ID: 1179129340

View in Genome Browser
Species Human (GRCh38)
Location 21:38620720-38620742
Sequence TGGAGAGAAAGCCTGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179129340_1179129351 28 Left 1179129340 21:38620720-38620742 CCCAAGGACAGGCTTTCTCTCCA 0: 1
1: 0
2: 2
3: 26
4: 255
Right 1179129351 21:38620771-38620793 AAGTGTGGTGGGGAGCAGAGTGG 0: 1
1: 0
2: 2
3: 60
4: 730
1179129340_1179129349 18 Left 1179129340 21:38620720-38620742 CCCAAGGACAGGCTTTCTCTCCA 0: 1
1: 0
2: 2
3: 26
4: 255
Right 1179129349 21:38620761-38620783 CCCAGTACACAAGTGTGGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 99
1179129340_1179129347 17 Left 1179129340 21:38620720-38620742 CCCAAGGACAGGCTTTCTCTCCA 0: 1
1: 0
2: 2
3: 26
4: 255
Right 1179129347 21:38620760-38620782 TCCCAGTACACAAGTGTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1179129340_1179129345 13 Left 1179129340 21:38620720-38620742 CCCAAGGACAGGCTTTCTCTCCA 0: 1
1: 0
2: 2
3: 26
4: 255
Right 1179129345 21:38620756-38620778 AGTTTCCCAGTACACAAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 147
1179129340_1179129346 16 Left 1179129340 21:38620720-38620742 CCCAAGGACAGGCTTTCTCTCCA 0: 1
1: 0
2: 2
3: 26
4: 255
Right 1179129346 21:38620759-38620781 TTCCCAGTACACAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179129340 Original CRISPR TGGAGAGAAAGCCTGTCCTT GGG (reversed) Intronic
903888779 1:26556258-26556280 TGGAGTAACAGCCTGTCCTATGG + Intronic
903963986 1:27074649-27074671 TGGAGAGAAATACTGCCCTCGGG + Intergenic
904215552 1:28915514-28915536 TCAAGAGAATGCCTGTTCTTGGG - Intronic
905133291 1:35777913-35777935 TGGAGAGAAAGGCTGAGCCTGGG - Intergenic
906263801 1:44412938-44412960 CGGAGAGAAAGGCTGTGCTGGGG - Intronic
907008742 1:50942851-50942873 GGGAGAGGAACCCTGTGCTTAGG + Intronic
907187940 1:52625413-52625435 AAGAGAGTCAGCCTGTCCTTTGG - Intergenic
907474608 1:54697466-54697488 GGGAGAGCAAACCTGGCCTTGGG + Intronic
909794473 1:79716279-79716301 TTGAGAGAGAGGCTGTCTTTTGG + Intergenic
910602942 1:89050820-89050842 TGGTGTGAGAGCCTGTCCTCAGG - Intergenic
910637778 1:89428430-89428452 TGGTGTGAGAGCCTGTCCTCAGG + Intergenic
912120571 1:106467283-106467305 TGCAGAAAGAGACTGTCCTTTGG - Intergenic
912125560 1:106533069-106533091 AGGAGACAAAGACTGTCTTTGGG - Intergenic
914861791 1:151392302-151392324 TAGACAGAATGCCTCTCCTTGGG + Intergenic
917196566 1:172472463-172472485 TGGAGAGAAATGCTGTATTTAGG + Intergenic
917477974 1:175385235-175385257 GTGCCAGAAAGCCTGTCCTTTGG + Intronic
918031921 1:180822843-180822865 GGTAGAGAAAGCCTTTGCTTTGG - Intronic
919064140 1:192671467-192671489 AGGACAGAAAGCCTGTATTTAGG - Intergenic
920016049 1:202909742-202909764 TTGAGAGAAACCTTGACCTTTGG - Intronic
921129427 1:212207200-212207222 TGGAGAAAACGCCTTTCCTCTGG - Intergenic
921648086 1:217643438-217643460 TGGACAGAAGGCCTGGCTTTGGG - Intronic
923070314 1:230558451-230558473 TTTCTAGAAAGCCTGTCCTTTGG + Intergenic
923181888 1:231528079-231528101 TGAAGATCAAGCCTGCCCTTCGG - Intergenic
923251773 1:232184799-232184821 TTGAGAGAAAGCATGTGCATGGG - Intergenic
924100264 1:240595659-240595681 TGGACAGAAAGCCTGGGCTTTGG + Intronic
924854323 1:247860687-247860709 TGGGGAAAAAGACTGTCATTTGG + Exonic
1063172375 10:3520518-3520540 TGGCGAGAGAGCCTGAGCTTTGG + Intergenic
1063447366 10:6127759-6127781 TGGAGAGAAGGCCTTTGCTATGG + Intergenic
1063601150 10:7482625-7482647 AGGACAAAAAGCCTGTTCTTTGG + Intergenic
1065020998 10:21501336-21501358 TGGAGAGAAGGAATCTCCTTGGG - Intergenic
1071431603 10:85611331-85611353 TGCAGGGAGAGCTTGTCCTTTGG - Intronic
1071495483 10:86164893-86164915 TGGTGATAAAGCATGTCCTTGGG + Intronic
1071574376 10:86715123-86715145 TGGAGAGGAAGGTTTTCCTTAGG - Intronic
1074445549 10:113518519-113518541 TGCAGAGAGAGCGTGTGCTTGGG + Intergenic
1074828339 10:117230827-117230849 GGGAGAGAAAGCCAGTCATTAGG - Intergenic
1075179359 10:120196197-120196219 GGCAGAGAAGGCCTGTCCTTAGG + Intergenic
1075332371 10:121583038-121583060 TGGCCAGAAAGGGTGTCCTTAGG - Intronic
1078117668 11:8470071-8470093 AGGAGAGTCAGTCTGTCCTTTGG + Intronic
1078444913 11:11396843-11396865 TGGAATGAAAGCCTTTCCTTTGG - Intronic
1078707325 11:13757355-13757377 AGGAGAGAAAGTCTTCCCTTAGG + Intergenic
1078766720 11:14305482-14305504 TAGAGGGAAAGCTTGTCTTTGGG + Intronic
1079314356 11:19395264-19395286 GGGAGAGAAAGCCCCTCATTGGG + Intronic
1079357787 11:19744243-19744265 TGGAGTGAAGGCCTATCCTAGGG + Intronic
1080815575 11:35753268-35753290 GGAAGAGAAAGCCTGTATTTGGG + Intronic
1080864949 11:36185585-36185607 TGGGGAGATAGCCTGTACCTGGG + Intronic
1082612950 11:55324388-55324410 TGGAGAGAAAGCATAGCATTTGG - Intergenic
1083089401 11:60184541-60184563 TGGAGAGGGAGCCTTTGCTTAGG - Exonic
1084726676 11:70946549-70946571 TGGAGAGGAAGGCTGACCCTGGG - Intronic
1087295517 11:96368509-96368531 AAGAGAGTCAGCCTGTCCTTTGG + Intronic
1087935255 11:104026246-104026268 TGGAAAGAAAGCCTGACCCTTGG + Intronic
1088597074 11:111448689-111448711 TGGAAACGCAGCCTGTCCTTGGG - Intronic
1089070818 11:115698222-115698244 AGGAGAGAAAGCATGCACTTCGG - Intergenic
1090485127 11:127106239-127106261 TGGAGAGAATGCCTTACCTAGGG - Intergenic
1090528323 11:127561758-127561780 TGTAATGAAAGCCTGTTCTTTGG - Intergenic
1090930431 11:131293092-131293114 GGCAGAGAAAGACTGGCCTTTGG + Intergenic
1091037985 11:132251116-132251138 TGGAGAGAATGTTTGTCTTTTGG + Intronic
1092280897 12:7096974-7096996 CTGAGAGAAACACTGTCCTTGGG + Exonic
1092406265 12:8223950-8223972 TGCAGAGACACCATGTCCTTAGG + Intronic
1092497507 12:9011790-9011812 TGGAGAGAGAGTCTGTGCTTTGG + Intergenic
1093221410 12:16424896-16424918 TGAAGAAAAAGCCTGACTTTTGG - Intronic
1096529249 12:52233077-52233099 TGGACTGAAAGCCTGGGCTTCGG + Intronic
1097466164 12:59927886-59927908 GGGAGAGAAACTCTGTGCTTGGG + Intergenic
1100025365 12:90121881-90121903 GGCTGAGAAAGCCTGTCCTTAGG + Intergenic
1100169281 12:91955380-91955402 AATAGAGTAAGCCTGTCCTTTGG - Intergenic
1100980291 12:100157799-100157821 TGGAGAGCAGGCCTTGCCTTGGG + Intergenic
1102043632 12:109816272-109816294 GGGAGAGACAGCCTGGCCTTTGG + Intronic
1102564459 12:113786344-113786366 TGGCGAGAAAGAGTGTCCTCTGG - Intergenic
1104404664 12:128507468-128507490 TCGGGAGAAATCCTGTCCTTTGG - Intronic
1107379006 13:39835599-39835621 AGGAGAGTATGCCTGTCCTGTGG - Intergenic
1107396257 13:40021109-40021131 TGGAGAGGAACCCTGAGCTTAGG - Intergenic
1109366382 13:61362194-61362216 AGGAAAGAAAGCCTGACCTTAGG + Intergenic
1110533457 13:76623625-76623647 AGTAGAGAAAGCCTGTCAGTGGG - Intergenic
1112037578 13:95511542-95511564 AGGAGAGGAAGCTTCTCCTTTGG + Intronic
1112483659 13:99800465-99800487 TGGAGAGAAATCCTGTCCTGAGG + Intronic
1112604175 13:100887926-100887948 GGCAGAGAATGCCTTTCCTTGGG + Intergenic
1114897715 14:27012275-27012297 TGGAAAGAATGACTGTCCTTGGG - Intergenic
1115257578 14:31419853-31419875 AGGAAAGAAAGCTTTTCCTTTGG - Intronic
1117098744 14:52323806-52323828 TGTAGAGACAGCCTGCCCTGAGG + Intronic
1118486144 14:66215960-66215982 TGGGGAGACAGCCTGACTTTGGG + Intergenic
1119071272 14:71587247-71587269 TGGAGCAAAAGTCTGTACTTTGG + Intronic
1120298140 14:82671290-82671312 TGGAAAGGAAGCATGACCTTGGG + Intergenic
1120498970 14:85270204-85270226 TGGAGAGAGAGCCTGTGGCTAGG - Intergenic
1121168291 14:91830817-91830839 AGGAAAAAAATCCTGTCCTTGGG - Intronic
1122341439 14:101031066-101031088 TGGAGAGAAGGCCTGCCCTGAGG + Intergenic
1122938273 14:104969931-104969953 AGGAGAGTAAACCTGGCCTTTGG + Intronic
1124184725 15:27514447-27514469 TGAAGAGAGAGACTGTCCTCTGG - Intronic
1126618646 15:50614326-50614348 TGGAGAGTAGGCCTGTTCCTAGG - Intronic
1128307869 15:66611837-66611859 TGGAGACAAAGCCTTTCCCAGGG - Intronic
1129070452 15:72946274-72946296 GGCAGGGAAAGCCTGTCCTCAGG - Intergenic
1131427779 15:92360926-92360948 GGGAAAGAAAGCCTGCTCTTTGG - Intergenic
1132400546 15:101502223-101502245 TGGCGGGGAAGCCCGTCCTTTGG + Intronic
1132469312 16:93084-93106 TGAAGTGAGAGCCTGGCCTTGGG + Intronic
1132949090 16:2550522-2550544 TGCAGAGAAATCTTGTACTTTGG + Intronic
1132965498 16:2651606-2651628 TGCAGAGAAATCTTGTACTTTGG - Intergenic
1133422446 16:5658084-5658106 TGGAGAGAATGCCTGCTCTGTGG + Intergenic
1134039828 16:11060021-11060043 TGGTGGGCAAGCCTGTCCTGGGG + Intronic
1135117429 16:19735561-19735583 GGGAGGGAAAGCCTGTGTTTGGG + Intronic
1136019756 16:27432524-27432546 TGGAGACAAACCCTGTCCCTTGG + Intronic
1137391232 16:48082912-48082934 TGGAGAGAAAGCTTTTTGTTTGG + Intergenic
1137590416 16:49689997-49690019 TGGAGAGGAAGCCTTTCCTGGGG - Intronic
1137865280 16:51888495-51888517 AGTAGAGAAAGCATGTACTTTGG - Intergenic
1138600333 16:58050110-58050132 TGGAGAGGAAACCTGAGCTTGGG - Intergenic
1139683218 16:68581364-68581386 TGGAGAGAATGCCTGGCATGGGG - Intergenic
1140127385 16:72129450-72129472 GGGAGAGAAAGCTGGTGCTTAGG - Intronic
1140557765 16:75941144-75941166 TGGGGAGAAAGACTGTCCTGTGG + Intergenic
1140766450 16:78163868-78163890 TGGTGAGAAAACTTGTCCTAGGG - Intronic
1140863282 16:79037899-79037921 CGGATGGAAAGCCTGTCCTTTGG - Intronic
1142130561 16:88429903-88429925 TGGGCAGGAAGCCTGTCCTCAGG - Exonic
1142878057 17:2864225-2864247 TGGTTAGGAAGCCTGTCCTCTGG + Intronic
1143317714 17:6045230-6045252 GGGAGAGGAAGCCTGTGCTTGGG + Intronic
1143412004 17:6714572-6714594 TTGGGAGAATGCATGTCCTTGGG - Intergenic
1143956041 17:10670002-10670024 TTGAGATAAAGCCAGTGCTTTGG - Intergenic
1144836494 17:18159124-18159146 TGGGGACAGAGGCTGTCCTTGGG - Intronic
1147844450 17:43395003-43395025 TGGAGAGACAGGTTGCCCTTAGG - Intergenic
1150313034 17:64145228-64145250 AGGACAGAAAGCCTGACTTTGGG - Intergenic
1151147748 17:72057159-72057181 GGGCAAGAAAGCCTGCCCTTTGG + Intergenic
1151523471 17:74647741-74647763 TGGAGAGACAGCCTGAGATTTGG - Intergenic
1155860426 18:30891057-30891079 TGGAGTGAAAGCCCGTCTCTGGG - Intergenic
1156428949 18:37049556-37049578 TGGAGGGTTAGCCTTTCCTTGGG - Intronic
1160258807 18:77271607-77271629 GGGAGAAAAAGTGTGTCCTTGGG - Exonic
1163861013 19:19742864-19742886 GGGAGAGACAGGCTGTCCCTGGG + Intergenic
1164743045 19:30590856-30590878 TGAAGGGAAGGCCAGTCCTTGGG + Intronic
1166165438 19:40984456-40984478 TGGTGAGTATGCCTGTCCTTGGG - Intergenic
1167320303 19:48793599-48793621 TGTAGAGAAAGCCAGGCATTCGG - Intergenic
925104234 2:1276317-1276339 AAGAGAGTCAGCCTGTCCTTTGG - Intronic
925156109 2:1649876-1649898 TGGAGAGAATACCTGTGTTTGGG - Intronic
925546164 2:5019002-5019024 TGAAGAGAAAACCTAACCTTTGG - Intergenic
926219447 2:10925297-10925319 TGGAGAGAAGCCCTGTGCATGGG - Intergenic
926450038 2:12991935-12991957 AAGAGAGTCAGCCTGTCCTTTGG - Intergenic
927514620 2:23664850-23664872 AGGAGATAAAGCATCTCCTTTGG - Intronic
929698547 2:44141383-44141405 TGGGGAGAGAGCCTGTCCTAGGG - Intergenic
929812298 2:45200913-45200935 GGTAGAGAGAGCCTGTCCTCAGG - Intergenic
931935118 2:67188083-67188105 TGGGGACAAAGCCTGAGCTTGGG + Intergenic
934619077 2:95793210-95793232 GGGAGAGACAGCATGTCCTGGGG - Intergenic
934641814 2:96031347-96031369 GGGAGAGACAGCATGTCCTGGGG + Intronic
936281959 2:111149370-111149392 TGGAGAGAAAACATGTTTTTGGG - Intronic
939552053 2:143627485-143627507 TGGAGAGAAAGTATTTCCTCTGG - Intronic
940111373 2:150158242-150158264 TGGAGAGAATGGCTGTCATCTGG + Intergenic
942110356 2:172675867-172675889 AAGAGAGTCAGCCTGTCCTTTGG - Intergenic
942305385 2:174601977-174601999 TGGAGAGAAAGGCTGTGATGCGG + Intronic
943414428 2:187582994-187583016 TGGAGAAAAAGTTTGGCCTTAGG + Intergenic
944110879 2:196130287-196130309 GGCAGAGAAAGCCTGTACATAGG + Intergenic
947362314 2:229359066-229359088 TGGACAGACAGCCTTTCCTGTGG + Intronic
947455284 2:230248516-230248538 TGGAAATAGAGCCTGCCCTTTGG + Intronic
947544344 2:231000646-231000668 GGGAAAGAAAGGCTTTCCTTCGG - Intronic
948070292 2:235115752-235115774 TGGAGAGAATCCATGTCATTTGG - Intergenic
1169313832 20:4571482-4571504 TGGCAAGAAAGCCTTTCCTGAGG + Intergenic
1170543172 20:17409097-17409119 TGGAGCCAAAGCATGTCTTTGGG - Intronic
1172244128 20:33434043-33434065 TGGAAGGATGGCCTGTCCTTTGG - Intronic
1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG + Intronic
1172907664 20:38380953-38380975 TGTAGAGAAGGACTGGCCTTGGG + Intergenic
1173155925 20:40608779-40608801 TAGGGAGAAAGCATCTCCTTAGG - Intergenic
1173324926 20:42024451-42024473 AGGAGAGAAAGCATGGCGTTTGG - Intergenic
1174454280 20:50638557-50638579 TGAAGACAAAGCCTCTCTTTGGG + Intronic
1177627937 21:23688893-23688915 TGCAGAGAAAGAATGTCCTTAGG - Intergenic
1179129340 21:38620720-38620742 TGGAGAGAAAGCCTGTCCTTGGG - Intronic
1179287399 21:39989686-39989708 TGGAGAGATGGGCTCTCCTTAGG - Intergenic
1179822216 21:43943538-43943560 TCAAGAGAAAGCCAGTCCTCAGG + Intronic
1180014331 21:45072956-45072978 TGGAAAACAAGCCTGTCTTTGGG - Intergenic
1181319261 22:21991902-21991924 TTGAGAGAGAGCCAGGCCTTGGG - Intergenic
1183094516 22:35544136-35544158 TGGAGACAAATACTGTCCCTGGG + Intronic
1183220493 22:36509255-36509277 TGGAGAGAAAAAGTGTACTTGGG - Intergenic
950938282 3:16866014-16866036 TGGAAAGATAGCCTGACCTGGGG - Intronic
954927073 3:54245480-54245502 GGGAGAGCAGGCCTGGCCTTAGG - Intronic
955434068 3:58881849-58881871 TGATTAAAAAGCCTGTCCTTGGG + Intronic
956066487 3:65402190-65402212 AGGAGGGAAAGCATGTCATTTGG + Intronic
958850336 3:99317461-99317483 TGGAGAGAAAACGAGTACTTTGG + Intergenic
959018177 3:101159368-101159390 CAGAGAGAAATCCTGTCCTCTGG - Intergenic
960397644 3:117156693-117156715 TGGAGATCAAGCAAGTCCTTGGG + Intergenic
961635143 3:128328605-128328627 TAGAGAGAAAGTCAGTTCTTAGG + Intronic
962864902 3:139440325-139440347 TGGAGGGACAGTCTGTCCTGAGG + Intergenic
964343275 3:155730844-155730866 TGGAGAGATACCCTCTGCTTGGG + Intronic
965325865 3:167302848-167302870 AGGAGAGAAATCCTGATCTTAGG + Intronic
967280342 3:187816348-187816370 TGGATGGAAAGCCTTTCCTCTGG - Intergenic
967356325 3:188575991-188576013 TGGAGAAGAAGCCTGTCATCTGG + Intronic
967450336 3:189615904-189615926 TGTAAAGTAAGCCTGGCCTTGGG + Intergenic
967766618 3:193287367-193287389 AAGAGAGACAGCCTCTCCTTTGG - Intronic
968172300 3:196520261-196520283 GGCAGAGAAAGCCTGTACATAGG - Intergenic
972563195 4:40246677-40246699 TGGAGAGAAAGACAGTAATTGGG + Exonic
973342189 4:49016847-49016869 CGGAGAGAAGGCATGTCTTTGGG - Intronic
973769673 4:54195139-54195161 AGGAGAGAAAGCCTGTCACATGG - Intronic
975644284 4:76530668-76530690 TGGAGACAAAACCTTTCCCTGGG - Intronic
977275029 4:94966942-94966964 TGAAGAGAGAGACGGTCCTTGGG + Intronic
977853997 4:101865513-101865535 TGGAGAGTAGGCCTGTGCTATGG - Intronic
978213852 4:106173435-106173457 TGGACTGAAACCCTTTCCTTTGG - Intronic
979552509 4:122007046-122007068 TGGAGAAAAAGACTTTCCTGGGG + Intergenic
981015652 4:139971320-139971342 TGGAGATAAAGAGAGTCCTTTGG - Intronic
981412372 4:144447908-144447930 AGGAGAGACTGCCTGTTCTTCGG + Intergenic
981816093 4:148832312-148832334 TGCAGAGAAAGCCTGTGTGTAGG + Intergenic
981998634 4:151001840-151001862 GGCTGAGAATGCCTGTCCTTGGG - Intronic
982283186 4:153707174-153707196 TGCAGAACAAGCTTGTCCTTGGG + Intergenic
983911838 4:173248300-173248322 TGGAGAGAAAGCCAAGCCATTGG + Exonic
984220370 4:176967420-176967442 CGGAGAGTCAGCCTTTCCTTTGG - Intergenic
984725901 4:183020406-183020428 TGGAGAGCAAAACTGTCCATAGG + Intergenic
985886144 5:2680793-2680815 TAGAGAGAAAGCCTGGGTTTGGG + Intergenic
985966740 5:3343573-3343595 GGGAGAGAAAGGCTGTCGGTGGG - Intergenic
991457177 5:66816614-66816636 TGGAGAGAATGGCTGCCTTTAGG + Intronic
992577160 5:78126138-78126160 AGGAGAGAAAGTATGTCCGTAGG + Intronic
994709121 5:103244735-103244757 AGGAGAGAAAACCTGGGCTTGGG + Intergenic
994937237 5:106271031-106271053 TGGGGACATAGCCTGGCCTTGGG + Intergenic
996543590 5:124654535-124654557 AGGAGAGAATGGCTGTCTTTTGG - Intronic
998582580 5:143394443-143394465 TGGAGAGCAACCCTTTTCTTTGG - Intronic
999131015 5:149283238-149283260 TGGGGAGAAAGCCTGTCCATTGG + Intronic
999780533 5:154846305-154846327 TTTAGAGAAAACGTGTCCTTTGG - Intronic
999901681 5:156092627-156092649 GGAAGATAAAGCCTTTCCTTTGG - Intronic
1000070143 5:157732896-157732918 TGGAGAGCACGGCTGTCATTGGG - Exonic
1001236504 5:170034341-170034363 TGGGGAGAAAGACTGTGCTGGGG - Intronic
1001438756 5:171721564-171721586 GGAAGACAAAGCCTGGCCTTTGG + Intergenic
1005238225 6:23791125-23791147 TGGAGAAAATGCCTTCCCTTTGG + Intergenic
1005400710 6:25430611-25430633 TGCAGAGAAACCCTGTCTCTAGG - Intronic
1006104742 6:31709942-31709964 TGGAGGGGAAGCCTCTCTTTGGG + Intronic
1006518911 6:34560277-34560299 TGGAGAGAACCCCCATCCTTCGG + Intergenic
1007108822 6:39301360-39301382 TGGAGAGAGAGGCTGTCTTGGGG - Intronic
1008267225 6:49443340-49443362 AGGAGAGGAAGCCTGAGCTTAGG - Intronic
1008288657 6:49685310-49685332 TGCAGAGACAACCTTTCCTTAGG - Intergenic
1009399973 6:63243087-63243109 TAGAGAGATAGCCTCTCCTTTGG - Intergenic
1010153168 6:72760120-72760142 TGAAGACAAAGCCTGTCATCTGG - Intronic
1010333011 6:74646543-74646565 TGTAGAGTAGGCCTGTCCTCAGG - Intergenic
1013327622 6:109063319-109063341 AAGAGAGGAAGCCTGCCCTTGGG + Intronic
1014199709 6:118594959-118594981 AGGAGAGAAAGACTGTCCTGAGG + Intronic
1014508163 6:122284767-122284789 TGGAGTCAAAGCTTCTCCTTAGG + Intergenic
1015141164 6:129933652-129933674 TGGTAAGAAAGCCCCTCCTTTGG + Intergenic
1016826549 6:148393578-148393600 AGGAGAGAAAGTCTGCCCATCGG + Intronic
1018209439 6:161466732-161466754 TTGTCAGAAAGCCTGTCCTTGGG - Intronic
1018448364 6:163879665-163879687 TGGAGAGAAAGGGTGTTCTCTGG + Intergenic
1019289948 7:245504-245526 TGGAGGGAGAGCCTGTCCCAGGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1023610180 7:41964859-41964881 TGCAGAGCAAGGCTGTCCCTCGG + Exonic
1024117206 7:46205733-46205755 TGCAGGGAAGGCCTGCCCTTGGG - Intergenic
1027776794 7:82475309-82475331 TGGAGAGAAATTCTGAGCTTAGG - Intergenic
1030678855 7:112413144-112413166 AGCAGAGAAACACTGTCCTTAGG + Intergenic
1031153776 7:118085281-118085303 TGGAGGGAAATCCTGACTTTAGG - Intergenic
1033348872 7:140545825-140545847 TGGAGAGGAAGCCTCACCGTTGG - Intronic
1035468674 7:159096194-159096216 TGGATAGGAGGCCTGTCTTTGGG - Intronic
1036263467 8:7257764-7257786 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036264770 8:7265386-7265408 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036266069 8:7273008-7273030 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036267372 8:7280630-7280652 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036268674 8:7288252-7288274 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036269976 8:7295874-7295896 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036301830 8:7574123-7574145 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036303127 8:7581772-7581794 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036315509 8:7716303-7716325 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036316817 8:7723951-7723973 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036318124 8:7731599-7731621 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036319433 8:7739247-7739269 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036320740 8:7746894-7746916 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036322050 8:7754542-7754564 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036323359 8:7762190-7762212 TGCAGAGACACCATGTCCTTAGG - Intergenic
1036351378 8:8014470-8014492 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036352684 8:8022116-8022138 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036353976 8:8029764-8029786 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036669238 8:10769656-10769678 TGGAGAGGACGCCTCTCCTCAGG - Intronic
1036698672 8:10996508-10996530 TGCAGAGAAAACCTGTAATTGGG - Intronic
1036846639 8:12174889-12174911 TGCAGAGACACCATGTCCTTAGG + Intergenic
1036868003 8:12417208-12417230 TGCAGAGACACCATGTCCTTAGG + Intergenic
1038888061 8:31687880-31687902 TGCAGAGAACGCCTGACCTAAGG - Intronic
1039834606 8:41246544-41246566 CAGAGAGAAAGCCTCACCTTGGG + Intergenic
1040636329 8:49277936-49277958 AGGAGAGTCAGCCTGTCCTTTGG - Intergenic
1045331784 8:101161668-101161690 GAGAGAGAAACCCTGTCCTATGG - Intergenic
1052989392 9:34510256-34510278 TGGAGAAGAAGCCTGTGCTGTGG - Intronic
1053441521 9:38120343-38120365 TGTAGAGAAAACCTGTCTTCAGG - Intergenic
1057317660 9:93980007-93980029 GGGACAGAAAACCTGCCCTTTGG - Intergenic
1059750953 9:117246850-117246872 TGCAGATACACCCTGTCCTTTGG - Intronic
1059996356 9:119913910-119913932 TTATGAGAAAGCCTGTTCTTCGG + Intergenic
1060749337 9:126158736-126158758 TGGAGAAGTAGCCTGGCCTTAGG - Intergenic
1186295866 X:8147261-8147283 TGGAGAGGAAACCTTTCCTTAGG - Intergenic
1186305191 X:8248911-8248933 TGGAGAGAACTCTTGTCTTTTGG + Intergenic
1188932112 X:36124203-36124225 TGGAGGGAAAGAATCTCCTTTGG + Intronic
1189418350 X:40833944-40833966 AGGAGAGAAACCCTGGACTTAGG + Intergenic
1193793115 X:85840959-85840981 GGGAGAGCTAGCCTGTCCTCAGG - Intergenic
1193969997 X:88039285-88039307 GGAAGGGAAAGCCTGTCCTCAGG - Intergenic
1194540653 X:95167206-95167228 TGGAAAAAAAGCTTCTCCTTAGG - Intergenic
1194733478 X:97483707-97483729 TACAGAGAAAGCCTGTTGTTTGG + Intronic
1195285371 X:103377542-103377564 TGGAGAGGAAGACCGCCCTTTGG + Exonic
1195451715 X:105021390-105021412 TGGAGGGAAAGCCCATTCTTAGG + Intronic
1196256642 X:113527829-113527851 TGGGGAGATAGGCAGTCCTTAGG - Intergenic
1196540320 X:116900067-116900089 TGGAGTCAAAGCATGTCATTTGG - Intergenic
1197358533 X:125467904-125467926 AAGAGAGTCAGCCTGTCCTTTGG + Intergenic
1200823336 Y:7612334-7612356 TGGAGATAATGCTTGTCTTTAGG - Intergenic
1201703412 Y:16908888-16908910 TGTAGAAAAAGTGTGTCCTTTGG + Intergenic
1202236719 Y:22718761-22718783 TGGAGATAATGCTTGTCTTTAGG + Intergenic
1202306448 Y:23477407-23477429 TGGAGATAATGCTTGTCTTTAGG - Intergenic
1202564361 Y:26193182-26193204 TGGAGATAATGCTTGTCTTTAGG + Intergenic