ID: 1179125049

View in Genome Browser
Species Human (GRCh38)
Location 21:38583189-38583211
Sequence CCCTGCCATAAGAACTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179125046_1179125049 21 Left 1179125046 21:38583145-38583167 CCTGGATGAGCAGATATTAGGCA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1179125049 21:38583189-38583211 CCCTGCCATAAGAACTGCACAGG 0: 1
1: 0
2: 2
3: 21
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179125049 Original CRISPR CCCTGCCATAAGAACTGCAC AGG Intronic
900723572 1:4198513-4198535 CACTATCATAAGAACAGCACAGG + Intergenic
900737192 1:4306449-4306471 CACTGCCATGAGAACAGCATGGG + Intergenic
900842081 1:5059930-5059952 CACTGCCACAAAAACAGCACGGG + Intergenic
901205041 1:7489782-7489804 CCCTGGCATGGGAACTGCTCCGG - Intronic
902230032 1:15022000-15022022 CACTGCCATGAGAACAGTACAGG + Intronic
902235111 1:15052390-15052412 CACTGTCACAAGAACAGCACGGG + Intronic
903803757 1:25989510-25989532 CCCCGCTATGAGTACTGCACTGG - Exonic
905008829 1:34732977-34732999 CACTGTCATGAGAACAGCACGGG + Intronic
905542774 1:38773559-38773581 CCCTGCCAGAGCAACTGCATTGG + Intergenic
907585036 1:55609490-55609512 CACTACCATAAGAACCGCATGGG + Intergenic
907615424 1:55919691-55919713 CACTGTCACAAGAACAGCACTGG - Intergenic
907808260 1:57842709-57842731 CACTGTCATAAGAACAGCATGGG + Intronic
908076271 1:60522808-60522830 CACTATCATAAGAACAGCACAGG + Intergenic
909910867 1:81256270-81256292 CACTGTCACAAGAACAGCACAGG + Intergenic
910013972 1:82497974-82497996 CACTGTCATAAGAACAGCAAAGG + Intergenic
910256265 1:85250134-85250156 CACTATCATAAGAACAGCACCGG + Intronic
911258703 1:95662028-95662050 CACTGCCATGAGAATAGCACGGG - Intergenic
912042943 1:105415597-105415619 CACTGTCATAAGAACAGCATGGG - Intergenic
912095696 1:106140181-106140203 CACTGTCATGAGAACAGCACAGG - Intergenic
913127988 1:115811084-115811106 CCCTCCCAATAGAGCTGCACAGG + Intergenic
913300656 1:117366639-117366661 CGCTGCCACGAGAACTTCACCGG - Intergenic
914920040 1:151840148-151840170 TCCTCCCATAAGGACTGCGCTGG - Intronic
915098838 1:153484139-153484161 CCCTGCAATAAGGACTCCTCAGG + Intergenic
916664990 1:166958372-166958394 CCCTACCACGAGAACAGCACAGG - Intronic
916827155 1:168453418-168453440 CCTTTCAATAAGAACTCCACAGG - Intergenic
917442455 1:175079524-175079546 GCCTGCCCTGAGAACTGCAGCGG + Exonic
917892628 1:179454227-179454249 CCCTACCATGAGAACAGCATGGG - Intronic
918633379 1:186746669-186746691 CACTATCATAAGAACAGCACAGG - Intergenic
920101425 1:203519353-203519375 CCGTGCCATCAGAACAGCCCAGG + Intergenic
920162856 1:204012912-204012934 CCATTCCATCAGAACTGCTCAGG - Intergenic
921282339 1:213579068-213579090 CACTATCATAAGAACAGCACAGG - Intergenic
921676727 1:217984340-217984362 CACTGCCATGAGAACAGTACAGG + Intergenic
923384257 1:233450907-233450929 CACTATCATAAGAACAGCACAGG + Intergenic
923596454 1:235363996-235364018 CACTGACTTAAGAATTGCACAGG - Intergenic
1063098765 10:2931563-2931585 CACTACCATGAGAACAGCACAGG - Intergenic
1063580715 10:7304222-7304244 CCCTGTCACAAGAACAGCATGGG - Intronic
1064675965 10:17760869-17760891 CACTGTCACAAGAACAGCACAGG + Intronic
1065164963 10:22966827-22966849 CACTGTCATGAGAACAGCACGGG + Intronic
1065753298 10:28908212-28908234 TCCTGTCATAAGAACAGCATGGG - Intergenic
1067018370 10:42774008-42774030 CACTACCATAAGAACTGTATGGG - Intergenic
1068556664 10:58465889-58465911 CACTGTCACAAGAACAGCACAGG - Intergenic
1069189156 10:65465987-65466009 CACTATCATAAGAACAGCACAGG - Intergenic
1069367655 10:67710975-67710997 CACTGTCATGAGAACAGCACTGG - Intergenic
1070128347 10:73639704-73639726 CCCTGCCATGTTACCTGCACAGG - Intronic
1071230402 10:83579618-83579640 CACTACCATGAGAACAGCACAGG + Intergenic
1071707145 10:88011527-88011549 CACTGTCACAAGAACAGCACAGG - Intergenic
1071941273 10:90594330-90594352 CACTATCATAAGAACAGCACAGG + Intergenic
1071980884 10:91003555-91003577 CACTACCATGAGAACAGCACAGG + Intergenic
1072075664 10:91970555-91970577 CGCTGTCATGAGAACAGCACAGG + Intronic
1072369159 10:94745845-94745867 CACTATCACAAGAACTGCACAGG - Intronic
1072782884 10:98262139-98262161 CCCAGCCATTAGACCCGCACTGG + Exonic
1073613497 10:104968555-104968577 TCCTGACATGAGAACTGCAGTGG - Intronic
1074011065 10:109480595-109480617 CCCTATCATGAGAACAGCACAGG - Intergenic
1074206233 10:111285337-111285359 CCTTGCCATAGGAACTGAACTGG + Intergenic
1074207915 10:111300534-111300556 CACTACCATGAGAACAGCACGGG - Intergenic
1074960035 10:118435980-118436002 CACTGTCATGAGAACAGCACGGG - Intergenic
1075941047 10:126390141-126390163 CACTACCATGAGAACAGCACAGG - Intergenic
1077117441 11:891528-891550 CCCAGCCTCAAGAACTGCCCTGG + Intronic
1079626224 11:22619858-22619880 CCCTACCACAAGAACAGCATGGG - Intergenic
1079881446 11:25932400-25932422 CACTGTCATGAGAACAGCACAGG - Intergenic
1080110207 11:28558121-28558143 CCCTGCCAGAAAAATTTCACTGG - Intergenic
1080236833 11:30079672-30079694 CACTGTTATAAGAACTGCAAGGG - Intergenic
1080958659 11:37131211-37131233 CACTGCCACAAGAAGAGCACTGG - Intergenic
1080980785 11:37403004-37403026 CCCTATCATAAGAAATTCACAGG - Intergenic
1081123206 11:39291446-39291468 CACTGTCATAAGAACAGCAAGGG - Intergenic
1081635007 11:44715282-44715304 CACTGTCATAAGAACAGCATGGG + Intergenic
1081692857 11:45089774-45089796 CCCTGCCATAAGAGAGGCCCAGG - Intergenic
1082867823 11:57915974-57915996 CACTACCATAAGAACAGTACGGG - Intergenic
1084300693 11:68249463-68249485 CACTGTCATAAGAACAGCATGGG - Intergenic
1084894099 11:72252709-72252731 CACTACCACAAGAACAGCACAGG - Intergenic
1085681665 11:78581074-78581096 CACTGCCATGAGAACAGCATGGG + Intergenic
1088273702 11:108061965-108061987 CCCTGTCACAAGAACAGCATGGG + Intronic
1090138045 11:124220556-124220578 CACAGCCATCAGAACTGCTCCGG + Intergenic
1091870634 12:3887869-3887891 CCTTGCCATAAGACATGAACTGG - Intergenic
1093123523 12:15301007-15301029 CACTGCCATGAGAACAGCAATGG + Intronic
1093238756 12:16642537-16642559 CACTATCATGAGAACTGCACTGG + Intergenic
1093784170 12:23173656-23173678 GCCTGCCTGAAGAACTGTACAGG + Intergenic
1094004792 12:25738196-25738218 CACTGTCATGAGAACAGCACAGG + Intergenic
1095594168 12:43939983-43940005 CACTACCACAAGAACAGCACAGG + Intronic
1097400983 12:59127356-59127378 CACTACCATGAGAACAGCACGGG + Intergenic
1097617933 12:61906318-61906340 CACTATCATGAGAACTGCACAGG - Intronic
1098026868 12:66213228-66213250 CACTGTCACAAGAACAGCACTGG + Intronic
1098656348 12:73035022-73035044 CACTATCATGAGAACTGCACGGG + Intergenic
1098743298 12:74201661-74201683 CACTGTCATAAGAACAGCATGGG + Intergenic
1099117597 12:78647225-78647247 CCCTATCATGAGAACAGCACAGG + Intergenic
1099668584 12:85660957-85660979 CACTATCATAAGAACAGCACAGG - Intergenic
1099937698 12:89147525-89147547 CACTATCATAAGAACAGCACGGG - Intergenic
1100451024 12:94706554-94706576 CACTGTCATGAGAACAGCACGGG + Intergenic
1100932051 12:99620101-99620123 CCCTGCCAACAGAAGAGCACAGG + Intronic
1100972102 12:100080970-100080992 CACTACCACAAGAACAGCACAGG - Intronic
1101374909 12:104163230-104163252 CACTGCCACAAGAACAGCATGGG + Intergenic
1101977187 12:109370023-109370045 CACTGTCATGAGAACAGCACAGG + Intronic
1102902736 12:116650965-116650987 CACTGTCACAAGAACAGCACCGG - Intergenic
1104079988 12:125421470-125421492 CACTGTCATGAGAACAGCACAGG + Intronic
1104452925 12:128886014-128886036 CACTGTCATGAGAACAGCACAGG - Intronic
1104466920 12:128997988-128998010 CACTGTCACAAGAACAGCACGGG - Intergenic
1104470643 12:129026828-129026850 CACTGCCATGAGAACAGCATGGG - Intergenic
1104498284 12:129261331-129261353 CACTGTCACAAGAACAGCACAGG - Intronic
1104807909 12:131601193-131601215 CACTACCATGAGAACAGCACGGG + Intergenic
1106076759 13:26466876-26466898 CACTGTCATGAGAACAGCACAGG - Intergenic
1106499047 13:30309478-30309500 CACTACCATAAGAACAGTACGGG - Intergenic
1106524182 13:30525755-30525777 CGCTACCATAAGAACAGCATGGG + Intronic
1107158446 13:37197675-37197697 ACCTGCCAAAAGAAGTGCATAGG - Intergenic
1108155459 13:47579612-47579634 ACCTGCCAAAAGAAGTGCATAGG + Intergenic
1109098408 13:58146069-58146091 CACTACCACAAGAACAGCACAGG - Intergenic
1109718875 13:66251936-66251958 CCCTGCCATAATAATTGAACTGG - Intergenic
1109749720 13:66673206-66673228 CCCTGTCACAAGAACAGCATGGG - Intronic
1110960215 13:81612237-81612259 CACTATCATAAGAACAGCACAGG + Intergenic
1111271962 13:85897295-85897317 ACCTGCCAAAAGAAGTGCATAGG + Intergenic
1111459306 13:88518972-88518994 CCCTACCATGAGAACAGTACTGG - Intergenic
1111715377 13:91873474-91873496 CACTATCATAAGAACAGCACGGG - Intronic
1112194044 13:97207538-97207560 CACTGTCATGAGAACAGCACGGG + Intergenic
1112257983 13:97852332-97852354 CACTGTCATGAGAACAGCACTGG + Intergenic
1112405891 13:99119887-99119909 CACTACCATAAGAACAGTACGGG - Intergenic
1112965733 13:105190867-105190889 CCCTGTCATGAGAACAGCATGGG - Intergenic
1113005287 13:105694863-105694885 CACTACCATAAGAAAAGCACAGG - Intergenic
1113265025 13:108607409-108607431 CACTGTCATGAGAACTGCATAGG - Intronic
1115016165 14:28616969-28616991 CACTACCATGAGAACAGCACAGG + Intergenic
1115840164 14:37461373-37461395 CACTATCATAAGAACAGCACAGG + Intronic
1115840429 14:37463254-37463276 CACTGTCAGAAGAACAGCACAGG + Intronic
1116024422 14:39497781-39497803 CACTACCATGAGAACAGCACAGG - Intergenic
1116211600 14:41953296-41953318 CATTGCCTTAAGAAATGCACTGG + Intergenic
1116666931 14:47788691-47788713 CACTACCATGAGAACAGCACAGG + Intergenic
1116713206 14:48396179-48396201 CACTGTCATGAGAACTGCAAGGG - Intergenic
1116968641 14:51041599-51041621 GGCTGCCTTAAGAACTGCCCTGG - Intronic
1117451799 14:55858329-55858351 CACTGTCATGAGAACAGCACAGG - Intergenic
1117671363 14:58110008-58110030 CACTACCACAAGAACAGCACAGG + Intronic
1119035817 14:71229998-71230020 CACTGTCACAAGAACAGCACAGG + Intergenic
1120188451 14:81418311-81418333 CACTGTCATGAGAACAGCACAGG + Intronic
1120207387 14:81601068-81601090 CCCTGCCCTAATCACTGCAGGGG + Intergenic
1120582970 14:86277351-86277373 CACTGTCACAAGAACAGCACAGG + Intergenic
1120730082 14:87992462-87992484 CCCTGCACTAACAACTGCACGGG + Intronic
1121729703 14:96177922-96177944 GCCTTCCAGAAGAACTGCAGTGG - Intergenic
1122756614 14:103985334-103985356 CACTATCATAAGAACAGCACAGG - Intronic
1123276768 15:17914294-17914316 CCTTCACATAAAAACTGCACGGG + Intergenic
1123298284 15:18292017-18292039 CCTTCACATAAAAACTGCACGGG + Intergenic
1123841481 15:24252420-24252442 CACTGTCATAAGAACAGCAAGGG + Intergenic
1126399676 15:48256670-48256692 CACTGTCATGAGAACAGCACAGG + Intronic
1126778222 15:52117822-52117844 CCCTGCCCTGAGATCTGGACTGG - Exonic
1128357889 15:66941295-66941317 CCCAGGCATAGGAAGTGCACAGG + Intergenic
1130324306 15:82866670-82866692 CACTATCATAAGAACAGCACAGG - Intronic
1130824919 15:87533917-87533939 CACTGCCATGAGAACAGCATAGG + Intergenic
1130948315 15:88566165-88566187 CCAGGCAATAGGAACTGCACAGG + Intergenic
1131749505 15:95491393-95491415 CTCTGCCATATAATCTGCACGGG - Intergenic
1131770149 15:95728472-95728494 CACTGTCATGAGAACTGCATGGG - Intergenic
1132416072 15:101619733-101619755 CCATCCCACAAGAACTGCAGTGG - Intergenic
1132814351 16:1818682-1818704 CCCGGCCATATGACCTCCACAGG + Intronic
1134246845 16:12546470-12546492 CACTGTCAGAAGAACAGCACAGG + Intronic
1134340201 16:13337764-13337786 CACTGTCATAAGAACAGCAGGGG - Intergenic
1134784166 16:16925728-16925750 CACTGTCATAAGAACAGCATGGG - Intergenic
1135029899 16:19030018-19030040 CCCTGGCATTAAAAATGCACAGG - Intronic
1137025183 16:35466878-35466900 TCCTGGCATAATAACTGCATTGG + Intergenic
1137370822 16:47904256-47904278 TCCTGCCTTAATCACTGCACTGG + Intergenic
1137638691 16:50009624-50009646 CCCTGTCATGAGAACAGCAAGGG - Intergenic
1137862117 16:51856912-51856934 CACTGTCATGAGAACAGCACGGG - Intergenic
1138129896 16:54470749-54470771 CACTGTCATAAAAACAGCACTGG - Intergenic
1138220699 16:55248014-55248036 CACTGTCATGAGAACAGCACAGG + Intergenic
1139232872 16:65303361-65303383 CACTACCACAAGAACAGCACAGG + Intergenic
1139309249 16:66014421-66014443 CACTTCCATGAGAACAGCACGGG - Intergenic
1139671437 16:68494547-68494569 CACTATCATAAGAACAGCACAGG + Intergenic
1140285404 16:73598122-73598144 CCCTCCCTTCTGAACTGCACTGG - Intergenic
1140340110 16:74149650-74149672 CACTGCCATGAGAACAGCATGGG - Intergenic
1141403031 16:83767330-83767352 CGCTACCATAAGAACAGTACGGG - Intronic
1142760182 17:2037420-2037442 CCCTGCCATTAGTACGGAACGGG - Intronic
1144460035 17:15451143-15451165 CACTATCATAAGAACAGCACGGG - Intronic
1146468328 17:33104727-33104749 CCCTGCCATGAAAATAGCACAGG - Intronic
1149292717 17:55233023-55233045 CACTATCACAAGAACTGCACAGG - Intergenic
1149620925 17:58044380-58044402 CACTACCATAAGAACAGCACAGG - Intergenic
1150045454 17:61908447-61908469 CCCTGCCTGAAGAACTGTAGTGG - Intronic
1150937497 17:69652852-69652874 CACTATCATAAGAACAGCACGGG + Intergenic
1151537455 17:74746985-74747007 CCCTGCCATGGGAAGTGGACAGG + Exonic
1153077441 18:1181040-1181062 CACTGTCACAAGAACAGCACAGG + Intergenic
1153127455 18:1811613-1811635 CACTACCATGAGAACAGCACGGG - Intergenic
1153842330 18:9017887-9017909 CCCTGTCAAATGAACTGCACTGG - Intergenic
1155320879 18:24617733-24617755 CCCTTCCCTAAGTACTTCACAGG - Intergenic
1155764199 18:29606509-29606531 CACTACCATGAGAACAGCACAGG - Intergenic
1155843623 18:30677924-30677946 CACTGCCACAAGAACAGCATGGG - Intergenic
1156381121 18:36562310-36562332 CCCGGCCATGACAACTACACTGG + Intronic
1156426473 18:37019237-37019259 ACCTGCCAAAAGAAGTGCACAGG - Intronic
1156813945 18:41286247-41286269 CACTGTCAGAAGAACAGCACAGG + Intergenic
1156927151 18:42596328-42596350 ACCTGCCAAAAGAAATGCATGGG - Intergenic
1157012795 18:43671582-43671604 CACTGTCATAAGAATAGCACAGG - Intergenic
1158226642 18:55208094-55208116 CACTATCATGAGAACTGCACAGG + Intergenic
1158297065 18:56010091-56010113 CACTACCATGAGAACAGCACGGG + Intergenic
1159254190 18:65924408-65924430 CACTACCATGAGAACTGCATGGG - Intergenic
1159744935 18:72221346-72221368 CACTATCATAAGAACAGCACAGG - Intergenic
1160082158 18:75737866-75737888 CCCTGTCACAAGAATAGCACTGG - Intergenic
1163216092 19:15878925-15878947 CCCTCCCCTAGGAACTGCATCGG - Exonic
1164902044 19:31936438-31936460 CAGTGCCATAAGAACTGTATGGG - Intergenic
1165893620 19:39128969-39128991 GCTGGCCATAAGAACTGCCCAGG - Intronic
1166519588 19:43471461-43471483 CTCTGCCATAAAATCTGCAAAGG - Intergenic
1167402522 19:49282386-49282408 CCCTGCCACGAGAACAGCATGGG + Intergenic
1168451779 19:56471960-56471982 CACTGCCATGAGAACAGCATGGG - Exonic
925768524 2:7260158-7260180 ACCTGCCAAAAGAAGTGCACAGG + Intergenic
926907973 2:17823763-17823785 CACTATCATAAGAACAGCACAGG - Intergenic
926979213 2:18549316-18549338 CACTACCATGAGAACAGCACAGG - Intergenic
927318207 2:21710688-21710710 CACTGTCATGAGAACAGCACAGG + Intergenic
927337418 2:21941200-21941222 CACTGTCATGAGAACAGCACGGG - Intergenic
927342038 2:21993452-21993474 CTCTACCATGAGAACTGCATGGG + Intergenic
928594656 2:32848360-32848382 CACTACCATGAGAACAGCACAGG - Intergenic
929345916 2:40884590-40884612 CACTGTCACAAGAACAGCACGGG - Intergenic
929773286 2:44911177-44911199 CCCTATCATAAGAACAGCATGGG + Intergenic
930263250 2:49171080-49171102 CACTATCATAAGAACAGCACAGG - Intergenic
930275794 2:49309889-49309911 CCCTGTGATAAGTACTGCAAAGG + Intergenic
930925360 2:56811309-56811331 CACTGTCATAAGAGCAGCACGGG - Intergenic
932696237 2:73959257-73959279 CACTGCCATGAGAACAGCATGGG + Intergenic
932960512 2:76407778-76407800 CGCTGTCATGAGAACAGCACAGG - Intergenic
933047724 2:77559071-77559093 CACTGTCAGAAGAACAGCACAGG - Intronic
933787513 2:85855198-85855220 CACTACCACAAGAACGGCACAGG - Intronic
935512873 2:103997636-103997658 CCCTGCCAAAAAAATTGCACGGG - Intergenic
937750907 2:125475547-125475569 CACTGTCACAAGAACAGCACAGG - Intergenic
939397063 2:141644273-141644295 CACTATCATAAGAACAGCACTGG - Intronic
939994283 2:148905946-148905968 CACTGTCATGAGAACAGCACAGG + Intronic
941578595 2:167267480-167267502 CACTGTCATGAGAACAGCACAGG - Intergenic
941933600 2:170965959-170965981 CCCTGCCACAACTACTGCAAAGG + Exonic
942298011 2:174535906-174535928 CCCTACCCCGAGAACTGCACAGG - Intergenic
943256628 2:185602047-185602069 CACTGTCATAAGAACAGCATGGG + Intergenic
943389912 2:187252501-187252523 CACTACCATAAGAACAGCACGGG + Intergenic
944012176 2:194985007-194985029 ACCTGCCAACAGAAGTGCACAGG + Intergenic
944087537 2:195866877-195866899 CACTATCATAAGAACAGCACGGG - Intronic
945065075 2:205941365-205941387 CACTGTCATGAGAACAGCACAGG - Intergenic
945347701 2:208738560-208738582 ACCTGCCAACAGAAGTGCACAGG - Intronic
945643952 2:212466464-212466486 CACTATCATAAGAACAGCACAGG - Intronic
946122966 2:217532505-217532527 CACTGTCATGAGAACAGCACAGG - Intronic
946247925 2:218397897-218397919 CCCTGGGAAAAGAACTGCACGGG + Intergenic
947338913 2:229116544-229116566 CACTACCATGAGAACAGCACGGG - Intronic
1169525557 20:6421322-6421344 GTCTGCCTTAAGAACTGCACAGG - Intergenic
1169538464 20:6573834-6573856 ACTTGCCATAAGTACTGCAAAGG - Intergenic
1169671247 20:8105547-8105569 ACCTGCCAAAAGAAGTGCATAGG - Intergenic
1170486500 20:16821705-16821727 ACCTGCCAAAAGAAATCCACGGG + Intergenic
1171302996 20:24080069-24080091 CCCTTCCACATGAACTGCAGGGG - Intergenic
1171749796 20:29037982-29038004 CACTGTCATGAGAACAGCACGGG + Intergenic
1172922712 20:38499198-38499220 GCCTTCAATAAGAACTGAACAGG + Intronic
1173192887 20:40889498-40889520 CACTGTCACAAGAACAGCACAGG + Intergenic
1173329248 20:42060531-42060553 CACTGTCACAAGAACAGCACAGG - Intergenic
1176315442 21:5238019-5238041 CACTGCCATGAGAACAGCACGGG - Intergenic
1176696939 21:9989537-9989559 CTCTGTCTTAAGAACTGAACTGG - Intergenic
1176889285 21:14294720-14294742 CACTACCATGAGAACAGCACAGG + Intergenic
1177022259 21:15876618-15876640 CCCTGTCACAAGAACAGCACTGG + Intronic
1177122097 21:17150557-17150579 CACTGTCATGAGAACAGCACAGG + Intergenic
1177674862 21:24284034-24284056 CACTGCCATGAGAACAGCATGGG - Intergenic
1178793546 21:35722473-35722495 CACTGTCATGAGAACAGCACAGG + Intronic
1179125049 21:38583189-38583211 CCCTGCCATAAGAACTGCACAGG + Intronic
1179299273 21:40091840-40091862 CACTGTCATGAGAACAGCACAGG + Intronic
1179469255 21:41599569-41599591 CACTATCATAAGAACCGCACAGG - Intergenic
1181533846 22:23531721-23531743 TGCTGCCGTAACAACTGCACGGG + Intergenic
1182863186 22:33579197-33579219 CACTGTCACAAGAACAGCACGGG - Intronic
1185250992 22:49801658-49801680 CTCTGCCAGAAGAGCTGCTCTGG + Intronic
951164822 3:19472434-19472456 CACTATCATAAGAACAGCACAGG - Intronic
951233432 3:20206684-20206706 CCCTATCATGAGAACAGCACAGG - Intergenic
951773626 3:26284934-26284956 CACTGCCACAATAACAGCACAGG + Intergenic
952397220 3:32931374-32931396 CACTGTCATGAGAACAGCACAGG - Intergenic
953543281 3:43841483-43841505 CCATGCCATGAGCCCTGCACTGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954407250 3:50352059-50352081 CCCACCCCTAAGAACTGCCCAGG - Intronic
954960654 3:54562001-54562023 CGCTATCATAAGAACAGCACAGG + Intronic
955036941 3:55277192-55277214 CCCTATCACAAGAACAGCACGGG + Intergenic
955131806 3:56177164-56177186 CTCTGCTTTAAGAACTGCAATGG + Intronic
955445890 3:59008945-59008967 CCCTGCCATTATAACTCCACAGG + Intronic
955455521 3:59116851-59116873 CCCTGGTATAAGAAGTGGACTGG - Intergenic
956558940 3:70552168-70552190 CACTACCACAAGAACAGCACAGG + Intergenic
956718951 3:72101344-72101366 CCCTGCCCTAGGAACTACAGGGG - Intergenic
956737940 3:72252910-72252932 CACTAACATAAGAACAGCACGGG + Intergenic
957158989 3:76584164-76584186 CCCTTCCATAAGATCTTCAGAGG + Intronic
957160458 3:76602603-76602625 CACTTTCATAAGAACAGCACAGG + Intronic
957608466 3:82434961-82434983 CACTACCATAAGAACAGCATGGG - Intergenic
957945341 3:87056788-87056810 CACTACCACAAGAACAGCACAGG + Intergenic
957954290 3:87163897-87163919 CACTGTCATAAGAAAAGCACGGG + Intergenic
959099313 3:101992204-101992226 CACTGTCACAAGAACAGCACAGG - Intergenic
961210757 3:125123674-125123696 CACTGCCATGGGAACAGCACGGG + Intronic
963400939 3:144798245-144798267 CACTATCATAAGAACAGCACAGG + Intergenic
964639578 3:158894322-158894344 CCCTATCAGAAGAACAGCACAGG + Intergenic
964844131 3:161027572-161027594 CACTGTCACAAGAACAGCACGGG + Intronic
965809490 3:172577352-172577374 CACTGTCAAAAGAACAGCACAGG - Intergenic
965892244 3:173529201-173529223 ACCTGCCAACAGAAGTGCACAGG - Intronic
966228836 3:177628352-177628374 CACTATCATGAGAACTGCACAGG + Intergenic
966733212 3:183167901-183167923 CACTGTCATGAGAACAGCACGGG + Intergenic
967207048 3:187133308-187133330 CACTGTCACAAGAACAGCACGGG - Intronic
967208592 3:187146608-187146630 CACTGCCACAAGAACAGCATGGG + Intronic
967320857 3:188193681-188193703 CTTTGCCATAAGAACTTCGCTGG + Intronic
967957185 3:194886344-194886366 CCCTACCGTAAGAACTGTATGGG + Intergenic
969087291 4:4665963-4665985 CCCTGCAGTGAGAACTCCACTGG + Intergenic
971126397 4:23760091-23760113 CACTACCATGAGAACAGCACGGG + Intronic
971260449 4:25052166-25052188 CACTACCATAAGAATGGCACAGG - Intergenic
971844760 4:31905388-31905410 CACTGTCACAAGAACAGCACAGG + Intergenic
972678114 4:41279817-41279839 CACTGTCACAAGAACAGCACAGG + Intergenic
972816544 4:42652688-42652710 CACTGTCATGAGAACAGCACGGG - Intronic
974517592 4:62937048-62937070 CACTGTCATGAGAACAGCACAGG - Intergenic
974775336 4:66473099-66473121 ACCTGCCAAAAGAAGTGCATAGG - Intergenic
976283231 4:83346116-83346138 CCCTGTCATAAGAATGGCATGGG + Intergenic
976440530 4:85068361-85068383 CACTGTCACAAGAACAGCACAGG + Intergenic
978083536 4:104622457-104622479 CACTGTCATAAGAACAGCATGGG + Intergenic
979108544 4:116719399-116719421 CACTATCATAAGAACAGCACAGG + Intergenic
979261375 4:118650009-118650031 CACTGTCACAAGAACAGCACAGG - Intergenic
980158375 4:129132936-129132958 TCCTTCCATAAGACCTGCTCAGG - Intergenic
980346721 4:131632108-131632130 CACTACCATAAGAACAGCATGGG - Intergenic
980426277 4:132631229-132631251 CCCTATCACAAGAACAGCACGGG - Intergenic
980545687 4:134259256-134259278 CCCTACCATGAGAACAGCACAGG + Intergenic
980882985 4:138732394-138732416 CCCTATCATGAGAACAGCACGGG + Intergenic
982118448 4:152116845-152116867 CCCTGCCCTAAAACCTGCAATGG + Intergenic
983880096 4:172923358-172923380 CACTGTCATGAGAACAGCACTGG + Intronic
984571790 4:181403918-181403940 CACTGTCATGAGAACAGCACGGG + Intergenic
985931493 5:3061400-3061422 CACTGTCACAAGAACAGCACAGG + Intergenic
985955425 5:3262087-3262109 CACTGCCATGAGAACAGCATGGG - Intergenic
987817119 5:22917057-22917079 CCCTATCATGAGAACAGCACGGG + Intergenic
988394634 5:30680649-30680671 CACTGTCACAAGAACTGCATGGG - Intergenic
988649551 5:33132685-33132707 CGCTGTCATGAGAACAGCACAGG - Intergenic
988691846 5:33580404-33580426 CACTGTCACAAGAACAGCACGGG + Intronic
988889538 5:35599570-35599592 CACTGTCATGAGAACAGCACAGG - Intergenic
988923960 5:35970430-35970452 CCCTATCACAAGAACGGCACAGG + Intronic
989203065 5:38784958-38784980 CACTGCCATAGGCACTGCACAGG + Intergenic
989203408 5:38787643-38787665 CACTGTCATGAGAACAGCACAGG - Intergenic
990364008 5:55050850-55050872 CACTATCATAAGAACAGCACAGG + Intergenic
990446130 5:55896409-55896431 ACCTTCCATAACAACCGCACTGG - Exonic
990592088 5:57276570-57276592 CACTGTCACAAGAACAGCACGGG + Intergenic
992854718 5:80848674-80848696 CACTGTCATGAGAACAGCACAGG + Intronic
993414944 5:87615497-87615519 CACTATCATAAGAACAGCACAGG + Intergenic
993481474 5:88430164-88430186 CACTGTCATGAGAACTGCATGGG + Intergenic
993578243 5:89628066-89628088 CACTGTCATAAGAACAGCATGGG - Intergenic
993723844 5:91347008-91347030 CACTATCATAAGAACAGCACCGG + Intergenic
994340913 5:98626700-98626722 CCCTATCACAAGAACAGCACGGG + Intergenic
994446436 5:99879911-99879933 CTCTGCCATTGCAACTGCACTGG + Intergenic
994866335 5:105276637-105276659 CACTGTCACAAGAACAGCACAGG - Intergenic
995120451 5:108530976-108530998 CACTGTCATGAGAACAGCACAGG + Intergenic
995389888 5:111628012-111628034 CACTGACATAAGAACAGCATGGG - Intergenic
995517874 5:112972253-112972275 CACTGTCATGAGAACAGCACAGG - Intergenic
995944031 5:117620556-117620578 CACTACCACAAGAACAGCACAGG - Intergenic
996452478 5:123641304-123641326 CCCTGTCACAAGAACAGCAAGGG + Intergenic
996922678 5:128787311-128787333 CACTATCATGAGAACTGCACAGG + Intronic
997037614 5:130212041-130212063 CACTGTCATAAGAACAGCATCGG + Intergenic
997693015 5:135839795-135839817 CACTACCACAAGAACAGCACAGG - Intronic
998703299 5:144730747-144730769 CCCTGCCATTCCAACTTCACAGG - Intergenic
998813815 5:145992706-145992728 CACTATCATAAGAACAGCACAGG + Intronic
1000705548 5:164506225-164506247 CCATGCTGTAACAACTGCACAGG - Intergenic
1002020232 5:176359609-176359631 GCCTGCCAGAAGAACAGCATTGG - Intronic
1002030033 5:176421226-176421248 CACTGTCACAAGAACTGCACAGG - Intergenic
1002588084 5:180265431-180265453 CACTGTCACAAGAACAGCACGGG - Intronic
1003203108 6:3981315-3981337 CACTATCATAAGAACAGCACGGG + Intergenic
1003863936 6:10346707-10346729 CCCTATCATGAGAACAGCACTGG + Intergenic
1003970512 6:11294922-11294944 CACTGCCATAAGAACAGCACGGG - Intronic
1006280216 6:33046491-33046513 CACTGTCACAAGAACAGCACTGG - Intergenic
1007148249 6:39659588-39659610 CACTGTCATAAGAACAGCATGGG - Intronic
1008186693 6:48401231-48401253 CCCTGCCAAAAGAACATCCCGGG - Intergenic
1008825052 6:55684045-55684067 CACTGCCACAAGAACAGCACAGG - Intergenic
1009535184 6:64873271-64873293 CACTATCATGAGAACTGCACGGG + Intronic
1009581148 6:65535366-65535388 CACTACCATGAGAACAGCACCGG - Intronic
1011310852 6:85977932-85977954 ACCTGCCATTAGAAGTGCATAGG + Intergenic
1011550817 6:88529677-88529699 CCCTGCCATAAAAATGACACTGG + Intergenic
1012029331 6:94037876-94037898 CACTGCCACAAGAACAGCAAGGG - Intergenic
1012617237 6:101292590-101292612 CCCTATCATAAGAACAGCATGGG + Intergenic
1013149187 6:107427167-107427189 CACTGTCACAAGAACAGCACAGG - Intronic
1013713752 6:112933083-112933105 CACTACCATGAGAACAGCACAGG - Intergenic
1014101762 6:117518732-117518754 CACTGTCATGAGAACAGCACGGG + Intronic
1014620925 6:123666295-123666317 CACTGTCATGAGAACAGCACAGG + Intergenic
1014841651 6:126226887-126226909 CACTGTCATGAGAACAGCACAGG - Intergenic
1014857313 6:126417568-126417590 CACTATCATAAGAACAGCACAGG - Intergenic
1015044794 6:128764158-128764180 CACTCTCATGAGAACTGCACAGG + Intergenic
1015173368 6:130279306-130279328 CACTGTCATGAGAACTGCATGGG - Intronic
1015285019 6:131476624-131476646 CACTGTCATGAGAACAGCACAGG - Intergenic
1015719387 6:136225679-136225701 CACTGTCACAAGAACAGCACGGG + Intergenic
1016143774 6:140645003-140645025 CACTACCATGAGAACAGCACAGG + Intergenic
1016757434 6:147702199-147702221 CACTGTCATAAGAACAGCATGGG + Intronic
1018076155 6:160215481-160215503 CACTACCACAAGAACAGCACAGG + Intronic
1018534541 6:164806588-164806610 TCCTGTCATAAGAACAGCATGGG + Intergenic
1019884592 7:3892936-3892958 CCCTGCCATGTGAAGTGCGCTGG - Intronic
1020405845 7:7833218-7833240 CCATGCCAGATGAACTGCAGTGG + Intronic
1020885773 7:13817340-13817362 CACTACCATAAGAGCAGCACAGG - Intergenic
1021372970 7:19872944-19872966 CACTGCCATGAGAACAGCATGGG - Intergenic
1021462315 7:20902252-20902274 CACTGTCATGAGAACGGCACAGG - Intergenic
1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG + Intergenic
1023060782 7:36323737-36323759 CACTGTCATAAGAACAGCATAGG - Intergenic
1023497557 7:40814969-40814991 ACCTGCCATCAGAAGTGCATGGG - Intronic
1024440730 7:49414353-49414375 CACTGTCATGAGAACAGCACGGG - Intergenic
1026180365 7:68034132-68034154 CACTGTCATGAGAACAGCACAGG + Intergenic
1026655547 7:72253614-72253636 CACTGTCATAAGAACAGCACGGG + Intronic
1026698606 7:72619140-72619162 CACTGCCTTAAAACCTGCACAGG + Intronic
1030452688 7:109732238-109732260 CACTGTCATGAGAACAGCACAGG + Intergenic
1030582628 7:111377557-111377579 TCCTGCCACAGAAACTGCACAGG + Intronic
1031271276 7:119652671-119652693 CACTACCATGAGAACAGCACAGG + Intergenic
1031625003 7:123982421-123982443 CACTACCACAAGAACAGCACAGG + Intergenic
1032440611 7:131940374-131940396 CACTGTCACAAGAACAGCACGGG + Intergenic
1033156432 7:138961004-138961026 CCCTTCTGTCAGAACTGCACAGG - Intronic
1033884913 7:145933036-145933058 CACTACCACAAGAACAGCACAGG - Intergenic
1034718228 7:153263581-153263603 CACTATCATAAGAACAGCACAGG + Intergenic
1034996983 7:155583866-155583888 TCCTGCCCTCAGAACTCCACTGG - Intergenic
1035048945 7:155987274-155987296 CTCTGTCATGAGAACAGCACGGG - Intergenic
1037290818 8:17347809-17347831 CCCTTTCATCAGAATTGCACAGG - Intronic
1037331245 8:17745927-17745949 CACTGTCATAAGAACAGCAAGGG - Intronic
1037711102 8:21356063-21356085 CAATGCAATAAGAATTGCACGGG - Intergenic
1038289841 8:26239272-26239294 CACTACCATGAGAACAGCACAGG + Intergenic
1039642625 8:39240728-39240750 CACTGTCATGAGAACAGCACAGG + Intronic
1039777221 8:40748963-40748985 CGCTTCCACAAGAACAGCACTGG - Intronic
1041013661 8:53569760-53569782 CACTGTCACAAGAACTGCATGGG - Intergenic
1041066858 8:54090831-54090853 CACTGTCATAAGAACAGCATGGG - Intronic
1041326398 8:56670686-56670708 CACTATCACAAGAACTGCACAGG - Intergenic
1044152544 8:88799717-88799739 CACTAGCATAAGAACAGCACGGG - Intergenic
1044847734 8:96398652-96398674 CACTGTCATGAGAACAGCACAGG + Intergenic
1044955664 8:97476815-97476837 ACCTGCCAAAAGAAGTGCATAGG + Intergenic
1045889277 8:107135126-107135148 CACTACCATAAGAACAGCAAAGG - Intergenic
1046236021 8:111424674-111424696 CACTGCCAGGAGAACAGCACAGG - Intergenic
1046314106 8:112477965-112477987 CCCTATCACAAGAACAGCACGGG - Intronic
1046430141 8:114113733-114113755 TGCTGCTATAAGAACTCCACGGG - Intergenic
1046433009 8:114153013-114153035 CACTATCATAAGAACAGCACAGG + Intergenic
1046630971 8:116622758-116622780 CACTATCATAAGAACAGCACAGG - Intergenic
1046700540 8:117395909-117395931 CCATGTCATAAGATCTGCTCTGG + Intergenic
1046839325 8:118839944-118839966 CCCTGTCACAAGAACAGCATGGG - Intergenic
1047151212 8:122265235-122265257 CACTGTCACAAGAACAGCACGGG + Intergenic
1048029007 8:130613332-130613354 CACTGTCATGAGAACTGCATGGG - Intergenic
1048122045 8:131592475-131592497 CACTGACACAAGAACAGCACGGG - Intergenic
1049521885 8:143095524-143095546 CTCTGTCATGAGAACAGCACTGG - Intergenic
1050082568 9:1930435-1930457 CACTGTCATGAGAACAGCACGGG + Intergenic
1051015987 9:12475797-12475819 CACTGTCATGAGAACTGCAAGGG - Intergenic
1051385066 9:16499019-16499041 ACCTGCCATAAGAAAAGCACAGG + Intronic
1051583434 9:18702127-18702149 CACTGTCATGAGAACAGCACAGG + Intronic
1052518312 9:29511366-29511388 CACTATCATAAGAACGGCACAGG + Intergenic
1052767820 9:32659801-32659823 CACTGTCATGAGAACAGCACTGG + Intergenic
1052867407 9:33473002-33473024 CCCTGCCCTAAGTAATGCCCAGG + Intronic
1052949602 9:34198101-34198123 CCCAGCCAACAGACCTGCACTGG - Intronic
1053258743 9:36642359-36642381 CCCTACCACAAGACCTGCATTGG - Intronic
1054758980 9:68987828-68987850 CACTACCATGAGAACAGCACGGG + Intronic
1054999538 9:71433305-71433327 CACTGTCACAAGAACAGCACGGG - Intronic
1056083311 9:83119771-83119793 CACTATCATAAGAACAGCACGGG - Intergenic
1056249660 9:84734614-84734636 CACTGTCATGAGAACAGCACAGG - Intronic
1057491519 9:95523521-95523543 CACTACCATGAGAACAGCACGGG - Intergenic
1058274702 9:103024919-103024941 CACTGTCATGAGAACAGCACAGG - Intergenic
1058526852 9:105867495-105867517 ACCTGCCCTAAGAGCTGCAAGGG - Intergenic
1059826778 9:118038819-118038841 CACTGTCATAAGAACAGCATGGG - Intergenic
1060021101 9:120132024-120132046 CACTATCATAAGAACAGCACAGG + Intergenic
1060021479 9:120135087-120135109 CGCTGTCACAAGAACAGCACAGG + Intergenic
1060751984 9:126176188-126176210 CACTGTCATGAGAACAGCACAGG + Intergenic
1061483104 9:130906842-130906864 CCCTGCCAGAAGAGCCGCCCAGG - Intronic
1061620592 9:131808964-131808986 CCCAGCCACAGGATCTGCACAGG - Intergenic
1203454289 Un_GL000219v1:150283-150305 CACTGTCATGAGAACAGCACGGG - Intergenic
1185849227 X:3469834-3469856 CACTACCATGAGAACAGCACAGG + Intergenic
1185867661 X:3637678-3637700 CCCTGCCTCATGAAATGCACAGG + Intronic
1186320264 X:8416508-8416530 CACTACCACAAGAACAGCACAGG - Intergenic
1186924003 X:14312057-14312079 CCCTACCATCAGAACTTCGCAGG + Intergenic
1187030285 X:15480097-15480119 CACTGTCACAAGAACAGCACAGG - Intronic
1187072494 X:15902136-15902158 CACTACCATGAGAACAGCACAGG + Intergenic
1188196539 X:27241261-27241283 CACTGTCACAAGAACAGCACAGG - Intergenic
1188785223 X:34337227-34337249 CACTATCATAAGAACAGCACAGG + Intergenic
1192988420 X:76425881-76425903 CCCAGGCATAAAAACTGCATTGG + Intergenic
1194172315 X:90602247-90602269 ACCTGCCAAAAGAAGTGCATGGG + Intergenic
1194830636 X:98619199-98619221 CACTGTCATGAGAACAGCACAGG + Intergenic
1194910218 X:99632093-99632115 CACTGTCATAAGAACAGCAAGGG + Intergenic
1197995372 X:132367090-132367112 CACTGTCACAAGAACAGCACAGG + Intergenic
1199157776 X:144570953-144570975 CACTTTCATGAGAACTGCACTGG - Intergenic
1199178947 X:144829304-144829326 CACTGTCATGAGAACAGCACAGG - Intergenic
1199192190 X:144982723-144982745 CCCTATCATAAGAACTGCACAGG - Intergenic
1199222984 X:145339282-145339304 CACTACCACAAGAACAGCACGGG + Intergenic
1199307539 X:146284567-146284589 CACTACCACAAGAACAGCACGGG - Intergenic
1199370355 X:147041293-147041315 CACTGTCATAAGAACAGCACGGG - Intergenic
1199491163 X:148402285-148402307 CACTGTCATGAGAACAGCACAGG + Intergenic
1199991309 X:152989077-152989099 CCCTGCCCTATAGACTGCACAGG + Exonic
1200518540 Y:4179983-4180005 ACCTGCCAAAAGAAGTGCATGGG + Intergenic
1200814431 Y:7516964-7516986 CACTACCATGAGAACAGCACAGG - Intergenic