ID: 1179137068

View in Genome Browser
Species Human (GRCh38)
Location 21:38688997-38689019
Sequence GTACTATTATTCAGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179137066_1179137068 8 Left 1179137066 21:38688966-38688988 CCAAATTGTGTATCACACTGTAG No data
Right 1179137068 21:38688997-38689019 GTACTATTATTCAGAAAAACTGG No data
1179137065_1179137068 24 Left 1179137065 21:38688950-38688972 CCATGAGATTAAAATGCCAAATT No data
Right 1179137068 21:38688997-38689019 GTACTATTATTCAGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179137068 Original CRISPR GTACTATTATTCAGAAAAAC TGG Intergenic
No off target data available for this crispr