ID: 1179126461

View in Genome Browser
Species Human (GRCh38)
Location 21:38595385-38595407
Sequence AATTAAGCAGAGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179126461 Original CRISPR AATTAAGCAGAGAAGGTGCA GGG Intronic
901357706 1:8665672-8665694 ATTTAAGTAGAGCAGGTGGAAGG + Intronic
902812499 1:18896555-18896577 AGGTGAGCAGAGAAAGTGCAGGG + Intronic
903982316 1:27198068-27198090 ATTTAGGAAGAGAAGATGCAGGG + Intergenic
904017196 1:27431232-27431254 AATTCAGCAGAGAAGTGGAATGG - Intronic
904175843 1:28628203-28628225 AATTAGCCAGACACGGTGCAGGG + Intronic
904850795 1:33457879-33457901 AATAAAGCAATGAAGGTGGATGG - Intergenic
906561337 1:46759798-46759820 GAATAAGCAGAGAGAGTGCAAGG - Intronic
906785614 1:48612983-48613005 AATTAAGCAGGCAAGGTGGTGGG + Intronic
907050329 1:51325915-51325937 AGTTAAGCAGAAGAGGTGCCGGG - Intronic
907381643 1:54095604-54095626 CATTAAGCAGAGCAGGTCTAGGG - Intronic
907750223 1:57256211-57256233 ATTTAAGGAAAGAATGTGCAGGG - Intronic
908896037 1:68900581-68900603 AATAGAGCAGAGAAAGTACAAGG - Intergenic
908922115 1:69207940-69207962 AATTAGGCATAGAAGATGCAGGG + Intergenic
909113930 1:71510590-71510612 ACTTAAGCAGAGAAGGGGATGGG + Intronic
909658011 1:78052234-78052256 AATTAAGCAGAGAAGGGAACAGG - Intronic
910573097 1:88728156-88728178 AATACAGCAGAGAAGGTAGAAGG - Intronic
910702973 1:90096431-90096453 AATTCAACAAGGAAGGTGCAGGG + Intergenic
910746884 1:90583780-90583802 TTTGAAGAAGAGAAGGTGCAAGG - Intergenic
910879844 1:91913541-91913563 AATCAGGCAGAAAAGGTACACGG + Intergenic
911020493 1:93382244-93382266 AATTAAACAGAGAAAATGTAGGG - Intergenic
911117860 1:94265055-94265077 AATTATGCATAGAAGGGCCATGG + Intronic
912338830 1:108889788-108889810 TATTAAGCAGAGAGGTTGCACGG - Intronic
915913403 1:159928064-159928086 AGTGGAGCAGAGAAGGTGCAGGG + Intronic
917472430 1:175337187-175337209 AATAAAGCAGTGGAGGTGCTGGG - Intronic
917473981 1:175352508-175352530 AATTAACCTGCGAATGTGCAGGG + Intronic
917491031 1:175498660-175498682 AGTTAAGCAGAGAAGGAATATGG + Intronic
918343916 1:183590148-183590170 ACTGAAGCAGAGAAGGTGAGTGG - Exonic
918934477 1:190902963-190902985 AATTCAGCAGAGAAGCTATAAGG - Intergenic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
920976780 1:210793606-210793628 AATTAAACAGAGAATGTGAGTGG + Intronic
921277890 1:213537346-213537368 AATTAAGCAAACCAGCTGCAGGG - Intergenic
921338196 1:214108740-214108762 AATAAAGCAGAGAAGGGACCTGG - Intergenic
922151440 1:223008191-223008213 AATTAATCAGAGATGGGGGATGG - Intergenic
922314686 1:224433371-224433393 AATTAAGCTCTGAAGGTGCGTGG + Intronic
922325405 1:224523893-224523915 CATTAAGCTGAGAAGGAGGATGG + Intronic
924240037 1:242031701-242031723 AATTAAGCAGGGATGGGGAAGGG + Intergenic
1063354944 10:5389218-5389240 GAGTCAGGAGAGAAGGTGCATGG + Intergenic
1063646821 10:7893397-7893419 AGTTAAACAGAGAAGAAGCAGGG + Intronic
1064065430 10:12177192-12177214 AAATAAGCTGAGAAGGGGAAGGG + Intronic
1064131839 10:12716608-12716630 AATGGGGCAAAGAAGGTGCAGGG - Intronic
1067022309 10:42812152-42812174 AACTAGGCAGAAAAGGAGCAAGG - Intronic
1069090951 10:64197744-64197766 TATTATGGAGAGAAAGTGCAAGG + Intergenic
1069098113 10:64284966-64284988 AATAAAGGAGGGAAGGTGAAGGG - Intergenic
1070227687 10:74527490-74527512 AATTAAGGAGAGAATGTGGAGGG + Intronic
1070664403 10:78333111-78333133 AATGGAGCAGAGAAGGAGAAGGG + Intergenic
1071511125 10:86263214-86263236 ATTTAAGCAGATAAAATGCAGGG - Intronic
1071964992 10:90843391-90843413 AATTAGGAAGAAAAAGTGCAAGG + Intronic
1072035061 10:91555546-91555568 AATTAAGAAGAAAAAGTGCTTGG - Intergenic
1072059516 10:91796478-91796500 AGGTGAGCAGAGAAGGTGCAGGG - Intergenic
1072368150 10:94735413-94735435 AATGAAGCAGAGCTGGTACAAGG - Exonic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1072985696 10:100138069-100138091 AATAATGCAGAGAAGGGGAACGG - Intergenic
1073051112 10:100668041-100668063 AAGTAAGCTGAGGAGGTGAAGGG - Intergenic
1073984284 10:109190526-109190548 AGTCAAGCAGAGAAGGTAGATGG + Intergenic
1074123455 10:110510147-110510169 CATCAAGCAGAGGAGGAGCATGG + Exonic
1074783773 10:116821029-116821051 AATTTAGAGGAGAAGGTGGAGGG - Intergenic
1074902685 10:117832688-117832710 GATTGAGGAGAGAGGGTGCACGG + Intergenic
1075587767 10:123669774-123669796 AATTAAGAAGAGAGGGTCCCGGG - Intronic
1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG + Intronic
1076823134 10:132951903-132951925 AAGGAAGCAGTGAAGGAGCAGGG - Intergenic
1078792265 11:14556639-14556661 GAGTAAGCAGAGAAAGTGGAGGG - Intronic
1079032965 11:16999248-16999270 AATTAAGCTGAGAAGTGGGAAGG - Intronic
1079509700 11:21196621-21196643 AATAAAGCAGAGAAAGGGGATGG - Intronic
1079608781 11:22404487-22404509 CATTGATCAGAGAAGGTGAAAGG - Intergenic
1080607413 11:33875195-33875217 AATGAAGCAGATCAGGTGCTTGG + Intronic
1082200940 11:49366283-49366305 AATTATGCAGATAAGTAGCAAGG + Intergenic
1082209157 11:49476525-49476547 TATTAAGCAAAGAAGTTACAGGG + Intergenic
1082281095 11:50272115-50272137 GAATAAGCAGATAAGGGGCAGGG + Intergenic
1083857811 11:65401638-65401660 AGTTAAGCTGAGAAGGGGGAGGG - Intronic
1086396211 11:86418014-86418036 AATGAGGCAGAGATTGTGCAGGG - Intronic
1086654732 11:89339937-89339959 AATTATGCAGATAAGTAGCAAGG - Intronic
1086721848 11:90130373-90130395 ACTTCAGAAGAGAATGTGCAGGG + Intergenic
1087629189 11:100630784-100630806 AATTAAATAGGGTAGGTGCAGGG + Intergenic
1088834832 11:113568754-113568776 GATTAAGCAGAGAAGGAACACGG + Intergenic
1088981880 11:114871491-114871513 ACTTCAGCTGAAAAGGTGCAGGG - Intergenic
1090836176 11:130455735-130455757 GAGTCAGCAGACAAGGTGCATGG + Intronic
1091805477 12:3353007-3353029 AATTAGGCAAAGAAGGTGAAGGG + Intergenic
1092858497 12:12697648-12697670 AATTAAGCAGAGAATATGTATGG + Intergenic
1095630285 12:44368229-44368251 AATAAAGCAGAGAAGGGGGATGG - Intronic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1096427189 12:51513981-51514003 AAATAAACAGAGAAGATGCAGGG - Exonic
1096668907 12:53186203-53186225 AATGAAGCAGAGAGATTGCATGG + Intronic
1098299744 12:69042309-69042331 AATAAAGCAGGGAAGGGGCATGG + Intergenic
1098619775 12:72580841-72580863 AATCTAGCAGGGAAGATGCATGG + Intronic
1099385883 12:82012591-82012613 AATTAAGCAGATAATATGGATGG + Intergenic
1099482245 12:83182145-83182167 AATGAAGCAGAGAAGATGTTAGG - Intergenic
1100638393 12:96457884-96457906 AATTAAGGAGAGAAGATAGAGGG + Intergenic
1101525795 12:105528588-105528610 AATTAAGAAGGGAAGCTGCCAGG - Intergenic
1101917213 12:108904879-108904901 AATTAAGAATAGAAGGATCATGG + Intergenic
1102216528 12:111165391-111165413 AGTTAAGCACAGAAGATGCAAGG + Intronic
1102842626 12:116142131-116142153 AATGAAGCAGTGAAGGAGGATGG - Intronic
1105542600 13:21327891-21327913 GATGAAGCAGACAAGGTGAAAGG + Intergenic
1106659315 13:31781965-31781987 AGTTCAGCTGAGAAGGTGCACGG - Intronic
1107007247 13:35627335-35627357 AAATAAGTAGTGATGGTGCATGG - Intronic
1107323226 13:39211485-39211507 AGCTAACCACAGAAGGTGCAGGG - Intergenic
1108596335 13:51953153-51953175 AATTAAGCAGAGAATATTCTTGG - Intronic
1110195823 13:72787486-72787508 AAGAAAGCAAAGAAGGTTCATGG + Intronic
1110264784 13:73525002-73525024 AATTAAGGAGAGAAAGTCCCAGG - Intergenic
1110419617 13:75291282-75291304 AACTAGGCAGAGAAGGATCAGGG - Intronic
1110654725 13:77984405-77984427 AATACAGCAGTGAAAGTGCAAGG + Intergenic
1110697513 13:78508720-78508742 AATTAAGAAGAGAAGGGAGATGG + Intergenic
1112383445 13:98915670-98915692 AGTGAAGCAGGGAAGGTGGACGG - Intronic
1112753375 13:102604335-102604357 AATTAAGCAGGGAAGGGAGATGG - Intronic
1113002208 13:105654171-105654193 AATGAAGGAGAGAAGGAACATGG - Intergenic
1113421101 13:110172029-110172051 ACTTCAGCTGAGAAGGAGCAGGG - Intronic
1113554813 13:111224258-111224280 AGTTAAGGAGAGAAGCAGCAAGG + Intronic
1116533675 14:46005168-46005190 AGTAAAGCAAAGAAGATGCAGGG - Intergenic
1117473726 14:56072805-56072827 AATTGGGCAGAGAAGATACATGG - Intergenic
1119602239 14:75983968-75983990 AATCAAGCAGGGAAGGAGGATGG + Intronic
1123423425 15:20149045-20149067 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1123532646 15:21155566-21155588 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1124689617 15:31811091-31811113 AGGCATGCAGAGAAGGTGCACGG + Intronic
1124697893 15:31881497-31881519 AATTAACCAGAGATGGTGGCAGG + Intergenic
1125236944 15:37525514-37525536 AATTCAGCTGAGAGGGTGCTGGG + Intergenic
1126048696 15:44668114-44668136 AGAAAAGCAGAGCAGGTGCATGG + Intronic
1128636024 15:69302930-69302952 AATGAAGCAAAGAAGAAGCAGGG - Intronic
1129267706 15:74402926-74402948 CATTAGGCAGAGCAGGTGCAAGG - Intergenic
1129313426 15:74727243-74727265 AATTAAACAGAAAAGGCGTACGG + Intergenic
1129673102 15:77617837-77617859 GATTAAGCAGAGAGGATTCAGGG + Intronic
1129684049 15:77674754-77674776 AATCAAGCAGAGGAGGGGGATGG - Intronic
1129819884 15:78592328-78592350 AAATAAGCAGAGAAGTAACAGGG + Intronic
1130719504 15:86372789-86372811 AATTAAGAAGACAAGGGGTAGGG + Intronic
1130868378 15:87951279-87951301 AAATAAGCAGAGATGGTCCTAGG - Intronic
1131364321 15:91825331-91825353 AATTAACTAGAGTTGGTGCAGGG - Intergenic
1131642458 15:94307252-94307274 AAGAAAGCAGAGTAGGTGCTGGG + Intronic
1131955487 15:97730898-97730920 AATAAAGCAGGGAAATTGCATGG + Intergenic
1132025807 15:98403640-98403662 AATTGAGCAGGGAAGGGGCCCGG + Intergenic
1132207353 15:99995283-99995305 ACTTAGGCAGAAATGGTGCATGG - Intronic
1132459157 16:41732-41754 AAGTAAGCAGACAAGGACCAAGG + Intergenic
1133364353 16:5198845-5198867 AATAAAACAGAGAAGGTCCTGGG + Intergenic
1134092112 16:11397005-11397027 AATGAAGCAGAGAGGGGCCAGGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135881308 16:26260259-26260281 TATAAAGCAAAGAAGGTCCATGG - Intergenic
1136484321 16:30561552-30561574 AATGAACCAGGGAAGGTGGAAGG - Intergenic
1136861396 16:33706561-33706583 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1138153284 16:54679091-54679113 AATGTAGCAGGAAAGGTGCAAGG + Intergenic
1138435109 16:56994218-56994240 AAGGAAGGAGAGAAGGTGGAGGG + Intronic
1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG + Intergenic
1140663140 16:77207098-77207120 AATTAGGGAGAGAAATTGCAGGG + Intronic
1140752179 16:78034753-78034775 AATTAATCAGAGATGGTGTCTGG - Intronic
1140935030 16:79662438-79662460 AATTCAGCAGAGAAGTAGCATGG - Intergenic
1140949614 16:79804052-79804074 TATAAAGCAGAGAATGTACAAGG - Intergenic
1203122895 16_KI270728v1_random:1554752-1554774 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1144283772 17:13752456-13752478 AATAAGGCAGACAAGGTGTAGGG + Intergenic
1145043725 17:19595956-19595978 GTTTAAGCAGAGAAGGTGCCAGG - Intergenic
1148198178 17:45729807-45729829 AATTCAGCAGGGAGGGTCCAAGG - Intergenic
1150506866 17:65707807-65707829 AATTAAAGAGACAATGTGCAAGG + Intronic
1151362893 17:73599234-73599256 AAGAAAGGAGAGAAGGTGCTGGG + Intronic
1152830130 17:82491981-82492003 AATCAAGGAGAGCAGGTGCCAGG + Intergenic
1153936823 18:9934162-9934184 AATTAACCAGAGAAGGTTGTTGG - Intronic
1155182368 18:23358890-23358912 TCCTAAGCAGAGAGGGTGCACGG + Intronic
1155350480 18:24901067-24901089 AAGTAACCAGAGAAGTTGGAAGG - Intergenic
1157152112 18:45228599-45228621 AACTAAGAAGAGAAGGGGGAAGG - Intronic
1157292690 18:46421222-46421244 ACTAAAGCAGATAAAGTGCAAGG - Intronic
1157996886 18:52568756-52568778 AATTCAGCAGTGAACGTGCAAGG + Intronic
1158337904 18:56433745-56433767 AATGCAACAGGGAAGGTGCAGGG + Intergenic
1158744723 18:60187193-60187215 AATAAAGCAGACAAGGGGAATGG - Intergenic
1159373824 18:67565410-67565432 AATTAACCAGAGAAAGAGGAAGG + Intergenic
1159732823 18:72053111-72053133 AATGAAGCATAGAATGAGCAGGG + Intergenic
1161092401 19:2368335-2368357 AAAAAAGCAGAGAATGTGAAGGG + Intergenic
1161224021 19:3134076-3134098 AATTAAGCAGAGATGTTGTTGGG - Intergenic
1165372731 19:35419828-35419850 AATGAATCAGAGAAGATTCAAGG + Intergenic
1165489912 19:36117133-36117155 AATAAAGCAAAGAAGGGGAAAGG - Intronic
1165670937 19:37678454-37678476 AATTAGGAGGAGAGGGTGCATGG + Intronic
1167762856 19:51460334-51460356 AATTGAGAAGGGAAGGTGCAGGG + Intergenic
927378161 2:22443126-22443148 TTTTAAGCAGAGAAGTTACATGG + Intergenic
930160854 2:48155267-48155289 AATTCATCAGGGAAGTTGCAGGG + Intergenic
931079775 2:58755567-58755589 AATTTAGCAGAGAAGTTATAAGG + Intergenic
931614178 2:64138804-64138826 AATAAAGCAGGGAAGGGGAAGGG - Intronic
932823040 2:74917414-74917436 ATGTAAGCAGAAGAGGTGCACGG + Intergenic
933953115 2:87348041-87348063 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934237346 2:90244386-90244408 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934459771 2:94207680-94207702 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934691280 2:96361639-96361661 AAGTAAGCAGAGGATGTGAATGG - Intronic
935277595 2:101488441-101488463 AATGAAGCATAGAATGTGAAAGG - Intergenic
935898055 2:107759199-107759221 AAGGGATCAGAGAAGGTGCATGG + Intergenic
935998201 2:108797149-108797171 AATTAAGCAGAAAGGGTATAAGG + Intronic
938133854 2:128737754-128737776 ATTTCTGCAGAGAAAGTGCAGGG - Intergenic
939302443 2:140362215-140362237 TTTTAAGCAGAGGAGGTCCATGG - Intronic
939658190 2:144853435-144853457 AATTAATCACAGAAAATGCAGGG + Intergenic
940372955 2:152922935-152922957 AAAGAAGAAGAGAAGGGGCAGGG - Intergenic
941731809 2:168926119-168926141 AAGTAAGTAGAGAAGGTTAAAGG + Intronic
942077861 2:172373473-172373495 CATGAAGAAAAGAAGGTGCAAGG - Intergenic
944433709 2:199664245-199664267 AATTAAGAAGAAAAAGTGCTTGG - Intergenic
945036850 2:205711254-205711276 AATTCAGCAGTGAAGAGGCAAGG + Intronic
945531267 2:210956107-210956129 ACTTAGGCAGAGAAAGTGCAAGG + Intergenic
945862921 2:215144401-215144423 AAAGAAGCAGAGAATGTGGAGGG + Intergenic
946218477 2:218205161-218205183 AATTAAGCAAAGTTGGTGCAAGG - Intergenic
1168737926 20:159892-159914 AATTCAGCAGAGTATGTACATGG - Intergenic
1169151064 20:3289805-3289827 AATAAAGCAGAGAAGGGGCCAGG - Intronic
1169347633 20:4841124-4841146 AAAACAGCAGAGCAGGTGCAGGG - Intergenic
1169468870 20:5865701-5865723 AATTAAGCAGTGAGTTTGCAGGG - Intergenic
1170131347 20:13023208-13023230 AATTAAGCAGGAAAGGGGCCAGG - Intronic
1170339731 20:15310753-15310775 AGTCAAGCAGAGAAGGGGCTTGG + Intronic
1170656600 20:18292612-18292634 AATAAAGCAGGGAAGGAGAAAGG - Intronic
1173801777 20:45898671-45898693 CTTTAAGCAGAGAAGGGGCCAGG - Exonic
1174872949 20:54200545-54200567 AATAAAGCAGACAAGGTGCTTGG - Intergenic
1176937800 21:14886764-14886786 AAATAAGCTTAGAAGGTGCCTGG - Intergenic
1177126392 21:17198544-17198566 AATAAAACAGAGAAGCTGTAAGG - Intergenic
1178050674 21:28743566-28743588 AAGGAAGGAGAGAAGGTGAAGGG + Intergenic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1179533245 21:42034335-42034357 AAAAAAGCAGAGAAGGGGCCGGG - Intergenic
1179535192 21:42046891-42046913 AATTAACCAGACATGGTGGAGGG - Intergenic
1181356428 22:22298776-22298798 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1181382881 22:22520886-22520908 AATTCAGCTGAGAAGGTTCCAGG - Intergenic
1182251565 22:29004915-29004937 AATGAAGCCGAGCAGGTTCACGG - Intronic
1184022140 22:41827916-41827938 GACTTAGCAGAGAAGGTGCTTGG + Intergenic
950659814 3:14460349-14460371 AGTCAAGCAGAGAAGGAGAATGG + Intronic
950703354 3:14765666-14765688 AGGTGAGCAGAGCAGGTGCAGGG + Intronic
951156878 3:19365786-19365808 AATAAAGCAAAGAAGGGGGAAGG + Intronic
952167100 3:30762238-30762260 AATTATGTTGAGAAGGTTCATGG + Intronic
953280143 3:41547353-41547375 AATTCAGCAGGGAAGGGACAGGG + Intronic
953719115 3:45339936-45339958 AATTAAGGCATGAAGGTGCAGGG + Intergenic
953724472 3:45385833-45385855 AATGAAGCAGACAAGTTGCTAGG - Intergenic
954111701 3:48437184-48437206 AATAAAGCAGAGAAGGTAGCTGG - Intronic
955518061 3:59747759-59747781 TATCAAGAAGACAAGGTGCATGG - Intergenic
956793375 3:72697404-72697426 AATTGAGCAAGGAATGTGCAGGG - Intergenic
956928232 3:74012726-74012748 AATTTAGCAGGGAAGATGGAGGG + Intergenic
957481739 3:80806712-80806734 AATGAAGGAGGGAAGGAGCAGGG - Intergenic
957536222 3:81507266-81507288 AATTAAACAGAGAACTTGCCCGG + Intronic
957637112 3:82800594-82800616 ACTAAAGCATAGAAGGTTCAAGG + Intergenic
958506036 3:94978227-94978249 AACTTAGCAAAGAAGGTGAAAGG - Intergenic
958568704 3:95851417-95851439 AATTAAGCAGACAATGGGAAAGG - Intergenic
960449488 3:117788942-117788964 AAGACAGCAGAGAAGGTGAAAGG - Intergenic
960899103 3:122536536-122536558 AATTTATTAGAGAAGGGGCAGGG - Intronic
960923143 3:122768608-122768630 AAAAAGGCAGAGAAGGTGCCAGG + Intronic
961534413 3:127560946-127560968 AAACAAGCAGAGAAGGGGAAGGG - Intergenic
963119671 3:141765395-141765417 AATCAAGCAGGGAAGGAGAAGGG - Intergenic
963131112 3:141858810-141858832 AATAAACCAGAGAAGGTAGAAGG + Intergenic
964619265 3:158704473-158704495 AATTAAGTAGCCAAGGTGGAAGG - Intronic
964975921 3:162620487-162620509 AATTCAGCAGTGAAGGTATAAGG + Intergenic
966038767 3:175454374-175454396 CATTAAGCAGAGCAGGGGCATGG - Intronic
966279029 3:178208329-178208351 AGAAAAGCAGAGAAGGGGCAGGG - Intergenic
966651069 3:182301683-182301705 AATTATCCAGAGATGTTGCAAGG - Intergenic
967648332 3:191953868-191953890 AATAAATCAGAGAAGATGCTAGG - Intergenic
970937873 4:21595916-21595938 AATTAAACAGAGCAGCTTCAGGG + Intronic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
973339866 4:48993174-48993196 AGATAGGCTGAGAAGGTGCAGGG - Intronic
973959157 4:56092232-56092254 ACTCAAGGAAAGAAGGTGCATGG + Intergenic
973992575 4:56424929-56424951 AAATAAGCATAGAAGTTTCATGG + Intronic
974378757 4:61110541-61110563 AAATAAGCAGAGAAGTTCTAAGG - Intergenic
975382046 4:73711903-73711925 AATAATGCAGAGAAGGTGAAAGG + Intergenic
976543734 4:86308795-86308817 AATTTAGCAGAAAAGGTAGATGG - Intronic
977136291 4:93309015-93309037 AATAAAGCAGAGAAGGGGAGAGG - Intronic
977295857 4:95208307-95208329 AATGAAGCAGTGAAGCTCCAAGG + Intronic
977634916 4:99286292-99286314 AATGAAGCAGACTAGGTGAAAGG - Intronic
979104362 4:116665254-116665276 AATTATGCAGGTCAGGTGCAAGG + Intergenic
979476948 4:121169424-121169446 AATAAAGCAGGAAAGGTGAATGG - Intronic
979663698 4:123287778-123287800 AATAAAGCAGGGAAGGAGAATGG + Intronic
980972712 4:139581798-139581820 AAATGAGCAGAGAAGTAGCAGGG - Intronic
981206914 4:142053112-142053134 TATTAGGCAGAGAAGGGGAAAGG + Intronic
983451603 4:167918579-167918601 AATTAATCAGAGAAGAAGGAAGG - Intergenic
984399933 4:179249650-179249672 AATAAAGCAGAGAAGGGGATGGG + Intergenic
984553495 4:181186974-181186996 AATTCAACAGAGAAGATGAAAGG + Intergenic
985539205 5:480032-480054 AATTCAGGAGAGAAGGGGCCGGG - Intronic
987181276 5:15371186-15371208 AATCAAGCAGACAAAATGCAAGG + Intergenic
987416601 5:17669179-17669201 ACTAAAACACAGAAGGTGCAGGG + Intergenic
987739387 5:21885841-21885863 AGTGAAGGAAAGAAGGTGCATGG - Intronic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989736779 5:44717019-44717041 AAATAAGCAGAGAAGTTCAAAGG - Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990992359 5:61698533-61698555 ATTTGAGCAGAGAATGTGCTAGG - Intronic
992813464 5:80412728-80412750 AATTAAGCACAGAAACTGAAAGG - Intronic
993516792 5:88846533-88846555 AATTAAGCAGTAAAGTTCCAAGG + Intronic
993754007 5:91704760-91704782 AATTAATCAGAGAAGAGGCAGGG + Intergenic
993777425 5:92017115-92017137 AATGAAGCAGAGCAGGAGCATGG + Intergenic
995945134 5:117635851-117635873 AATTCAGAAGAGATGCTGCAAGG - Intergenic
996185246 5:120465526-120465548 AAAGAAGCAGAGAAGGTGTCAGG + Intronic
996339280 5:122418149-122418171 AATTTAGCAGTGGAGCTGCAGGG + Intronic
1000601101 5:163275453-163275475 AAATAAGAAGAGAAAGTACATGG + Intergenic
1001362015 5:171096084-171096106 GAGTAAGCCGAGAAGGTGGAAGG + Intronic
1003828250 6:9975974-9975996 GATTAAGCAAATAAGGTGGAAGG - Intronic
1004070298 6:12291554-12291576 AATTGGGCAGATAAGCTGCATGG + Intronic
1005444710 6:25910378-25910400 AATCAATCAGAGAAGCTGCTGGG + Intergenic
1006493641 6:34405470-34405492 AATTAATCAGAGAAGAAGGAGGG + Intronic
1006519641 6:34563812-34563834 AATGAAGCAGGAAAGGAGCATGG + Intergenic
1006972656 6:38062665-38062687 AATTAAGCAGACAATGGGCTGGG - Intronic
1008371876 6:50741696-50741718 AATTAAAAAAAAAAGGTGCATGG + Intronic
1009766158 6:68078766-68078788 ATTTAAGCAGAGAATGGACAGGG - Intergenic
1010552712 6:77242867-77242889 AATTAAGGAAAGAAGGGACAGGG + Intergenic
1010886391 6:81247842-81247864 AATTTAGCAAAAAATGTGCAAGG + Intergenic
1015276415 6:131387245-131387267 AATTGATCAGAGCAAGTGCAGGG - Intergenic
1015603075 6:134929456-134929478 AATTAAGCAGAGGATGGGAATGG + Intronic
1016911278 6:149201521-149201543 AGCTAAGCAGAGAAGCTCCAGGG - Intergenic
1017915368 6:158827410-158827432 AGATTAGCAGAGAGGGTGCAGGG + Intergenic
1018394650 6:163368908-163368930 AAACAAGCAGAGAAGGCCCAGGG - Intergenic
1018455075 6:163944366-163944388 AACCCAGCAGAGAAGGGGCATGG - Intergenic
1020890427 7:13871075-13871097 AATTAATCATAGAATGTGCTGGG - Intergenic
1020908793 7:14101931-14101953 AAAGGAGCAGAGAAGGTGCTGGG - Intergenic
1022029929 7:26483270-26483292 AAGAAAGATGAGAAGGTGCAGGG + Intergenic
1022185065 7:27959360-27959382 AAGTAATCAGAGAAGTTTCATGG - Intronic
1023183280 7:37508054-37508076 AATTAAACAGAGATAGTGCAAGG + Intergenic
1027613172 7:80388414-80388436 AGTTAACTAGAGAAGGTGTAAGG - Intronic
1028390830 7:90314667-90314689 AAATTTGCAGAGAAGTTGCAAGG - Intergenic
1028433828 7:90778688-90778710 AATAAAGAAGAGAAGGAGGAAGG - Intronic
1028839796 7:95416196-95416218 AATTCAGCAGAGGAGATACAAGG - Intronic
1029573191 7:101385026-101385048 AAGCAGGCAGAGAAGGTGAAAGG - Intronic
1029919994 7:104252760-104252782 AACTTAGCAGAGAAGGTCAAGGG - Intergenic
1030872996 7:114780755-114780777 AGATAATCAGAGAAGGAGCAGGG - Intergenic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1031677266 7:124625676-124625698 AATTTAGCCAAGAAGGTGAAAGG + Intergenic
1033006705 7:137572941-137572963 ACTTAAGCAGAGATAGGGCAAGG - Intronic
1033946014 7:146718497-146718519 AATTAAACAGAAAAGGTTTAAGG - Intronic
1034910549 7:154994521-154994543 TTTTATGCAGAGATGGTGCAAGG + Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1035714823 8:1745942-1745964 AAATGAGAAGAGAAAGTGCATGG - Intergenic
1037997066 8:23360511-23360533 ATTTAAGCCCAGAAGTTGCATGG + Intronic
1038402748 8:27297916-27297938 TTTTAAGCAGAGGAGGGGCACGG + Intronic
1038411278 8:27361637-27361659 AATTTTACAGAGAAGGTGCCTGG - Intronic
1038627322 8:29206818-29206840 AATAAAGCAGGGAAGGTGGATGG + Intronic
1040673144 8:49716394-49716416 AGTTAAGCAGTGAATGTGTATGG - Intergenic
1041947644 8:63464182-63464204 AATAAAGCACAGAAGGTGCCTGG - Intergenic
1042654222 8:71077952-71077974 AGTTAGGAAGAGAAGGAGCAAGG + Intergenic
1043019050 8:74977859-74977881 AATTAATCAGATAATTTGCAGGG - Intergenic
1043359265 8:79451916-79451938 ACTGAAGCAGGGAAGGAGCAGGG + Intergenic
1043457084 8:80423287-80423309 ATTTAAGGGGAGAAGGTGGAGGG - Intergenic
1043681549 8:83033068-83033090 ACTTTAGCAGAGAAGGTATACGG - Intergenic
1044463156 8:92470988-92471010 CATTAAGCAGTGAAAGTACAGGG + Intergenic
1045180252 8:99773274-99773296 GATTAAGCAGAGAATGACCAAGG - Intronic
1045483480 8:102611622-102611644 AATTAAATAGAAAAGGTGCTGGG - Intergenic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1046770679 8:118113313-118113335 AATAAAGCAGGGAAGGGGCATGG + Intergenic
1049099619 8:140569541-140569563 AACTGAGCAGAGAAGCTCCAGGG + Intronic
1049437005 8:142591150-142591172 CAGGAAGCAGAGAAGGTGAAGGG + Intergenic
1050623343 9:7477630-7477652 CATTAAGCAGAGTAATTGCAGGG + Intergenic
1052108377 9:24547760-24547782 AATTTGGCAGAGAAGTGGCAAGG + Intergenic
1052600891 9:30629283-30629305 AATTAATCAGAGAGGAGGCAGGG + Intergenic
1052904210 9:33818606-33818628 AGGTAAGCAGAGAATGTGAACGG - Intronic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1053099202 9:35355595-35355617 TATTAAGAATAGAAAGTGCAAGG - Intronic
1053690274 9:40583493-40583515 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1054301525 9:63384454-63384476 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1055483852 9:76737175-76737197 AATAAGGAAGAGAAGGTACAAGG - Intronic
1055702129 9:78956471-78956493 AAAAAAGCAGATAAGGAGCAGGG + Intergenic
1057516452 9:95725920-95725942 AAAAAAGAAGAGAAGGTACAAGG - Intergenic
1057750940 9:97792512-97792534 AATCAAGCAGCAAATGTGCAGGG + Intergenic
1059275660 9:113094780-113094802 AATTAAACAAGGATGGTGCAGGG + Intergenic
1059502581 9:114767597-114767619 AGTTAACCAGAGAAGGTTGAGGG + Intergenic
1059547615 9:115194083-115194105 AAGAAAGCAGAGAAGTTTCAGGG + Intronic
1059573172 9:115462372-115462394 AATAAAGCAGAGAAGAAGAAAGG + Intergenic
1059756626 9:117299763-117299785 AATTAAGATGACAAGGTGGATGG + Intronic
1059761751 9:117344399-117344421 AATGAAGCAGGGGAGGGGCAGGG - Intronic
1060279267 9:122205065-122205087 AATCAGGCACAGAAGGTGCAGGG - Intronic
1062659312 9:137620125-137620147 AAGTAAACTGGGAAGGTGCAGGG + Intronic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1188562383 X:31483660-31483682 AATTAAGAAAAGAAAGTGGATGG + Intronic
1188598924 X:31936868-31936890 AATTCAGAAGAGATGGTGCTGGG - Intronic
1189739801 X:44106100-44106122 AATTAAGCAGGGAAGGGGGGTGG + Intergenic
1190828649 X:54041691-54041713 AATTAAGCAGAATAGATGCTGGG - Intronic
1192886475 X:75340061-75340083 AATTTAACAAAGGAGGTGCAAGG - Intergenic
1194599652 X:95904465-95904487 AGTTAAAAAGAGAAGTTGCAAGG + Intergenic
1195694243 X:107655125-107655147 AGTGAGGCAGAGAAGGAGCACGG + Intergenic
1196337053 X:114549824-114549846 AATTAACCAGGGATGGTGGAGGG - Intergenic
1199169490 X:144719095-144719117 AATTATGCAGATGAGATGCAAGG + Intergenic
1202048915 Y:20760916-20760938 ATTTAAGCAGACAAGGCTCAAGG - Intronic