 3:55211368-55211390 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
955211698 3:56947381-56947403 ATGTGTCTCTGCAGGTGAGATGG - Intronic
955428620 3:58818394-58818416 CTGTGTCTCTGCACGTGAGATGG - Intronic
955630099 3:60964320-60964342 GTGTGTCTCTGCAGGTGAGATGG + Intronic
955670390 3:61395507-61395529 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
955936910 3:64110785-64110807 ATGAGGCTCAGAAGGTGAAAAGG + Intronic
957354500 3:79063926-79063948 CAGAGGCTGGGGAGGAGAGATGG + Intronic
957886905 3:86299272-86299294 CTGTGTCTCTGCACGTGAGATGG - Intergenic
958064691 3:88528524-88528546 ATGAGCCACTGGTGGTGAGATGG + Intergenic
958624312 3:96605227-96605249 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
959052618 3:101539086-101539108 TTGAGCCTCTGCAGGTGAGATGG + Intergenic
959723749 3:109521335-109521357 CTGTGTCTCTGCATGTGAGATGG + Intergenic
960363663 3:116745092-116745114 CTGTGTCTCTGCATGTGAGATGG - Intronic
961795426 3:129405351-129405373 AAGGGGCTGTGGAGGTGAGAAGG + Intronic
962326186 3:134434521-134434543 CTGAGGCTGGGGTGGTGGGAGGG - Intergenic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
962381182 3:134899247-134899269 CTGAAGCCCTGCAGCTGAGAAGG - Intronic
963032240 3:140989807-140989829 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
964305317 3:155333434-155333456 CTGAGGGTCTGGAGCTGGGCCGG + Intergenic
965015335 3:163150361-163150383 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
965445407 3:168768335-168768357 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
965522468 3:169681604-169681626 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
966140105 3:176747597-176747619 CAGAGCCTCTGAAGGAGAGATGG - Intergenic
967736977 3:192963516-192963538 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
968040958 3:195588939-195588961 CTCAGTCTCTGAAGGTTAGAGGG - Intergenic
1202748779 3_GL000221v1_random:136861-136883 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
968611096 4:1557526-1557548 TTGAGGCTCTGGCGGGGAGTGGG - Intergenic
968611113 4:1557574-1557596 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611143 4:1557671-1557693 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611159 4:1557719-1557741 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968699540 4:2048020-2048042 CTGAGGCTGTGGGGATGAGGTGG + Intergenic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
968964233 4:3761454-3761476 CTGAGGCCCTGGAAGCCAGAAGG + Intergenic
969440431 4:7213673-7213695 CCGAGGCCCAGGAGGTGAGTGGG + Intronic
970014989 4:11503497-11503519 CTGAGGCTCTCAGGGTTAGAGGG + Intergenic
970180214 4:13384077-13384099 GTGAGGCTCTGGAGGTGGTGGGG - Intronic
970917685 4:21354402-21354424 GTGTGTCTCTGCAGGTGAGATGG - Intronic
971393534 4:26207684-26207706 CTGATGCTCTGCTGGGGAGAGGG + Intronic
972213706 4:36870537-36870559 CTAAGGCACTGCAGGTGGGAAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973771817 4:54213715-54213737 CTAAGGCCCTGGAGGCAAGAAGG + Intronic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
974678855 4:65135475-65135497 TTGTGTCTCTGGAGGTGAGGTGG - Intergenic
975232375 4:71949808-71949830 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
975518628 4:75274469-75274491 GTGAGTCTCTGCACGTGAGATGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976957067 4:90913745-90913767 CTGTGTCTCTGCACGTGAGATGG - Intronic
977478184 4:97539296-97539318 CTGTGTCTCTGCATGTGAGATGG - Intronic
977554701 4:98477082-98477104 CAGAGGATCTGTAGGTGAAAGGG + Intronic
978150508 4:105428453-105428475 CTGTGTCTCTGCACGTGAGATGG - Intronic
979177639 4:117684037-117684059 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
980139482 4:128897776-128897798 GTGTGTCTCTGCAGGTGAGATGG - Intronic
980216256 4:129856021-129856043 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
980587149 4:134831903-134831925 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
980744892 4:137000763-137000785 CTCAGCCTGTGGGGGTGAGATGG - Intergenic
981422149 4:144563480-144563502 CTTACGCTCTGGAGGTGGGGTGG + Intergenic
981439897 4:144770794-144770816 GTGAGTCTCTGCACGTGAGATGG - Intergenic
981959972 4:150524910-150524932 GTCAGGCTTTGGAGTTGAGATGG - Intronic
982313563 4:154009577-154009599 CTCTGGCTCTGGAGGTGACTGGG + Intergenic
1202753016 4_GL000008v2_random:26577-26599 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
985627489 5:997138-997160 ATGAGGCTCTGTAGGTCAAAAGG - Intergenic
986894455 5:12348192-12348214 CTAAGACTCTGGAGGTGTGTTGG + Intergenic
987424028 5:17753492-17753514 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
988734055 5:34002955-34002977 CTGAAGCTTTGGAGATGAGGGGG + Intronic
988842734 5:35098691-35098713 CTCAAGCTTTGAAGGTGAGAAGG + Intronic
989345080 5:40421075-40421097 GTGTGTCTCTGGATGTGAGATGG + Intergenic
989522245 5:42416202-42416224 GTGAGCCTCTGCATGTGAGATGG + Intergenic
989583488 5:43055368-43055390 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
989627318 5:43442725-43442747 CTATGTCTCTGCAGGTGAGATGG + Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990556745 5:56944037-56944059 GTGAGGAAATGGAGGTGAGAGGG - Intronic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
991970192 5:72133343-72133365 GTGAGGCGCTGGAGGCGGGATGG + Intronic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
992604215 5:78439102-78439124 GTGTGTCTCTGCAGGTGAGATGG + Intronic
994538285 5:101059649-101059671 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
996232620 5:121085039-121085061 CTGCGTCTCTGCACGTGAGATGG + Intergenic
996594221 5:125183324-125183346 CTCAGGCTCTTGAAGAGAGAAGG - Intergenic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
997374585 5:133388150-133388172 CAGAGGCTCTTGAAATGAGAAGG - Intronic
997398395 5:133582532-133582554 CTGAGACTCTGGAGTGGGGAGGG + Intronic
997652676 5:135534173-135534195 CAGAGGCTTTGGAGGTGAGTGGG + Intergenic
997692195 5:135834484-135834506 CTGAGGCTCTGAAGTTGGCAAGG + Intergenic
997720840 5:136077398-136077420 CTGAGGCTCTTGAATTAAGATGG + Intergenic
998170272 5:139868644-139868666 CTGAGGCCCGGGAGGTGGGGTGG - Intronic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
1001787363 5:174425425-174425447 GTGAGGCTGTGGGGCTGAGATGG - Intergenic
1002192030 5:177483414-177483436 TTGTGGCACTGGAGGTGAAAGGG + Exonic
1002399651 5:178984551-178984573 CTGAGGCTGGGGAGGAGAGCTGG + Intronic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002639381 5:180623487-180623509 AAGAGGCTCTGGAGGTGTGTAGG + Intronic
1002669556 5:180855600-180855622 ATGAGGCTCTGTAATTGAGAGGG - Intronic
1002822846 6:743839-743861 TTGAGGCTCTGCAGGCCAGATGG - Intergenic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003413758 6:5890040-5890062 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1003802289 6:9683887-9683909 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1005202478 6:23362860-23362882 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1005239376 6:23806168-23806190 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1005990660 6:30899729-30899751 CTGAGAATCTGGGGGTGAGGAGG + Intronic
1006183758 6:32168988-32169010 CTGAGTCACTGGAGATGAGGGGG + Exonic
1006365172 6:33611014-33611036 CTGAGGCTCCAGAGTGGAGAGGG - Intergenic
1006416757 6:33908938-33908960 GCCAGGCTCTGGATGTGAGAAGG + Intergenic
1007162684 6:39804941-39804963 CTGGAGCTCTGGAGGTGGGCGGG - Intronic
1007589133 6:43010984-43011006 CTGAGGCTGTTCAGGTGGGAGGG + Exonic
1007679965 6:43627254-43627276 TTGAGGCCCTGGAGGTGGGGAGG - Intronic
1007753234 6:44082642-44082664 CTGAGGCTGAGCAGGTGAAATGG + Intergenic
1009238965 6:61161462-61161484 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1009579022 6:65508250-65508272 CTGAGGCTCTGTTGGTTTGATGG + Intronic
1009987924 6:70804380-70804402 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1010695916 6:78973631-78973653 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1011494225 6:87922825-87922847 GGGAGGCTGTGGAGGAGAGATGG + Intergenic
1012185488 6:96210063-96210085 CTGAATCTCTGGGTGTGAGATGG + Exonic
1012399958 6:98834903-98834925 TGGAGGCGCTGGAGGTGAGCAGG - Exonic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1014071260 6:117183934-117183956 GTGCGTCTCTGCAGGTGAGATGG - Intergenic
1014077017 6:117246869-117246891 GTGCGTCTCTGCAGGTGAGATGG - Intergenic
1017363360 6:153603473-153603495 CAGAGGCTCTGGGGCTGGGATGG + Intergenic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1018127268 6:160693467-160693489 CTGAGGCTCTGGAGGGGCCCTGG + Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018373780 6:163192090-163192112 CAGAGTCTCTGGGGGTTAGAGGG + Intronic
1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG + Intronic
1019258052 7:64234-64256 CTCAGCCTCTGGAGGTGAAGAGG - Intergenic
1019492182 7:1320558-1320580 CTGAGGCTCTGGGGGGGTGGGGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021282490 7:18738147-18738169 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1021352650 7:19613930-19613952 CTGAGGCTTTGAAGGTGACTAGG - Intergenic
1022520562 7:31004249-31004271 CAGAGGCTCAGGAAGTGAAAAGG - Intergenic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1023983698 7:45083360-45083382 CAGAGGCTCTGGACCTGAGGTGG + Exonic
1024114280 7:46177679-46177701 GTGAGGCTTTGGAGGTGATTAGG + Intergenic
1024210353 7:47197946-47197968 CTGATGCTAGGGAGGTGACAAGG - Intergenic
1024255921 7:47539928-47539950 CTGAGGGTCTGGGGATGCGAAGG + Intronic
1024492666 7:50003421-50003443 CTGTGCCACTGGAGGTGAGGTGG - Intronic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1024552430 7:50574721-50574743 GTGTGTCTCTGGACGTGAGATGG + Intergenic
1024974675 7:55102169-55102191 CTGAGGCTCTGGGTGAGGGAAGG - Intronic
1025022489 7:55490479-55490501 CTGGGGCTCTTGTGGTGAGTAGG - Intronic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026114013 7:67481121-67481143 CTGAAGCTCTGATGGAGAGAAGG - Intergenic
1026902783 7:74046259-74046281 CAGAGGCTCTGGCGTTGGGAGGG + Intronic
1027201359 7:76065741-76065763 CTCAGTTTCTGCAGGTGAGACGG + Intronic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029197681 7:98817766-98817788 ATTAGGCTCAGGAGGTGAGCAGG - Intergenic
1029313376 7:99688275-99688297 GTGTGGCTCTGCATGTGAGATGG - Intronic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029630738 7:101748475-101748497 CTGAGGCTCGGGTGGGGGGAGGG + Intergenic
1030524868 7:110640779-110640801 TTGATCCCCTGGAGGTGAGAGGG - Intergenic
1031256876 7:119463806-119463828 GTGTGTCTCTGGATGTGAGATGG - Intergenic
1031314403 7:120238717-120238739 CTGTGTCTCTGCACGTGAGATGG + Intergenic
1032368490 7:131323292-131323314 AGGAGGGTCTGGAGGTGAAAGGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033259577 7:139831196-139831218 CAGAGGTTCTGGGGGTGAGCTGG + Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033367448 7:140682479-140682501 AGGAGGCTGAGGAGGTGAGAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035127018 7:156616307-156616329 CTGAGACTGTGGAGGGGTGACGG - Intergenic
1035155942 7:156913276-156913298 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1035182934 7:157103742-157103764 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1035397267 7:158543277-158543299 CCGAGGCTCTGAAGGTGGGTGGG + Intronic
1035882028 8:3253762-3253784 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1038366266 8:26938825-26938847 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1038686888 8:29727113-29727135 CTGCTGCTCTGGGGGTGGGAGGG + Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1040088270 8:43367755-43367777 GTGTGGCACTGCAGGTGAGATGG - Intergenic
1040985255 8:53286901-53286923 GGGAGGCACTGGAGGTGAGAGGG - Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041414227 8:57589866-57589888 CTCAGGCTCTGGAAGAGAGATGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042073082 8:64957803-64957825 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1043936201 8:86145062-86145084 CTGAGGCACAGGAGGTGTGAAGG + Intronic
1044253139 8:90027606-90027628 GTGTGTCTCTGCAGGTGAGATGG + Intronic
1044490244 8:92805177-92805199 CAGAGGCTCTGGAGGAGAACTGG - Intergenic
1045481093 8:102592728-102592750 CTGAGGCCCTGGAGATGAAATGG + Intergenic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1047024883 8:120813521-120813543 CGGAGTCACTGCAGGTGAGAGGG + Intergenic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047717974 8:127613411-127613433 TTGAGGCTATGAAGGTGGGAGGG - Intergenic
1048251020 8:132866884-132866906 CTGAGGACCTGGGGGTGGGAAGG + Intergenic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048696931 8:137038854-137038876 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1049270966 8:141696082-141696104 CTGAGGCCAGGGAGGTGAGGGGG + Intergenic
1049370845 8:142265484-142265506 CTGTGCCTCTGCAGGTGAGCAGG - Intronic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049763658 8:144342997-144343019 CTGTGTCTCTGTAGGTGAGTGGG - Intergenic
1049773447 8:144394187-144394209 CTGAGGCTCTGGGGGTGGCCGGG - Intronic
1049850830 8:144829262-144829284 TTGAGGCTCTTGAGGGGGGAGGG + Intronic
1049861357 8:144901390-144901412 CTGCGGCTCTGACGGTGAGTGGG - Exonic
1050370692 9:4918933-4918955 GTGTGGCTCTGCACGTGAGATGG + Intergenic
1050744305 9:8858335-8858357 CTGAGGCTCGTGGGGGGAGAGGG + Intronic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053827290 9:42038383-42038405 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054603271 9:67149057-67149079 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1055301461 9:74887410-74887432 CTGAGAATCCGGAGGAGAGAAGG - Intronic
1055468367 9:76587700-76587722 GTGAGTCTCTGGAGGTGAGGAGG + Intergenic
1056710675 9:88990336-88990358 CTGATCCTCTGGAGGCAAGAGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058803669 9:108569073-108569095 CTGAGTCTTTGGAGATGAGCAGG + Intergenic
1059343465 9:113612748-113612770 CTGAGGCTCAGGGAGGGAGAAGG + Intergenic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060282636 9:122224642-122224664 ACTAGGATCTGGAGGTGAGAGGG - Intronic
1060300975 9:122374392-122374414 ATGAGGCTCCAGAGGTGGGAGGG + Intronic
1060421198 9:123470882-123470904 CTGAGTCTCTGGTGTTGAAACGG + Intronic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1203354142 Un_KI270442v1:115711-115733 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1203717420 Un_KI270742v1:166951-166973 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
1203533806 Un_KI270743v1:11282-11304 GTGTGTCTCTGCAGGTGAGAAGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187308360 X:18117208-18117230 CTGAAGCTCTGGAAGGGGGAAGG + Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1189862812 X:45290801-45290823 CTGGGGCTCTGGAGTTTTGATGG + Intergenic
1190720956 X:53147221-53147243 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1190862765 X:54359272-54359294 TTGAGGCTCAGGAGGGGAAATGG + Intergenic
1190905164 X:54720268-54720290 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1190923551 X:54880951-54880973 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1191008002 X:55731195-55731217 TTGTGGCTCAAGAGGTGAGAAGG + Intronic
1191589708 X:62869105-62869127 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1191649530 X:63521367-63521389 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192162740 X:68800738-68800760 CTGAGGCTCAGGGGATGAGAAGG - Intergenic
1193315855 X:80064433-80064455 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
1193461275 X:81793316-81793338 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1195255207 X:103083096-103083118 CAGAGGCTCTGAAGTTGAGGTGG + Intronic
1195391211 X:104364528-104364550 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1196829295 X:119763612-119763634 CTGAGGCTCGAGGGGTGAGTGGG + Intergenic
1197720026 X:129738846-129738868 CTGGGGCTCTGCCGCTGAGAGGG + Intergenic
1198005406 X:132489077-132489099 CTGAAGTTCTGGAGGTGGGGCGG - Intronic
1198243616 X:134808055-134808077 CAGAAGATCTGGAGGTGAGTGGG - Intronic
1198643412 X:138780418-138780440 GTGTGTCTCTGCAGGTGAGATGG - Intronic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1199779364 X:151044272-151044294 CTTAGGTTCTGGATGGGAGATGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200288328 X:154846671-154846693 GTGAGTCTCTGCATGTGAGATGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200693433 Y:6332229-6332251 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1201013243 Y:9571695-9571717 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1201041842 Y:9842497-9842519 GTGTGTCTCTGCAGGTGAGATGG + Intergenic
1201171578 Y:11271887-11271909 GTGTGTCTCTGCAGGTGAGAAGG + Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic
1201450315 Y:14104381-14104403 CTGTGTCTCTGCACGTGAGATGG - Intergenic
1201590877 Y:15613123-15613145 GTGTGTCTCTGCAGGTGAGATGG - Intergenic
1201626635 Y:16022321-16022343 GTGAGTCTCTGCACGTGAGATGG + Intergenic
1201988091 Y:19991753-19991775 CTGTGTCTCTGAAGGTGAGTTGG + Intergenic
1202368343 Y:24181701-24181723 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1202372353 Y:24207484-24207506 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic
1202389136 Y:24351946-24351968 AATAGGCTCTGGAGGGGAGATGG + Intergenic
1202481651 Y:25318178-25318200 AATAGGCTCTGGAGGGGAGATGG - Intergenic
1202498432 Y:25462636-25462658 CTGAGGCTCTGGGAGGGAAAGGG + Intergenic
1202502442 Y:25488416-25488438 CTGAGGCTCTGGGAGGGAAAGGG - Intergenic