ID: 1179124577

View in Genome Browser
Species Human (GRCh38)
Location 21:38579556-38579578
Sequence CATGAGGACTGGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179124570_1179124577 5 Left 1179124570 21:38579528-38579550 CCACCAAGGAGCCTTGATGAACA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 2
3: 49
4: 506
1179124572_1179124577 -6 Left 1179124572 21:38579539-38579561 CCTTGATGAACAAGAAGCATGAG 0: 1
1: 1
2: 5
3: 18
4: 205
Right 1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 2
3: 49
4: 506
1179124571_1179124577 2 Left 1179124571 21:38579531-38579553 CCAAGGAGCCTTGATGAACAAGA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 2
3: 49
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179124577 Original CRISPR CATGAGGACTGGAGGAAAGA GGG Intronic
901054346 1:6441796-6441818 AATGAGGCCCGGAGGGAAGAAGG + Intronic
901066406 1:6496747-6496769 CCTGAGGACTGCAGGAGAAAAGG - Intronic
902479962 1:16706538-16706560 AATGAGGCCCGGAGGGAAGAAGG - Intergenic
902922109 1:19672227-19672249 CATGGGAACTGAAGGAGAGAAGG - Intronic
903560218 1:24221459-24221481 CATGAGCACAGGAGGGGAGATGG + Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
903934944 1:26889189-26889211 AATGAGGGCTTGAGGACAGAGGG + Intronic
904405552 1:30285954-30285976 CAAGAGGCCAGGAGGGAAGACGG + Intergenic
904889101 1:33764506-33764528 CTTGAGGACTGGATAACAGAGGG + Intronic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
906185724 1:43860569-43860591 GATGAGGACTGGAACAGAGATGG - Intronic
906745608 1:48220318-48220340 CATGAGGAAGGGAGCAAAAAAGG - Intergenic
906794965 1:48689468-48689490 AAGGAGGAAGGGAGGAAAGAAGG - Intronic
907255055 1:53172953-53172975 CATGAGGACGTCAGAAAAGAGGG - Intergenic
907570164 1:55476107-55476129 CCAGAGGAGTGGAGGAATGAGGG + Intergenic
907622191 1:55992695-55992717 GAAGAGGACTGGGAGAAAGAAGG - Intergenic
907958735 1:59257272-59257294 CATGAGGACTGGCCAACAGAAGG - Intergenic
908358471 1:63344905-63344927 GATGAGGAAAGGGGGAAAGAGGG + Intergenic
908440557 1:64149637-64149659 TTTGAGGACTGGAGGAGACATGG - Intronic
908464853 1:64383451-64383473 CCTGAGGAAAGGAAGAAAGAGGG - Intergenic
908546375 1:65166214-65166236 CATTAGGACTCCAGAAAAGAAGG - Intronic
908597419 1:65703369-65703391 CATGAGAACTGTAGGCAGGATGG - Intergenic
909180413 1:72416782-72416804 AATGAGGAATGGAGGAAGGAAGG - Intergenic
910396964 1:86803259-86803281 CTTTAGGACAGGAGGATAGATGG - Intergenic
910684319 1:89900915-89900937 CATGGCGACTGGAGGCCAGAGGG + Intronic
912198707 1:107430653-107430675 AATGAGGGATGGAGAAAAGACGG - Intronic
912411403 1:109483239-109483261 CATGATGACAGGATGACAGAAGG - Intergenic
912752668 1:112298639-112298661 AAGGAGGTATGGAGGAAAGAAGG + Intergenic
913089594 1:115467568-115467590 CATTAAGGCTGGAGGAAGGAAGG + Intergenic
913502198 1:119481677-119481699 CCTGAGAACAGGAAGAAAGAAGG - Intergenic
913510000 1:119552835-119552857 CCTGAGAACAGGAAGAAAGAAGG - Intergenic
913513824 1:119585957-119585979 CCTGAGAACAGGAAGAAAGAAGG - Intergenic
913517493 1:119616937-119616959 CTTGAGAACAGGAAGAAAGAAGG - Intergenic
914460512 1:147878966-147878988 CAAGATGCCTGGAGGACAGAGGG + Intergenic
914747220 1:150509516-150509538 CGTGAAGCCTGGAGGGAAGAAGG - Exonic
914908252 1:151764049-151764071 CATAAAAACTGGATGAAAGAAGG + Intronic
914931855 1:151942056-151942078 CATTAGGGCTGGAGGAAATAGGG + Intergenic
915489941 1:156245302-156245324 CAAGAGGACTTGGGCAAAGATGG + Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
917169398 1:172153567-172153589 CGTGCTGAATGGAGGAAAGATGG - Intronic
917309970 1:173668845-173668867 TATGAGCATTGGAGGGAAGAGGG + Intronic
917470293 1:175320807-175320829 AATGAGGAAAGAAGGAAAGAAGG - Exonic
918113419 1:181477590-181477612 AAAGAGGAATGGAGGAAAAAAGG - Intronic
918313212 1:183301562-183301584 CATGAGCACAGGAGCAAAGATGG - Intronic
918406101 1:184213245-184213267 AATGAGAACTGGGGGAAACACGG - Intergenic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
919347982 1:196410983-196411005 AATGAGGAAGGAAGGAAAGAAGG - Intronic
919709917 1:200716169-200716191 CATGAGTAGGGGAGGAGAGAAGG - Intergenic
919753244 1:201051321-201051343 CATGAGGGCTGCAGCACAGAGGG - Intronic
919879993 1:201894995-201895017 CTAGAGGGCTGGAGGAAGGAGGG + Intergenic
920500512 1:206482258-206482280 GGTGAGGAGGGGAGGAAAGAAGG + Intronic
920970901 1:210743128-210743150 CATGGGGAGTAGAAGAAAGAGGG + Intronic
921266150 1:213422176-213422198 GATGAGGGCTGGAGGAAGGAGGG - Intergenic
922592726 1:226790235-226790257 CATGAAGACTAGAGAAATGAAGG - Intergenic
922691214 1:227693110-227693132 GAAGGGGACTGGAGGCAAGAGGG - Intergenic
923091468 1:230744414-230744436 CATGAGCTCTGCAGGAAAGATGG + Intergenic
923751232 1:236747907-236747929 CATGAAAAGTGGAAGAAAGAGGG + Intronic
924229105 1:241948568-241948590 CAAGAGGACTAGATGAAAGGTGG + Intergenic
1062833778 10:623409-623431 CATGAGGACGGGTGCAGAGAAGG + Intronic
1063170906 10:3509093-3509115 AATGAAAACGGGAGGAAAGAAGG + Intergenic
1063398807 10:5720856-5720878 CATGAGAACTGAAGAAATGAAGG - Exonic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1063559342 10:7112049-7112071 CAGGTGGACTGGAGGAAATGTGG + Intergenic
1064474639 10:15674243-15674265 TATGTGGGATGGAGGAAAGAGGG - Intronic
1064652092 10:17519629-17519651 AATGAGGAAGGGAGGAAGGAGGG + Intergenic
1064686477 10:17867178-17867200 CAGGAGGAAGGGAGAAAAGATGG - Intronic
1066305894 10:34140608-34140630 TATGAGGAATGGAGGAAGGGTGG + Intronic
1067687905 10:48478880-48478902 CATGAGGAGTGGACCATAGAGGG - Intronic
1067714460 10:48678760-48678782 CATGAGACTTGGAGGAAGGAGGG - Intergenic
1067720340 10:48723302-48723324 CTTGAGGACTGGAGCCCAGAGGG + Intronic
1068001249 10:51336698-51336720 CTTGAGGACAGGAGGCAAGGTGG + Intronic
1068099400 10:52532973-52532995 AATGAGGAAAGGAGGAAAGGAGG - Intergenic
1068240892 10:54299661-54299683 CTTCAGGACAGGAGGATAGATGG + Intronic
1068976335 10:63013916-63013938 CATGAGGACCAGAAGAAATAGGG + Intergenic
1070645286 10:78197911-78197933 TCTGGGGACTGGTGGAAAGAGGG + Intergenic
1070983648 10:80669761-80669783 CATCAGGCCTTGAGGACAGAGGG + Intergenic
1071263415 10:83942290-83942312 AATGAGGACTGGGGGCAACAAGG - Intergenic
1071553447 10:86584946-86584968 CATGTGGACTTGAGGCCAGAAGG + Intergenic
1072606169 10:96984576-96984598 CAAGAGTACTGAAGGAATGAAGG + Exonic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072765966 10:98095473-98095495 CATAAGGGCTGAAGGAGAGAAGG + Intergenic
1072806897 10:98429551-98429573 GGTGAGGACCGGAGGAAAGCAGG - Exonic
1072841073 10:98774584-98774606 CATGAAGACTGAAGGAATGGAGG - Intronic
1073538832 10:104301544-104301566 GATGTGGCCTGGAGAAAAGAGGG + Intronic
1075128188 10:119717931-119717953 AATGAGGAATGTAGGAAGGAGGG - Intergenic
1076052289 10:127345516-127345538 GAGGAGGCCTGAAGGAAAGATGG - Intronic
1076125613 10:127971581-127971603 AATGAGCACTGGAGTAAGGAAGG + Intronic
1077498767 11:2899470-2899492 CAGGCTGACTGGAGGAAGGAAGG - Exonic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078325620 11:10378524-10378546 ACTGAGGAGAGGAGGAAAGATGG + Intronic
1079419155 11:20270032-20270054 CTTGAGGACTGGATCAAACACGG - Intergenic
1079624482 11:22599657-22599679 AATGAAGTGTGGAGGAAAGAGGG + Intergenic
1080968208 11:37239296-37239318 TGTGAGGAAAGGAGGAAAGAGGG - Intergenic
1081075369 11:38667040-38667062 CATGAGGCATGGAAGAAAGATGG + Intergenic
1081840795 11:46200144-46200166 CATGATGAATGAAGGAATGATGG + Intergenic
1081859857 11:46326692-46326714 CGTGAGGTCTGGAGGAAGGGTGG + Intergenic
1082568991 11:54714690-54714712 AATGAGGGGTGGAGCAAAGATGG - Intergenic
1082728249 11:56763598-56763620 CATAAAGACAGAAGGAAAGAAGG - Intergenic
1082982626 11:59137324-59137346 GGTGAGGTCTGGAGGAAAGCGGG + Intergenic
1083089747 11:60187387-60187409 CTTCAGGACTGGATGATAGACGG + Intergenic
1084172367 11:67406705-67406727 CATGGGGGCTGGAGGAAGGAGGG + Intronic
1084207750 11:67605893-67605915 CATGAGGACTGGAAAAGAGCTGG + Exonic
1084568463 11:69944827-69944849 GATGAGGCCTGGAGGAAGGAGGG - Intergenic
1084576099 11:69988927-69988949 AATGAGGAAGGAAGGAAAGAAGG + Intergenic
1085136188 11:74090943-74090965 AATGAGGACACAAGGAAAGAAGG + Intronic
1085378206 11:76087540-76087562 CATGAGGACTGTAATATAGATGG + Intronic
1086474239 11:87153360-87153382 TTTGAAAACTGGAGGAAAGAAGG - Intronic
1086855588 11:91861371-91861393 CATGTGTCCTGGAGGAAACATGG + Intergenic
1086929598 11:92678249-92678271 CATGAAGACTGGTTGCAAGAGGG + Intronic
1088916548 11:114232181-114232203 CATGAGCACTGCAAGAAATATGG - Intronic
1090167785 11:124569894-124569916 CATGAAGATGGGAGGAAAGCAGG - Intergenic
1091062569 11:132477406-132477428 GATGAGGACTTCAGGAAAGAGGG + Intronic
1091212450 11:133873796-133873818 CATGTGGACTGGGAGAGAGAAGG - Intergenic
1092254081 12:6916793-6916815 CAGGAGGAAGGGAAGAAAGAAGG + Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1094399615 12:30047858-30047880 CTTGAGTACTGGGGGAGAGAGGG - Intergenic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096613068 12:52815822-52815844 TATGAGGAATTGAGGAAAGGAGG - Intergenic
1097048051 12:56202365-56202387 CAGGAGAACTGGGGGAAGGAGGG - Exonic
1097123895 12:56757744-56757766 CATAAGGACTGAAGGAAAAAAGG - Intronic
1097170448 12:57110017-57110039 AGTGGGCACTGGAGGAAAGAGGG - Intronic
1097246624 12:57610968-57610990 CCCGGGGCCTGGAGGAAAGAAGG + Intronic
1098009005 12:66030645-66030667 AAAGAGGAAGGGAGGAAAGAAGG - Intergenic
1098236145 12:68420198-68420220 CAAGAGGAGAGGAGGAAGGAGGG + Intergenic
1098421992 12:70307860-70307882 CATGAGGAATGGGCTAAAGAGGG - Intronic
1098971804 12:76864987-76865009 CATGAGGACTGGGGAAGAAAGGG - Intronic
1099853886 12:88140116-88140138 CTTGAGGACTTGAGGTAAAAAGG - Intronic
1100544999 12:95593251-95593273 CCTGCAGATTGGAGGAAAGATGG - Intergenic
1101244281 12:102870711-102870733 CATGACAACTGGGGGAAGGATGG + Intronic
1101261653 12:103038103-103038125 AGGGAGGACAGGAGGAAAGAAGG + Intergenic
1101923602 12:108953054-108953076 AATGAGGAAGGGAGGAGAGAAGG + Intronic
1102050099 12:109855966-109855988 CACCAGGCCTGGAGGAGAGAAGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103361016 12:120353676-120353698 GATGAGGACAGGAGGGAAGCAGG - Intronic
1104191143 12:126482613-126482635 CATGAGGAACGAAGGAAGGAAGG - Intergenic
1104408933 12:128542064-128542086 AATGAGGACTGAAATAAAGAGGG - Intronic
1104783430 12:131434784-131434806 GACGATGACTGGAGGAAGGAAGG + Intergenic
1105285033 13:18996495-18996517 CAGGAAGACAGGAGGACAGAAGG + Intergenic
1105295632 13:19086154-19086176 CATGTGGACAGGAGGAACAAAGG - Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1106442011 13:29783451-29783473 CCTTAGGACTGTAAGAAAGATGG + Intronic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107627660 13:42306336-42306358 CATGAGGGTGGGAGGAAAGGGGG - Intronic
1108114167 13:47109587-47109609 AATAAGGGCTGGAGGAAAAAAGG - Intergenic
1108962702 13:56256050-56256072 CCTGAGGATTGGGAGAAAGATGG - Intergenic
1109217795 13:59609879-59609901 CAGGAGGACTGCAGGAAAAAAGG - Intergenic
1109838705 13:67893532-67893554 CATTGGCACTGGAGGAATGAAGG + Intergenic
1110613876 13:77519914-77519936 CAAGAAGGCTGGAGGAATGAAGG + Intergenic
1111806022 13:93041332-93041354 CTTCAGGACAGGAGGATAGATGG + Intergenic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1112835748 13:103512195-103512217 GAGGAGGATTGGAGGAAGGAGGG + Intergenic
1113891984 13:113740933-113740955 CATGAGGGCTGGCAGAGAGAAGG + Intergenic
1114443526 14:22770299-22770321 CATGGGTACTGGATGAAATAAGG - Intronic
1114853113 14:26404391-26404413 GAGGAGGAATGGAGGAAGGATGG + Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1115433865 14:33351319-33351341 GATGAGGACTGGGGAACAGAGGG + Intronic
1115797639 14:36957178-36957200 AATGGGAAGTGGAGGAAAGAAGG - Intronic
1117472045 14:56056175-56056197 AATGAGGGAGGGAGGAAAGAAGG + Intergenic
1117955369 14:61119283-61119305 CTTCAGGACTGGATGATAGATGG - Intergenic
1118991899 14:70804608-70804630 GCTTAAGACTGGAGGAAAGAAGG - Intronic
1119353544 14:73986622-73986644 CATGAGGGCTGGGTGGAAGAAGG - Intronic
1120021837 14:79539651-79539673 CATAAGGACTAGAGAAAAGATGG + Intronic
1120470052 14:84911670-84911692 GATTAGGACAGGAGGAAATAGGG + Intergenic
1121409480 14:93739594-93739616 CATGAAGAAAGGTGGAAAGAAGG + Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1121788904 14:96683973-96683995 CCTGAGGGCTCGAGGAAAGTGGG + Intergenic
1121885412 14:97538513-97538535 CATGAGGCGTGGAAGCAAGAGGG - Intergenic
1122299201 14:100722526-100722548 CATGGAGCCTGGAGGAAAGTGGG - Intergenic
1122398893 14:101455490-101455512 CATCTGGACAGGTGGAAAGAAGG + Intergenic
1123067472 14:105625885-105625907 CCTGAGGACTGTAGGACAGCCGG + Intergenic
1123071490 14:105644609-105644631 CCTGAGGACTGTAGGACAGCCGG + Intergenic
1123076447 14:105669664-105669686 CCTGAGGACTGTAGGACAGCCGG + Intergenic
1123091149 14:105742890-105742912 CCTGAGGACTGTAGGACAGCCGG + Intergenic
1123096920 14:105771225-105771247 CCTGAGGACTGTAGGACAGCCGG + Intergenic
1124010805 15:25837154-25837176 CATGAGGACTGAAGCTAATATGG - Intronic
1124803680 15:32860097-32860119 CAGGAGGGAGGGAGGAAAGAAGG + Intronic
1124904683 15:33857603-33857625 CATGAGCAGAGGAGGAAAGATGG - Intronic
1125466173 15:39955066-39955088 CAGGAGCACTGGTGGAAACAGGG - Intronic
1125660624 15:41391979-41392001 GATGAAGACAGGAGGAGAGATGG + Intronic
1127474337 15:59318461-59318483 CATGAGAACTGGAGGACTAAAGG + Intronic
1128101772 15:65007059-65007081 CATGAGCACTGGAAGAATGGGGG + Intronic
1128301340 15:66567978-66568000 CATGAGGACAGGAGGCGAGCAGG + Intergenic
1128793896 15:70451062-70451084 TCTGAGCACTGGAGGAAGGAAGG + Intergenic
1129136316 15:73555391-73555413 CAGGAGGTCTGGAGGCATGAAGG - Intronic
1129176311 15:73842034-73842056 GATGAGGAAAGGAGGAAGGAAGG - Intergenic
1129709710 15:77814390-77814412 CATGAGGACTAAACAAAAGAAGG + Intronic
1129971228 15:79779885-79779907 CATGTAGAATGGAGGAAAGCAGG + Intergenic
1130966798 15:88703754-88703776 GATGGGGACTGGAGCACAGATGG - Intergenic
1131054640 15:89368276-89368298 GAGGAGGACTGGGGGAAAGCTGG - Intergenic
1131280961 15:91020948-91020970 TGTGAGGACTGGAAGGAAGATGG - Intronic
1131311383 15:91293638-91293660 CATGGGGACTGAGGGAAGGATGG + Exonic
1131749939 15:95495425-95495447 AATGAGAGCTGGAGGAAAGCAGG + Intergenic
1131847418 15:96502561-96502583 GATCAGAACTGGACGAAAGAGGG + Intergenic
1134242729 16:12517789-12517811 AATGAGGACTGGATCAGAGAGGG + Intronic
1136153303 16:28366022-28366044 GAAGAAGACTGGAGGAAAGCAGG + Intergenic
1136209783 16:28749245-28749267 GAAGAAGACTGGAGGAAAGCAGG - Intergenic
1137376288 16:47954958-47954980 AATGAGGACTGCTGGATAGAAGG - Intergenic
1137436143 16:48455601-48455623 GAGGAGGACTGGGGGAAAAAGGG + Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137750030 16:50854429-50854451 CATGAGGGCAAGAGGACAGAGGG + Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1140158507 16:72459059-72459081 GATGAGAATTGGAGGAATGAGGG - Intergenic
1140526309 16:75625791-75625813 CATGAGATCTGAAGGGAAGAAGG - Intergenic
1142523474 17:521044-521066 GATGAGGGCTGGAGAACAGATGG - Intronic
1142837921 17:2602941-2602963 TATGTGGACTATAGGAAAGAGGG - Intronic
1143266295 17:5640462-5640484 GATGATGACAGGAGGAGAGAAGG - Intergenic
1143347593 17:6261291-6261313 CATGGGACCTGGAGAAAAGAAGG - Intergenic
1143822541 17:9576516-9576538 TATGGGGACTGGAAGAGAGATGG - Intronic
1144405793 17:14951515-14951537 AATGAGAACTGGAATAAAGAAGG - Intergenic
1145892390 17:28426330-28426352 CATGAGGACCCAAGGAGAGAAGG - Intergenic
1146788303 17:35736491-35736513 CCTGGGGTCAGGAGGAAAGATGG + Intronic
1147032230 17:37648287-37648309 CATGAGAACTCGAAGAAAGATGG - Intergenic
1147047989 17:37768917-37768939 CAGGAGCACAGGAGGAGAGAAGG + Intergenic
1148154234 17:45413568-45413590 CATGGGGATTGGGGGAAAGCAGG + Intronic
1148205149 17:45775320-45775342 CGTGAGGACAGGAGGGAGGATGG - Intergenic
1148712083 17:49689289-49689311 GATGAGGGCTGGAGGAATCAAGG - Intergenic
1148986987 17:51631472-51631494 AATGAGGCTTGGGGGAAAGAAGG + Exonic
1151518241 17:74611221-74611243 CATGGTGACTAGGGGAAAGATGG - Exonic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1152656284 17:81520468-81520490 CCTAAGGACTGGAGGAAATGGGG - Intronic
1154228985 18:12536573-12536595 GATGGGGAGTGGAGGAAAGAGGG + Intronic
1154460790 18:14583180-14583202 CATAAGGCATTGAGGAAAGAAGG - Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1156133675 18:34009013-34009035 CATGAGGAATGAGGGCAAGATGG - Intronic
1156268605 18:35510881-35510903 CATGAGGCCTGGAGCATGGAAGG - Intergenic
1156372154 18:36481155-36481177 CAACAGGACTGAAGGAAGGAGGG + Intronic
1156511139 18:37637784-37637806 CAGGAGAGTTGGAGGAAAGAGGG + Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1160918341 19:1508192-1508214 GACGAGGCCTGGAGGGAAGATGG + Intronic
1162362050 19:10226538-10226560 CCAAAGGACTGGAGGAAAGAGGG - Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163826706 19:19528211-19528233 CCTGGGGACTGGGGGAAAGAAGG + Intronic
1164232580 19:23303164-23303186 CATGGAGAATGGAGGAAAGCAGG - Intergenic
1164439128 19:28258660-28258682 CAAGAGGAGTGGAGGAGTGAGGG - Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165164307 19:33840658-33840680 GATGGGGACTGGAGGCATGAGGG - Intergenic
1165395454 19:35561298-35561320 CATGGGGACAGGAGGAGACATGG - Intronic
1165780301 19:38429502-38429524 CATGAGGCCAGGGGGAGAGAGGG - Intergenic
1165926067 19:39327120-39327142 GAGGAGGACTGGAGACAAGAGGG - Intergenic
1166007749 19:39918682-39918704 AATGAGGGCTGGAGGCCAGATGG - Intronic
1166159431 19:40940936-40940958 GATGAGGAGAGGAGGGAAGAGGG + Intergenic
1166564678 19:43756503-43756525 GATGAGGCCTGGAGGGGAGAGGG - Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168519399 19:57036519-57036541 CGTGAGGAGAGGAGGGAAGACGG + Intergenic
1202713998 1_KI270714v1_random:32444-32466 AATGAGGCCCGGAGGGAAGAAGG - Intergenic
925154009 2:1636612-1636634 AATGAGGCATGCAGGAAAGATGG - Intronic
925262642 2:2541748-2541770 CAGGAGGAGAGGGGGAAAGAGGG + Intergenic
925545178 2:5008327-5008349 CATGAGGTTTGGAAGAAAGAAGG + Intergenic
926000289 2:9325780-9325802 CCTGAGGACTGCTCGAAAGATGG - Intronic
927171299 2:20372405-20372427 CACAAGGAATGGGGGAAAGAGGG - Intergenic
927441895 2:23124711-23124733 TAGGAGGCCTGGAAGAAAGAAGG + Intergenic
927521462 2:23701224-23701246 TATGAGGACAGGAGAACAGAAGG - Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
928203077 2:29263641-29263663 CTAGAGGACTAGAGAAAAGAAGG + Intronic
928443939 2:31316437-31316459 CATGAGGCCTGAAGGGAACAGGG - Intergenic
930656167 2:54009183-54009205 TTTGAGGACTCGAGGAAAGTAGG + Intronic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
932591072 2:73068086-73068108 CAAGAGGACGGGCAGAAAGAGGG - Intronic
932705208 2:74019460-74019482 CATGAGGACTTGAGGGAGAAAGG - Intronic
933553148 2:83800639-83800661 GATGAGGAATGGAATAAAGAAGG + Intergenic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
933620539 2:84534686-84534708 CAAGAGGAAAAGAGGAAAGAAGG - Intronic
933683962 2:85128237-85128259 CATGAGAACAGCAAGAAAGAAGG - Intergenic
934515797 2:94985675-94985697 CATGAGGACCGGATGATAGAGGG + Intergenic
934859418 2:97751544-97751566 CTAGAGGACTGGAGAAAACAAGG + Intergenic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936266089 2:111008364-111008386 CATGAGGTATGTAGGAAAAAAGG - Intronic
936548256 2:113411698-113411720 CCAGGGGACTGGAGAAAAGAAGG + Intergenic
937038658 2:118803676-118803698 CATGTGGACTGCCTGAAAGAAGG + Intergenic
937182532 2:120009599-120009621 TATGAAGACTTGAGGAAAGGAGG - Intergenic
937241524 2:120465354-120465376 CATGAGGACAGGATGGAGGAGGG - Intergenic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
938637005 2:133238873-133238895 CAAGAGGAATGAATGAAAGAGGG + Intronic
940159552 2:150696840-150696862 CAGGAGGGAGGGAGGAAAGAAGG + Intergenic
940363506 2:152820552-152820574 TATGAGGACAGGAGGACAGATGG - Intergenic
940638761 2:156327639-156327661 CATGAGGACAGGATGGAGGAAGG - Intronic
940845156 2:158632504-158632526 CATGAGGACTGGCGGTACAAGGG - Intronic
943203642 2:184861469-184861491 AATGAGTACAGAAGGAAAGAGGG - Intronic
946209814 2:218138376-218138398 CACAAGGACTGGAGGAAACATGG + Intergenic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
946448575 2:219760837-219760859 CATCATGGCTGGAGGAAGGAAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947266581 2:228288977-228288999 TTTGAGGAATGGAGGAGAGAAGG + Intergenic
947384900 2:229581070-229581092 CCTGAGGACAGGAGGCAACATGG + Intronic
948018601 2:234710953-234710975 CATGGGGACTGGTGCAATGATGG + Intergenic
948043385 2:234922944-234922966 CAAGAGAACTGGGGGAAAAAAGG + Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948515026 2:238498328-238498350 CATGGGGACTGGGGGAAAGGTGG + Intergenic
948557391 2:238822581-238822603 CATGGGTACTGGAGGATGGATGG + Intergenic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1169870233 20:10241371-10241393 CATGGGGAGTGGCAGAAAGAGGG - Intronic
1170066843 20:12320300-12320322 GATGGGGACAGGAGGAAAGTGGG + Intergenic
1170182615 20:13549208-13549230 CTTGAGGAGTGGAGGGAATAGGG - Intronic
1170289036 20:14747054-14747076 CATGAGGACTGGACATATGATGG - Intronic
1171139479 20:22728751-22728773 CAAGGGGACTGGAGCTAAGATGG - Intergenic
1171256654 20:23693671-23693693 GATGAGGACTGGGGAGAAGAAGG - Intergenic
1171261837 20:23740933-23740955 CTTCAGGACAGGAGGATAGATGG + Intergenic
1172441429 20:34969128-34969150 CCACTGGACTGGAGGAAAGAGGG + Intergenic
1173800490 20:45891701-45891723 CCGGAGTACTGGCGGAAAGACGG - Exonic
1173811510 20:45958722-45958744 CATGAGGAATGATGGATAGATGG + Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174384136 20:50176613-50176635 CCTGAGAACTGGATGAAAGCTGG + Intergenic
1174452413 20:50628541-50628563 CATGGGGAGTGGAGGCAGGAAGG - Intronic
1175004918 20:55671669-55671691 CATGAGGACTGGCGAGAAGTTGG + Intergenic
1177579154 21:22996768-22996790 CCTGAGAACTGGAAAAAAGAAGG + Intergenic
1177629259 21:23705252-23705274 CACGAGGACAGGAGAAAAAAAGG + Intergenic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179592752 21:42420960-42420982 CATGAGAGCTGGAGGATGGAAGG - Intronic
1180025927 21:45162100-45162122 AATGAGGAGAGGAGGAGAGAAGG + Intronic
1180237861 21:46475456-46475478 CATGAGTACTGTAGAAAATATGG + Intronic
1181710778 22:24686476-24686498 CATGAGGACCTAAGGAAAGCTGG + Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182050954 22:27312107-27312129 GGAGAGGACAGGAGGAAAGAAGG + Intergenic
1183054447 22:35294829-35294851 CAGGAGGAAGGAAGGAAAGAGGG - Exonic
1183390681 22:37544179-37544201 AAGGAGGAAAGGAGGAAAGAAGG + Intergenic
1183696605 22:39427255-39427277 CATGAGGACTGAAGGGAATAAGG - Intronic
1184164136 22:42717492-42717514 GGTGAGGACAGGAGGCAAGAGGG - Intronic
1184537114 22:45094703-45094725 CATGAGGAGGGGGGGGAAGAGGG - Intergenic
1184900767 22:47445181-47445203 CAGGAGGACAGGAGGATAGGTGG - Intergenic
949611352 3:5706953-5706975 CTTCAGGACTGGAGGATAGATGG - Intergenic
949776052 3:7633610-7633632 CAGGAGTAGTGGAGGATAGAAGG - Intronic
950037776 3:9899521-9899543 AAGGAGGAAGGGAGGAAAGAAGG - Intergenic
950430723 3:12949493-12949515 CATGAGGCCTGGAGGCGTGATGG - Intronic
950534014 3:13569151-13569173 CATGAGGACTGGTGAGAAGGTGG + Intronic
951239820 3:20274617-20274639 CTTCAGGACAGGAGGATAGATGG + Intergenic
952005501 3:28837934-28837956 CAAGAAGACTTGAAGAAAGATGG + Intergenic
953175739 3:40550533-40550555 AAGGAGGAAAGGAGGAAAGAAGG - Intronic
953732715 3:45464089-45464111 CAGGAGGACAGGAACAAAGAGGG - Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954839717 3:53499765-53499787 AATGAAGAATGGAAGAAAGAGGG + Intronic
956482524 3:69687461-69687483 AATGAGGAAGGGAGGAAGGAAGG + Intergenic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
956948796 3:74256148-74256170 CCTGAGGAGTAAAGGAAAGAAGG + Intergenic
957480526 3:80787693-80787715 CATGCAGACTGGCCGAAAGAAGG - Intergenic
958437541 3:94115620-94115642 CATGAGGAATTAATGAAAGAGGG + Intronic
959018021 3:101158145-101158167 CAAGTGGAATGGGGGAAAGAAGG - Intergenic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
959621581 3:108403751-108403773 CATGAGGAGCTGAGAAAAGAAGG - Intronic
959696334 3:109252986-109253008 CCTGAGGAATGGTCGAAAGAAGG + Intergenic
959869192 3:111307123-111307145 CATTACGGCTGGTGGAAAGAGGG - Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961177958 3:124851489-124851511 CATGAGGGCTGAGGGAAAGAAGG + Intronic
961340158 3:126212410-126212432 AAGGAGGAAGGGAGGAAAGAAGG + Intergenic
961461411 3:127052570-127052592 CAGGAGGCCTGGAGGAAATGGGG - Intergenic
961685169 3:128624998-128625020 AATGAGAAATGGAGGAAGGAAGG + Intronic
964044746 3:152309412-152309434 TATGAGGTCTGGAGAAAACAGGG - Intronic
964953200 3:162323075-162323097 CTTCAGGACAGGAGGATAGATGG + Intergenic
965367143 3:167814849-167814871 CATGCTGCCTGGAGGAAAGTAGG + Intronic
965825009 3:172721339-172721361 CTTCAGGACAGGAGGATAGATGG + Intergenic
965964648 3:174472376-174472398 CATGAGTGCTTGAAGAAAGATGG + Intronic
966242036 3:177765611-177765633 AATGAGGAAAGGAGGGAAGAAGG + Intergenic
966340455 3:178920096-178920118 GATGAGGAAAGGAGGAAAGGAGG - Intergenic
966446985 3:180011748-180011770 CAGGAGGAAGGGATGAAAGAGGG - Intronic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
967762654 3:193242385-193242407 CCTGGGGAGTGGAGGAGAGAGGG + Intronic
969534762 4:7748892-7748914 CAAGATGAATGCAGGAAAGAAGG + Intergenic
970694451 4:18660914-18660936 CTTGAGAACTGGAGGAAGGTGGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971949237 4:33322483-33322505 CATGAGTACTGTAGCCAAGAAGG + Intergenic
974220460 4:58962688-58962710 AAGGAGGAGGGGAGGAAAGAGGG - Intergenic
975924269 4:79430191-79430213 GTCGAGGGCTGGAGGAAAGATGG - Intergenic
976047765 4:80972305-80972327 CATGTGTACTTGAGGATAGAAGG + Intergenic
976381658 4:84406338-84406360 TAAGAGCAGTGGAGGAAAGAAGG + Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
978166282 4:105611916-105611938 CTTGAGGACAGGATGAATGATGG + Intronic
979133289 4:117076008-117076030 CATGTGGATTGGTGGAGAGAAGG - Intergenic
979142072 4:117189815-117189837 AATGAGGTATGGAAGAAAGAAGG + Intergenic
980616171 4:135228861-135228883 CAGGAGGAAGGAAGGAAAGAAGG - Intergenic
981090674 4:140729105-140729127 AATGAGGACTGCATGACAGAGGG - Intronic
981475550 4:145183265-145183287 CATGACTGCTGGAGGAAAGCAGG - Intergenic
982092111 4:151889263-151889285 TATGAGGTCTGAAGGAAGGAAGG - Intergenic
982662005 4:158218517-158218539 CAAGAGGAAAGGAGAAAAGAAGG - Intronic
982806850 4:159776603-159776625 CATTATGGCTGGCGGAAAGAAGG + Intergenic
984508884 4:180654849-180654871 CATGTGGAGTGGAAAAAAGAAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985085819 4:186311471-186311493 CATGAGGACCTGTGGCAAGAAGG + Intergenic
985117294 4:186604905-186604927 GAAGAGGACTGGAGGAGAAAAGG + Intronic
986067981 5:4254788-4254810 CCTGAGGAGTGAAGCAAAGAAGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986762142 5:10889877-10889899 CATGAGCACTGAAGGAATGCTGG - Intergenic
986848721 5:11785348-11785370 AATGATGGCTGGAGTAAAGAAGG + Intronic
987175970 5:15309890-15309912 CATAGGGACAGGATGAAAGAGGG + Intergenic
987329669 5:16845437-16845459 CAAGAGGACTGCTTGAAAGAAGG + Intronic
987367025 5:17158026-17158048 CAAGAGGAATGAAGGACAGAGGG + Intronic
987510933 5:18837063-18837085 CATGAGGTCTGAAAAAAAGAAGG - Intergenic
987529375 5:19097631-19097653 CATGAGGAGAGGAGGAGAGAAGG - Intergenic
987899851 5:23997552-23997574 CATGAGCACTAGAGGCAAAATGG + Intronic
988102126 5:26693603-26693625 CCTGATGACTGGAAGAAAGATGG + Intergenic
988529657 5:32016577-32016599 CCTGAGGCCTTGAGGATAGAGGG + Intronic
990200430 5:53366705-53366727 CATGGGGAATGGAGGAAAATGGG + Intergenic
990989957 5:61674954-61674976 CTCCAGGACTGGAGAAAAGAGGG + Intronic
991184263 5:63788913-63788935 CTTGAGGACTGGAGAAATTAAGG + Intergenic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
993033269 5:82728943-82728965 TATGATGCCTGGAGGAAAGGAGG - Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
994453202 5:99970456-99970478 CATAAGCATTGGAGGTAAGATGG - Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995377049 5:111486334-111486356 AATGAGGAAGGAAGGAAAGAGGG - Exonic
995686213 5:114775358-114775380 CCTGAGGACTGGGGGAAATGGGG - Intergenic
997263077 5:132478487-132478509 CATGGGGACTGAATGAAAGAGGG - Intergenic
997381870 5:133444229-133444251 CATGGGGACTGTGGGCAAGAAGG - Intronic
997720670 5:136076304-136076326 CATGAGGCAGGGAGGAAAGTGGG + Intergenic
998394333 5:141808750-141808772 CATGAGGCCTGGAGGAAGGATGG + Intergenic
999316192 5:150585642-150585664 GATAAGGATGGGAGGAAAGAGGG + Intergenic
999322364 5:150623603-150623625 CATGAGGCCAGGAGGAGAAATGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001558597 5:172654393-172654415 CTTCAGGACTGGACGATAGATGG - Intronic
1001659911 5:173383644-173383666 GAAGAGACCTGGAGGAAAGAGGG + Intergenic
1001946584 5:175783864-175783886 CCTGAGAACTGGAGGGCAGAAGG + Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003175411 6:3750297-3750319 GAGGAGGACTGCAGAAAAGAAGG + Intronic
1003618231 6:7674203-7674225 CACGAGGTCTGGAGGGTAGAAGG + Intergenic
1004291475 6:14371295-14371317 CATGAGGCCTGGATGATGGATGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1005036447 6:21559493-21559515 AATGATGACAGGAGGTAAGATGG - Intergenic
1005227462 6:23659251-23659273 CATGAGAATTCAAGGAAAGAAGG + Intergenic
1005278205 6:24242659-24242681 AATGAAGACAGGAAGAAAGATGG + Intronic
1005461792 6:26075943-26075965 CTTCAGGACAGGAGGATAGATGG + Intergenic
1005959632 6:30686171-30686193 GATGAGGACAGAGGGAAAGACGG + Exonic
1006060503 6:31414997-31415019 CACGAGCTCTGGAGAAAAGAGGG - Exonic
1006363293 6:33599561-33599583 CCTGGGGGCTGGAGGAATGATGG - Intergenic
1006989193 6:38199012-38199034 CAGGAAGACTGGTTGAAAGAAGG + Intronic
1008081520 6:47199611-47199633 CCTGAAGACTGGGGGCAAGAAGG + Intergenic
1008456795 6:51720429-51720451 CCTGGGCACTGGAGGAAAGCAGG - Intronic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1009161360 6:60287079-60287101 AATGGGGTCTGGAGGATAGATGG - Intergenic
1011342406 6:86331428-86331450 TATTAGGAGGGGAGGAAAGAGGG + Intergenic
1011540121 6:88419637-88419659 CTTCAGGACCGGAGGATAGATGG - Intergenic
1011570211 6:88726578-88726600 CTTCAGGACAGGAGGATAGATGG + Intronic
1011816805 6:91201124-91201146 CATGAGGGCTTGGAGAAAGAAGG - Intergenic
1012343993 6:98164802-98164824 CATAAGGAATGGGGAAAAGATGG - Intergenic
1012651597 6:101761469-101761491 CATGAGCTCTGGAGAAATGAAGG - Intronic
1013001640 6:106028791-106028813 GATGAGGATGGAAGGAAAGATGG - Intergenic
1013088818 6:106880464-106880486 CATGAGGAGAGGAAGAGAGACGG + Intergenic
1013202741 6:107916842-107916864 CATGAGGAGTGGGAGAGAGATGG - Intronic
1013293487 6:108738558-108738580 CATGAGGAGTTTAGGAAAGGAGG + Intergenic
1013507018 6:110810942-110810964 TATCAAGACTGGAGGTAAGATGG + Intronic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1014822753 6:126010825-126010847 CATGAGGAAGGGAGGCAAAATGG - Intronic
1015037110 6:128669216-128669238 TATGTGGTCTGGAGGAAAGTAGG - Intergenic
1015342513 6:132118013-132118035 CAGGCCGACTGGAGAAAAGATGG - Intergenic
1015842118 6:137487964-137487986 CAGGAGGACAGGGGCAAAGAGGG - Intergenic
1016343403 6:143085820-143085842 CTTCAGGACAGGAGGACAGATGG - Intronic
1016449973 6:144172459-144172481 CAAGAGGATGGGAGGAAACATGG - Intronic
1016897275 6:149065936-149065958 TATGAGGACTAAAGGATAGAGGG + Intronic
1017429525 6:154357170-154357192 GATTAGGAAAGGAGGAAAGAGGG - Intronic
1018024035 6:159790035-159790057 CCTGAGGCCTGGAGCAAAGCCGG - Intronic
1018030170 6:159835449-159835471 CAAGAGGCCTGGAGGAGAGGAGG + Intergenic
1018613122 6:165662411-165662433 GATGAGGAGGGGAGAAAAGAGGG + Intronic
1020038558 7:4982646-4982668 CAGGAGGTCTGGCAGAAAGAGGG - Intergenic
1020156745 7:5731818-5731840 CAGGAGGTCTGGCAGAAAGAGGG + Intronic
1021514022 7:21463273-21463295 AATGAGGATTTGAGGACAGAGGG + Intronic
1021579898 7:22141632-22141654 CATGAGGTGTGGAGGCAACACGG - Intronic
1021855839 7:24854834-24854856 CATGAGGATTGAATGAGAGAGGG + Intronic
1021880656 7:25092575-25092597 AATGAGGAATGGAGGTTAGAGGG - Intergenic
1022055023 7:26721611-26721633 CAAGTGGACTGGAGGAGAGAGGG - Intronic
1023870347 7:44260045-44260067 CTTGAGGACTGGAGGGAATAAGG - Intronic
1024298157 7:47862799-47862821 AAGGAGGACAGAAGGAAAGAAGG + Intronic
1024823765 7:53365089-53365111 CCTGAGGGCTGCAGGAAAGAGGG + Intergenic
1026221306 7:68399923-68399945 CATGGAGACTGGTGGACAGAGGG - Intergenic
1026229921 7:68473659-68473681 ACTGAGGATTGGAGGAGAGAGGG - Intergenic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1026956107 7:74377275-74377297 CATTAGGACTGGCAGAAAGGGGG - Intronic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1029425990 7:100494209-100494231 CATGGGGAAGGGAGGAAGGAAGG + Exonic
1030511747 7:110491500-110491522 CATGAGGAGTAGTGGAGAGAAGG - Intergenic
1031049928 7:116934769-116934791 CAGGAGGAAGGAAGGAAAGAAGG - Intergenic
1031216641 7:118901081-118901103 GATGAGGAAGGGAGGGAAGAAGG - Intergenic
1031539061 7:122971122-122971144 CATGAGGAAGGAAGGAAGGAAGG - Intergenic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1031991153 7:128200152-128200174 AAGGAGGAGGGGAGGAAAGACGG - Intergenic
1033682057 7:143604428-143604450 CATGAGGCCAGGAGGCAAAATGG + Intergenic
1033702832 7:143857485-143857507 CATGAGGCCAGGAGGCAAAATGG - Intronic
1034013948 7:147561473-147561495 CATGAGCACTGGAATAAAAAGGG + Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037888580 8:22608670-22608692 CATGTGAACTGGAGAGAAGACGG - Intronic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1038365008 8:26922473-26922495 GGTGAGGACTGGAGGAAAAAGGG - Intergenic
1038876633 8:31558216-31558238 CATGAGGCCAGCAGAAAAGACGG - Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1041345321 8:56890894-56890916 CATGATGACTGGATGAAATGTGG + Intergenic
1041640326 8:60192912-60192934 GATGTTGACAGGAGGAAAGAGGG - Intronic
1041692631 8:60703955-60703977 CAAAAGAACTGGATGAAAGAGGG - Intronic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042167240 8:65957737-65957759 AATGAAGCCTGGAGGACAGAAGG + Intergenic
1042591281 8:70402130-70402152 CGTGCGGACCGGAGGAAGGAAGG - Intronic
1042747700 8:72125441-72125463 CATGAGGAGGGCAGGAGAGAGGG + Intergenic
1043613384 8:82093539-82093561 CTTTAGGACAGGAGGATAGATGG - Intergenic
1043858530 8:85289016-85289038 CATGAGGACTTGATGAAGGATGG - Intergenic
1044537966 8:93379333-93379355 CATGAGGAAACGAGGACAGAGGG - Intergenic
1044633124 8:94298135-94298157 GGTGTGGACTGGGGGAAAGAAGG + Intergenic
1046170302 8:110497285-110497307 CTTGAGAACTGGAGTAAAGGTGG + Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048325266 8:133434293-133434315 GATGAGGGCAGGAGGAAGGAAGG - Intergenic
1048690317 8:136955731-136955753 CATGAAGAATGGAGGGAGGAAGG - Intergenic
1048690399 8:136956007-136956029 AATGAGGAAGGAAGGAAAGAAGG - Intergenic
1049318282 8:141981286-141981308 TATCAGGGCTGGAGGAAGGAGGG + Intergenic
1049561253 8:143311780-143311802 AATGAGGAATGAATGAAAGAGGG + Intronic
1049950067 9:635174-635196 CATGAGGTCAGGATGGAAGAGGG - Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1052507942 9:29379105-29379127 CTTCAGGACAGGAGGATAGATGG + Intergenic
1053197961 9:36134974-36134996 TCTGAGGACTGGAGGTGAGAGGG - Intergenic
1053344836 9:37370700-37370722 CCTGAGGACAGGAGGAAACTGGG + Intergenic
1053727306 9:41017089-41017111 CCAGGGGACTGGAGAAAAGAAGG - Intergenic
1054967031 9:71040965-71040987 CGTGACGACTGGAGGCAACATGG + Intronic
1055098238 9:72436640-72436662 CTTGAGGAATGGTGAAAAGACGG - Intergenic
1055292055 9:74792457-74792479 AAAGAGGACTGGAGGAAGGCAGG - Intronic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056438267 9:86594718-86594740 CAGGAGAACTTAAGGAAAGATGG - Intergenic
1056466760 9:86864386-86864408 CATCAGGGAGGGAGGAAAGAAGG + Intergenic
1056627897 9:88269199-88269221 CATGAGTAGTGCAGGGAAGAAGG - Intergenic
1056888416 9:90466924-90466946 AACTAGGACAGGAGGAAAGAGGG + Intergenic
1057753016 9:97807590-97807612 CATGAGCCCTGGAGGACAGCTGG + Intergenic
1058844965 9:108947713-108947735 CATGAATACTGAAGGAAAGAAGG + Intronic
1059390540 9:113996995-113997017 CATGAGGACTTCTGGGAAGATGG + Intronic
1059429885 9:114243580-114243602 CCTGGGGACAAGAGGAAAGAGGG + Intronic
1059636048 9:116171686-116171708 CATGAGGACAGACGGAAGGATGG - Intronic
1059637969 9:116189206-116189228 CATGAGGACTATAGGAAATAAGG + Intronic
1059709738 9:116856530-116856552 GATGAGGAATGGAGAAAAGCCGG + Intronic
1061388560 9:130304698-130304720 CATGAGCACAGGAGGAACCAAGG - Intronic
1062185754 9:135217634-135217656 AAGGAGGAGGGGAGGAAAGAAGG - Intergenic
1062677077 9:137752926-137752948 GGTGAGGACTGGAGGGAAGAGGG + Intronic
1062703159 9:137918635-137918657 CATGAGGGCTGGTGGCATGATGG + Intronic
1185757728 X:2665205-2665227 TAGGAGGAATGGAGGAAGGAAGG - Intergenic
1186272114 X:7900199-7900221 GATCAGGACTGGAGGAACAAAGG - Exonic
1186624001 X:11272477-11272499 AATGAGGAGTGGAGGCAGGAGGG - Intronic
1186819970 X:13277742-13277764 TAGGAGGTCTGAAGGAAAGAAGG + Intergenic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1187500311 X:19833476-19833498 GAGGAGGACTGTGGGAAAGAGGG - Intronic
1188007280 X:25024153-25024175 CATGAGGAAGGAAGGAAGGAAGG - Intergenic
1189865625 X:45324143-45324165 CATGAGGAATGAAGAGAAGATGG - Intergenic
1193684945 X:84566546-84566568 CAAGAAGACTGGTGGAATGATGG + Intergenic
1194752707 X:97702520-97702542 AAAGAGGACTGGAGTTAAGAAGG - Intergenic
1195034924 X:100963833-100963855 CATGAGGACTGGTGAAGAGCAGG - Intergenic
1195592951 X:106653330-106653352 CATGATGACTGGAGGGGATATGG + Intronic
1195593896 X:106665862-106665884 CATTAGGACTGTGGGAAAGAAGG - Intronic
1195632190 X:107069279-107069301 AATGATGACTGGACGAATGAGGG - Exonic
1197892206 X:131278876-131278898 CCTGAGGAAGGAAGGAAAGAAGG - Intronic
1199448732 X:147956200-147956222 CCTGAGGCCTGGTGGAATGAAGG + Intergenic
1199606841 X:149585117-149585139 GGTGAGGACTGAAGGTAAGAAGG - Intronic
1199632282 X:149784251-149784273 GGTGAGGACTGAAGGTAAGAAGG + Intronic
1199682438 X:150236223-150236245 AATGAGGGCTGGAGGAGGGAAGG - Intergenic
1199897792 X:152139712-152139734 TATCAGGACAGCAGGAAAGACGG - Intergenic
1199924651 X:152450227-152450249 CAAGAGGACTGGGGGAAGGGTGG - Intronic
1201568189 Y:15387971-15387993 CTTCAGGACTGGATGATAGATGG - Intergenic
1201905456 Y:19081987-19082009 CTTCAGGACAGGAGGATAGATGG + Intergenic
1202147727 Y:21817448-21817470 CATAGGGACTGGAGCCAAGAGGG - Intergenic