ID: 1179137100

View in Genome Browser
Species Human (GRCh38)
Location 21:38689235-38689257
Sequence AAAAGCTGTCTTGCATAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179137098_1179137100 -4 Left 1179137098 21:38689216-38689238 CCTCTAACTGGGATTGAGGAAAA No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data
1179137094_1179137100 2 Left 1179137094 21:38689210-38689232 CCAACCCCTCTAACTGGGATTGA No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data
1179137096_1179137100 -2 Left 1179137096 21:38689214-38689236 CCCCTCTAACTGGGATTGAGGAA No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data
1179137090_1179137100 30 Left 1179137090 21:38689182-38689204 CCATTAAGGGCATAAATCCTTAT No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data
1179137091_1179137100 13 Left 1179137091 21:38689199-38689221 CCTTATCAAATCCAACCCCTCTA No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data
1179137097_1179137100 -3 Left 1179137097 21:38689215-38689237 CCCTCTAACTGGGATTGAGGAAA No data
Right 1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179137100 Original CRISPR AAAAGCTGTCTTGCATAAGG AGG Intergenic