ID: 1179137068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:38688997-38689019 |
Sequence | GTACTATTATTCAGAAAAAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179137066_1179137068 | 8 | Left | 1179137066 | 21:38688966-38688988 | CCAAATTGTGTATCACACTGTAG | No data | ||
Right | 1179137068 | 21:38688997-38689019 | GTACTATTATTCAGAAAAACTGG | No data | ||||
1179137065_1179137068 | 24 | Left | 1179137065 | 21:38688950-38688972 | CCATGAGATTAAAATGCCAAATT | No data | ||
Right | 1179137068 | 21:38688997-38689019 | GTACTATTATTCAGAAAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179137068 | Original CRISPR | GTACTATTATTCAGAAAAAC TGG | Intergenic | ||
No off target data available for this crispr |