ID: 1179137368

View in Genome Browser
Species Human (GRCh38)
Location 21:38691936-38691958
Sequence GAACTCAGCTGGCCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179137365_1179137368 1 Left 1179137365 21:38691912-38691934 CCAGGAAATTATGGTCCTTGTTT No data
Right 1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG No data
1179137361_1179137368 30 Left 1179137361 21:38691883-38691905 CCAGAGGGTGGTTAGAGAACCAG No data
Right 1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG No data
1179137363_1179137368 11 Left 1179137363 21:38691902-38691924 CCAGATGTTTCCAGGAAATTATG No data
Right 1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179137368 Original CRISPR GAACTCAGCTGGCCAAAAGC TGG Intergenic
No off target data available for this crispr