ID: 1179132730

View in Genome Browser
Species Human (GRCh38)
Location 21:38653015-38653037
Sequence CGTGGAATCTAGAATCTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179132730 Original CRISPR CGTGGAATCTAGAATCTAGG CGG (reversed) Intronic
906546420 1:46622463-46622485 TGTGGAATCCAGACTCTACGGGG - Intergenic
910423897 1:87100207-87100229 GGTGGAATCTGCAATCTAGGTGG + Intronic
910627560 1:89324660-89324682 CCTGGAATTTAGAATCCAGTTGG - Intergenic
911310953 1:96291376-96291398 TGTGGCCTCTATAATCTAGGAGG - Intergenic
913047159 1:115084121-115084143 AGTAGAATCTAGAATCCAAGAGG - Intronic
921200299 1:212798822-212798844 CATGGAAGCTAGATTCTAGATGG + Intronic
923226571 1:231943431-231943453 CGTGGACTCTGGAGTATAGGGGG + Intronic
924412195 1:243818354-243818376 CATGGAGTCTAGAGTCTAGTGGG - Intronic
1064232076 10:13537909-13537931 CGTGGAGTTTAAATTCTAGGTGG + Intergenic
1065073089 10:22048200-22048222 CATGGAATCTAACATATAGGAGG + Intergenic
1065690759 10:28331123-28331145 CTTGGGATCTAGCATCTAGCAGG + Intronic
1066291402 10:34017467-34017489 AGTGGAATCCAGGAACTAGGGGG + Intergenic
1068782505 10:60936496-60936518 CATGGAATCTTAAATATAGGAGG - Intronic
1073688837 10:105785306-105785328 CGTGGAATTTTTAATCTAGTTGG + Intergenic
1086540066 11:87898489-87898511 TGTGGAATCCACAGTCTAGGAGG - Intergenic
1087715308 11:101602041-101602063 CTTGGAAGCTAGAAGCAAGGTGG - Intronic
1089623877 11:119739234-119739256 CCAGGAATCAAGAATCTAGCAGG - Intergenic
1092757280 12:11775586-11775608 CGTGGAATTTACAATCTAGAGGG + Intronic
1093150880 12:15619423-15619445 CCTGGAATTTAGAATCTTGAGGG - Intergenic
1093743801 12:22717126-22717148 TGTGAATTATAGAATCTAGGTGG - Intergenic
1094318738 12:29161195-29161217 CTTGGAAGATAGAATCTGGGAGG - Intronic
1100261194 12:92933763-92933785 AATGGAAGCTACAATCTAGGAGG - Intergenic
1101837804 12:108307316-108307338 CTTGGAATCTCGACTCTGGGAGG + Intronic
1105880828 13:24605697-24605719 CGTAGAATACAGAATCTGGGTGG - Intergenic
1106275155 13:28197660-28197682 CATGGTATCTTGAATCTGGGAGG - Intronic
1106779302 13:33041063-33041085 CGTGGAAAATAGGATCTAGGAGG - Intronic
1106812580 13:33374745-33374767 CATGGAAGCTAAAATCTTGGGGG + Intergenic
1108229635 13:48322112-48322134 TGTGGAATCTAAAAAATAGGGGG - Intronic
1111903431 13:94228136-94228158 CATAGAATCTAGAACCAAGGAGG + Intronic
1118712611 14:68534751-68534773 TGTGGAATTTACAATCTAGGGGG - Intronic
1120567831 14:86081409-86081431 CTTGGGGTCTAGAATCTAGAAGG + Intergenic
1126113481 15:45188377-45188399 CTGGGAAACTATAATCTAGGAGG + Intronic
1133748715 16:8707675-8707697 CGTGGAACCTAAAAGCTAGCTGG + Intronic
1138795462 16:59962930-59962952 AGTGGAATCTAGAAACTAACTGG - Intergenic
1145194624 17:20880217-20880239 CATGGAATTTACAATCTAGCAGG - Intronic
1157379922 18:47204624-47204646 TTTGGAATCTGGAATTTAGGTGG + Intergenic
1157502179 18:48199053-48199075 CCTGGAATCTAGAAGCTACTGGG - Intronic
1159030336 18:63224358-63224380 CGTGAAATTTAGAATATAGGGGG + Intronic
929088811 2:38194626-38194648 CATGGAAACTAGAATCTTCGAGG - Intergenic
930681372 2:54260075-54260097 GGTGGAATCTAGTACCTAAGTGG + Intronic
931097721 2:58960696-58960718 CTAGGAATCTAGGATCTAAGAGG - Intergenic
932457772 2:71860538-71860560 CATGGAATCTAGCATCTGGCAGG - Intergenic
932977655 2:76624132-76624154 CATGGAATTTAGAATCTGGATGG - Intergenic
933381269 2:81549296-81549318 TCTGGAATCTAGAATATTGGAGG - Intergenic
935417272 2:102832137-102832159 AGTGGAATAAAGAATGTAGGCGG - Intronic
937353706 2:121185042-121185064 CATGGGATCTAGAAGCTTGGAGG + Intergenic
944826580 2:203489184-203489206 CCTGTAAACTAGAATCTTGGAGG + Intronic
945056203 2:205871442-205871464 CGTGGAGTTTAGCATGTAGGAGG - Intergenic
945192456 2:207203710-207203732 CATGTAATTTAGGATCTAGGAGG - Intergenic
945426780 2:209715477-209715499 CATGGAATTTACATTCTAGGAGG + Intronic
945658020 2:212649344-212649366 CATGGATTTTAGAATCTAGTTGG + Intergenic
945741653 2:213670452-213670474 AGTATAATCTAGAATTTAGGAGG + Intronic
1170352944 20:15462110-15462132 CGTGGAATCTAGTTTCCAGATGG + Intronic
1171563151 20:26147919-26147941 CATGGAATTTAGAATCTAGCAGG - Intergenic
1172026301 20:31951348-31951370 TGTGGAATACAGAATATAGGTGG - Intronic
1173428039 20:42959685-42959707 AGTGGAAGCTAGAAACAAGGAGG - Intronic
1179132730 21:38653015-38653037 CGTGGAATCTAGAATCTAGGCGG - Intronic
1182407887 22:30153278-30153300 AGTGGTATCTAGGATCCAGGAGG - Intronic
950134650 3:10572037-10572059 GTTGGAATCTAGACTCTAAGAGG + Intronic
950247602 3:11435923-11435945 TGTGGTATCTAGAATATAGAGGG + Intronic
966263448 3:178008052-178008074 CCTAGAATATAGAATCTAGTTGG + Intergenic
971988378 4:33858024-33858046 CATGGAATTTAGAATCTAGCAGG + Intergenic
973740412 4:53914402-53914424 CGTTGCATCTAGTACCTAGGAGG - Intronic
977801600 4:101240535-101240557 CTTGGAATCTACAATGTGGGAGG + Intronic
983590445 4:169404881-169404903 TGGGGAATCCTGAATCTAGGAGG - Intronic
986149949 5:5119525-5119547 TGTGGAATTCAGAATCTAAGTGG - Intergenic
987781790 5:22446590-22446612 CATGAAACCTAGAATCTAGAAGG + Intronic
994560448 5:101364344-101364366 TGTAGAAAGTAGAATCTAGGAGG - Intergenic
996947125 5:129083848-129083870 GATGGTATCCAGAATCTAGGTGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
998531425 5:142888845-142888867 CATGGAAATTACAATCTAGGAGG + Intronic
1000787192 5:165559753-165559775 CTTGCAATCAAGAGTCTAGGAGG - Intergenic
1005286466 6:24332891-24332913 CTTGGAGTTTACAATCTAGGAGG + Intronic
1007008546 6:38392148-38392170 CATAGAATCTAGACTCTGGGAGG - Intronic
1008257853 6:49326273-49326295 CGTGGAATAAAGTAACTAGGTGG + Intergenic
1013127522 6:107199252-107199274 CTTGGAATTTATATTCTAGGAGG + Intronic
1015452942 6:133391615-133391637 AGAGGAATCTATTATCTAGGTGG - Intronic
1017816646 6:158021276-158021298 AGTGGGAACTAGAATCTAGGAGG - Intronic
1018107829 6:160506102-160506124 CATGGAATTCAGAATCTGGGTGG - Intergenic
1018745004 6:166754999-166755021 CGTGGAATCTGGAAGCTGGAAGG - Intronic
1020804268 7:12769150-12769172 CGTGGAATTTAGAATATTTGTGG + Intergenic
1025274647 7:57567559-57567581 CATGGAATTTAGAATCTAGCAGG + Intergenic
1026387346 7:69863397-69863419 CGTGGATTTTAGGATCTTGGGGG + Intronic
1029246113 7:99202887-99202909 TGTGGAATCTAGATTCTAGTGGG - Intronic
1030208766 7:106975902-106975924 CAAGGAGTCTAGAATCTAGAAGG - Intergenic
1037664034 8:20952319-20952341 AGTGGAACATAGAAACTAGGTGG + Intergenic
1037721407 8:21447556-21447578 CGGAGAATCTAGTTTCTAGGAGG - Intergenic
1039621310 8:38999009-38999031 GGTGGAGGATAGAATCTAGGAGG + Intronic
1043881872 8:85553302-85553324 AGTTGAATCTAGAATCTGGTAGG - Intergenic
1044503117 8:92985373-92985395 GGTGGAATCCAGGAGCTAGGAGG - Intronic
1047027851 8:120844002-120844024 TGTGGAGTCTAGAATGGAGGTGG + Intergenic
1047391489 8:124455495-124455517 AGTGGAATCTAAATTCTAAGAGG - Intronic
1050011336 9:1188484-1188506 CATGGAATTTGGAATCCAGGAGG + Intergenic
1051787839 9:20765507-20765529 TGTGGAAGCTGGAATCTAGCTGG - Intronic
1053175009 9:35916207-35916229 GCTGGATTCTGGAATCTAGGAGG + Intergenic
1056552847 9:87665213-87665235 CATGGGATCCAGAATCTAGTGGG - Intronic
1060446832 9:123697197-123697219 AGTGGAATATGGAACCTAGGTGG - Intronic
1203625916 Un_KI270750v1:21383-21405 CATGGAATTTAGAATCTAGCAGG + Intergenic
1191993793 X:67068275-67068297 CCTGGGATAGAGAATCTAGGAGG + Intergenic
1194374182 X:93112029-93112051 CATAGAATTTAGAATCTAGATGG - Intergenic
1197819456 X:130530090-130530112 CATGGACTCTAGAATCCTGGTGG + Intergenic
1197905510 X:131420903-131420925 TATGGGATCTAGAATATAGGTGG + Intergenic
1200682208 Y:6226109-6226131 CATAGAATTTAGAATCTAGATGG - Intergenic