ID: 1179124267

View in Genome Browser
Species Human (GRCh38)
Location 21:38577556-38577578
Sequence CAGGCTCCTGGTGCTCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179124262_1179124267 -1 Left 1179124262 21:38577534-38577556 CCGGGAAGCAGATGAAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 250
Right 1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG 0: 1
1: 0
2: 3
3: 15
4: 147
1179124260_1179124267 11 Left 1179124260 21:38577522-38577544 CCTGAAATTGAACCGGGAAGCAG 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG 0: 1
1: 0
2: 3
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179124267 Original CRISPR CAGGCTCCTGGTGCTCTCGT GGG Intronic
900427064 1:2585728-2585750 CAGGCCCCTGGAGCTGTCCTGGG + Intergenic
900754264 1:4422952-4422974 GATGCTCCAGGTGCTCACGTGGG - Intergenic
901621464 1:10591710-10591732 CATGCTCCTGATGTTCTCTTTGG + Intronic
901744937 1:11366109-11366131 CAAGTTCCTGGTGCTCTCTGTGG + Intergenic
902196353 1:14801454-14801476 CAGGCTCTTGGGGCTCTCCTAGG + Intronic
902368196 1:15990705-15990727 CATGCTCCTGGTGGTCTTGGAGG - Intergenic
904538617 1:31217744-31217766 CAGGCTCCCTGTCCTCTCCTGGG + Intronic
905351631 1:37350695-37350717 GAGTCTCCTGGTGCTCTAGTGGG - Intergenic
911688679 1:100806704-100806726 CAGCCTCATGGTGCACTCCTGGG + Intergenic
914899209 1:151703065-151703087 CAGGCCCCTGCGGCTCTCCTGGG + Exonic
918316861 1:183329721-183329743 CAGGCTCCTGGATCTCACCTTGG - Intronic
918509920 1:185300459-185300481 CGGGCTCTTGGTGTTCTCATGGG + Exonic
1063017412 10:2092783-2092805 CAGGTCCCTGGTGATCTGGTTGG + Intergenic
1063021128 10:2128437-2128459 ACAGCTCCTGGTGCTCTAGTGGG - Intergenic
1063583970 10:7334302-7334324 CAGGCTCCTGGTGGTGGCTTTGG - Intronic
1063864318 10:10347329-10347351 CAGGTGCCTGGTGCTCCCCTGGG - Intergenic
1067686763 10:48470461-48470483 CAGGCTCCTGGGGCTCTGGCAGG + Intronic
1069862825 10:71482020-71482042 CAGGCTCCTGATGCTCTGGACGG - Intronic
1073177375 10:101564734-101564756 CAGGTTCCTGGTGCTCCGGTGGG + Intergenic
1074412677 10:113241994-113242016 CTGCCTCCTGGTGCTCTCCATGG + Intergenic
1076673868 10:132137685-132137707 CAGGGTCCTGCTGCTCTCCGGGG - Intronic
1077456330 11:2683373-2683395 CAGGTTCCTGGGGCTCTGGGTGG + Intronic
1077902474 11:6500468-6500490 CAGGCTCCTGGGGCCCTAATGGG + Intronic
1081858025 11:46316213-46316235 CTGCCTCCTGGAGCTCTCCTAGG - Intronic
1081858807 11:46320429-46320451 CAGGTACTTGGTGGTCTCGTGGG - Exonic
1084431628 11:69114535-69114557 TAGGCTCCTGATGATCTCTTGGG + Intergenic
1084733477 11:71089501-71089523 CAAGCCCCTGGTGTTCCCGTGGG - Intronic
1085177930 11:74507069-74507091 CTGAATCCTGGTGCTCTTGTTGG + Intronic
1085299318 11:75449207-75449229 CAGGATCCAGGTGCTCTAGGGGG + Intronic
1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG + Intronic
1089815130 11:121166125-121166147 CAAGCTCCTAGTGCTCACCTGGG + Intronic
1090807314 11:130210549-130210571 CAGGGGCCTGGTGCCCTGGTAGG + Intergenic
1090991364 11:131819832-131819854 CAGGGTGCTGCTGCTCTCATGGG - Intronic
1092816750 12:12319054-12319076 CAGGCACCTGGTTTTCTCCTGGG + Intergenic
1097289619 12:57903646-57903668 CAAGCTCCTGATGCTCCCGCTGG - Intergenic
1101428314 12:104605893-104605915 CCACCTCCTGGTCCTCTCGTGGG + Intronic
1103293564 12:119867088-119867110 CAGTCACCTGGGGCTCTCCTGGG - Intronic
1105067935 12:133216585-133216607 CAGTCTCCTGGTGCTGTTTTAGG + Intergenic
1106406249 13:29477115-29477137 CAGGCTCCTGCTGCTCACTAGGG - Intronic
1119433195 14:74581666-74581688 CAGGCTCCTGGGGCTCTAGGGGG - Intronic
1120831756 14:89003748-89003770 CAGGCTCCTGCTCCTCTCACTGG + Intergenic
1122828886 14:104385952-104385974 CAGGCTCCCGGAGGTCCCGTGGG + Intergenic
1124126203 15:26939847-26939869 GAGGCTCCTGGTGAACTCCTTGG + Intronic
1125727278 15:41874527-41874549 AAGGCTCCTGGTTCTTTCCTTGG + Intronic
1129268539 15:74407724-74407746 GATGCTCCTGGTGCTCTGATGGG - Intergenic
1129847364 15:78774089-78774111 CAGGCCCCAGGTTCTCTCCTGGG - Intronic
1131438525 15:92441462-92441484 CAGGATCGTGGGGCTCTCCTGGG - Intronic
1135487832 16:22881390-22881412 CAGGCTCCAAGGGCTCTCCTGGG + Intronic
1135892838 16:26372966-26372988 CAAGCTCCTGCTGCTCTTCTTGG + Intergenic
1136278145 16:29191661-29191683 CCCGCTCCTGGTGGTCTCCTGGG + Intergenic
1141943751 16:87296188-87296210 GAGGCTCCTGAAGCTCACGTGGG + Intronic
1142326369 16:89417694-89417716 TAGGTTCCTGGTGGTCTCGCCGG - Intronic
1144948904 17:18983614-18983636 CAGGCTCCTGCTGCTATGTTGGG - Intronic
1146904497 17:36609224-36609246 CTGGCTCCTGCTGCTTTCCTGGG - Intergenic
1148065003 17:44862684-44862706 CATACTCCTGGGGCTCTGGTTGG + Intronic
1148156351 17:45427166-45427188 GAAGCTCTTGGTGGTCTCGTGGG - Intronic
1149029306 17:52065708-52065730 CAGGCCCCTGCTGCTCTCCAAGG + Intronic
1149991347 17:61385245-61385267 CAGCCTCCTGGTGCTGGCGCTGG - Intronic
1150388024 17:64775797-64775819 GAAGCTCTTGGTGGTCTCGTGGG - Intergenic
1151589173 17:75032326-75032348 CAGTCTCCTCGTTCTGTCGTGGG - Intergenic
1152189539 17:78880031-78880053 CCGGCTGCTGCTGCTCTCGGAGG + Intronic
1152317507 17:79589609-79589631 CAGGCTCCTGGAGCTTCCCTGGG + Intergenic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1152389422 17:79993857-79993879 GGGGCTCCTGGTGCTCTCGAGGG - Intronic
1152790061 17:82273863-82273885 CAGGCTCCTGCTGCTCTCGCGGG + Intergenic
1157683176 18:49622769-49622791 CAGGGACCTGGTGCTCTCCCAGG + Intergenic
1158493459 18:57931350-57931372 CAGGCACCTAGTTCTCTCATTGG + Intergenic
1158706912 18:59800899-59800921 CATGCACCTGGTGCTCTGGGTGG + Intergenic
1159657873 18:71054511-71054533 CAGGACTCTGGTGCTCTCCTTGG + Intergenic
1164472837 19:28550380-28550402 CAGGTTCCTGGCCCTCTCCTCGG + Intergenic
1166559245 19:43720857-43720879 CAGGCCCCTGGGGCTGTCTTTGG - Intergenic
1166739673 19:45106194-45106216 CAGGCTCCTGCTGCTCTCCTCGG + Intronic
925019808 2:559366-559388 GAGTCTCCAGGTGCTCTCCTGGG + Intergenic
926112004 2:10189496-10189518 CAGGCTGCTGGTGGGCTCATTGG - Intronic
927537218 2:23872961-23872983 CAGGTTCCAGGTGCTCTCACTGG + Intronic
928260077 2:29758595-29758617 CAGGCACCTGGCCCTCTCCTTGG + Intronic
940453599 2:153871332-153871354 CAGGATCCTAGTGTTCTGGTTGG - Intergenic
941997024 2:171610798-171610820 CAGGCTCCTGTCCCTCTCCTTGG - Intergenic
942461170 2:176169845-176169867 CAGGCTGCTGGTGCTGTTGCTGG + Intronic
946844427 2:223846822-223846844 CAAGCTCATGGTGATCTCATTGG - Intergenic
947750361 2:232528879-232528901 CAGGCTCAGGGTGATCTCTTTGG - Exonic
948005759 2:234606321-234606343 CAAGCGCCAGGTGCTCTTGTAGG - Intergenic
948022383 2:234745619-234745641 CTGGAGCCTGGTGCTCTCCTGGG - Intergenic
1168951697 20:1806582-1806604 CAGGTTCCTGGTGCTTTCGTGGG + Intergenic
1170297204 20:14840532-14840554 CAGTCTCCTGGTGTTCTTGGAGG + Intronic
1170738131 20:19028124-19028146 CAGGCTCCTGGAGCTTTCCTGGG + Intergenic
1171086032 20:22239191-22239213 CAGGCTCCCTGTCCTCTGGTGGG + Intergenic
1172502535 20:35437445-35437467 ACGGCTCCTTGGGCTCTCGTGGG + Exonic
1173027981 20:39326951-39326973 CAGCCTCCTGGAGCTCTCCTGGG + Intergenic
1176046705 20:63096692-63096714 CATGCTCCTGAGGCCCTCGTGGG - Intergenic
1179090399 21:38259954-38259976 CAGGCTCCTTGTGTTCTTTTAGG - Intronic
1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG + Intronic
1179597217 21:42451025-42451047 CAGGCTCCTGGGGCCTTCTTGGG - Intergenic
1179629117 21:42665895-42665917 CAAGCTCCTGATGCTCCCCTGGG + Intronic
1181894067 22:26091281-26091303 CAGGCTCCTGGTTCTGAAGTTGG + Intergenic
1182064905 22:27423850-27423872 AAGGCTGCTGGTCCTGTCGTGGG - Intergenic
1182765307 22:32753852-32753874 CAGGCCCCTGGCTCTCTCATTGG - Intronic
1184510739 22:44931854-44931876 GAGGCTCCTGGTGGGCTCCTGGG - Intronic
1184678204 22:46054594-46054616 AAGGGGCCTGGTGCTCTCGGAGG + Intronic
1184796229 22:46734970-46734992 CAGGCTGGTGGTGAACTCGTTGG - Intronic
953488048 3:43321421-43321443 TTGCCTCCTGGTGCTCTCCTGGG - Intronic
954149159 3:48648624-48648646 CAGGCTCCTGCTGTTCTCTTGGG - Intronic
955971657 3:64443870-64443892 CTGGCTGCTGGGGCTCTGGTTGG - Intronic
958583224 3:96052738-96052760 TAGGCTTCTGGTCCTGTCGTGGG + Intergenic
958666060 3:97139171-97139193 CAGGGCCCTGGTGCTCTCTGAGG - Intronic
961673584 3:128551527-128551549 CTTTCTCCTGGGGCTCTCGTGGG - Intergenic
962553107 3:136515857-136515879 CAGACTTCTGATGTTCTCGTGGG - Intronic
962711066 3:138086573-138086595 CAGCCGCCTGGTTCTCTCCTAGG + Intronic
965033324 3:163402236-163402258 CAGGCTCCTGTTGCACTCCTGGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
968597908 4:1494863-1494885 AAGGCTCCTGGTGCTCAGGGAGG - Intergenic
969220531 4:5755798-5755820 CAGTCTCCTGCTGCTCTGCTGGG + Intronic
969396137 4:6922777-6922799 CACGCTCCTGGTGCTGCCCTGGG + Intronic
969499978 4:7546695-7546717 CAGGCTACACGTGCTCTTGTGGG - Intronic
969604010 4:8193227-8193249 CAGGCTGCTGGTTCTCCCATTGG - Intronic
973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG + Exonic
977962159 4:103098420-103098442 CAGGCTCCTGGTGCCACAGTGGG - Intronic
980096136 4:128492790-128492812 CAGGCTCCTGGTCCAGTAGTGGG + Intergenic
983294629 4:165850384-165850406 AAGGCTCCTTGTGGTCTCCTCGG - Intergenic
984296550 4:177861647-177861669 CAGGATCCCTGTGCTCTCGGGGG + Intronic
984902648 4:184599043-184599065 CCTGCTCCTGGTGCTCTTCTGGG - Intergenic
985581472 5:697618-697640 CAGGCTCCTTGTGGTCTGCTTGG - Intergenic
985596099 5:788949-788971 CAGGCTCCTTGTGGTCTGCTTGG - Intergenic
986805665 5:11306445-11306467 CAGGCTCCAGGAGCTATCATGGG + Intronic
989685587 5:44082777-44082799 GAGGCTCCTGGTGTCCTCTTTGG + Intergenic
991507125 5:67337067-67337089 CAGGCTCCTGGTGAGCACTTAGG - Intergenic
997823649 5:137087678-137087700 CAAGGTCCTGGTGCTCTCCAGGG - Intronic
998295672 5:140966920-140966942 CAGGCACCCGGCGCGCTCGTGGG + Exonic
999242946 5:150138101-150138123 TTGGCTCCTGGTGGTCTCTTGGG - Intronic
1002424231 5:179166234-179166256 CAGGCTCCCGGTGCTGCTGTGGG - Intronic
1007060417 6:38935115-38935137 CAGGTACCTGGTGCTCCCATAGG + Intronic
1007406987 6:41640830-41640852 CAGGCTCCCGGGGCTCTCAGGGG - Intronic
1017522515 6:155214282-155214304 CTGGCTCCTGGTGGTCTTGATGG - Intronic
1018059337 6:160078486-160078508 CAGCATCTTGGTGCTCTCGTAGG + Intronic
1018368965 6:163149838-163149860 CTGGGTCCTGTTGCTCCCGTTGG + Intronic
1018987262 6:168647336-168647358 GAGGAGCCTGGTGCTCTGGTGGG - Intronic
1019049552 6:169172567-169172589 CAAGCTCCTGGTGTTCCCGGAGG + Intergenic
1019135654 6:169906085-169906107 CAGGTTCCGGGAGCTCTCCTAGG + Intergenic
1020961591 7:14811057-14811079 CAAGCTCATGGTGCTCTGCTTGG - Intronic
1022651060 7:32275384-32275406 CAGGCTCCTGATGAGCTTGTAGG + Intronic
1025995555 7:66525201-66525223 CAGGCTCCTGGGAGTCTCGGAGG + Intergenic
1027989199 7:85335216-85335238 CAGGCTCCTGGAGCTGTGGTGGG + Intergenic
1028504555 7:91556944-91556966 CAGGCTCCTTGTCCTCTCCCAGG + Intergenic
1029059149 7:97778954-97778976 CAGGCTCCTTGAGCTGTGGTAGG + Intergenic
1031164772 7:118214768-118214790 CAGGGTCCTGGCGCCCTGGTCGG - Intronic
1031574785 7:123401673-123401695 CAGGCTGATGGTGCTCTCTGGGG + Intergenic
1031887352 7:127255311-127255333 CAGCAGCCTGGTGCTCTAGTGGG + Intergenic
1034393279 7:150801703-150801725 CCGGCTGCTGGTGGCCTCGTGGG + Exonic
1034466635 7:151233542-151233564 CAGGCTCCGGCTCCTCTGGTTGG + Exonic
1035209081 7:157314384-157314406 CATCCTCCTGCTGCTTTCGTGGG + Intergenic
1036627841 8:10486536-10486558 AAGGATGCTGGTGCTCTCCTTGG - Intergenic
1037932262 8:22888550-22888572 CAGGCTTCTGGAGCCCTCCTGGG + Intronic
1038482968 8:27914416-27914438 CAGGCTCCGGGTGCTCCCACAGG - Intronic
1039886569 8:41657542-41657564 CAGCCTCCTGGTGCTCCCCACGG + Intronic
1042651098 8:71042241-71042263 CAGGCTCCAGGTGCTTCCCTTGG - Intergenic
1046295065 8:112207953-112207975 CAGGCTCTTGGGGCTATAGTTGG + Intergenic
1046823917 8:118666297-118666319 CAGGCTGGTTGTGCTCTCCTGGG + Intergenic
1048214390 8:132481283-132481305 CCGGCTCCTGGAGCTCCCGTGGG + Intergenic
1056827011 9:89883546-89883568 CAGGCCCCTGTTGCTCACGGGGG + Intergenic
1058232570 9:102447376-102447398 CAGGCTCCTGGTGCACCCAGAGG - Intergenic
1060797566 9:126522894-126522916 AAGGCTCCTGGTGCTGTCCTGGG + Intergenic
1061014189 9:127972510-127972532 CTGCCTCCTGGTGCTCTCAGAGG - Intronic
1061048996 9:128183110-128183132 CAGGCTTCTGGTGGCCTCCTGGG - Intronic
1193919449 X:87407227-87407249 CAGCCTCCTTGTGCTCTTGGGGG - Intergenic
1197843005 X:130770195-130770217 CAGGCTCCAGGTGCTCTTTGAGG - Intronic
1199613032 X:149633788-149633810 TATGCTACTGGTGCTCTCATGGG + Intergenic