ID: 1179138311

View in Genome Browser
Species Human (GRCh38)
Location 21:38699852-38699874
Sequence TAACCCCAGCTGATACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179138311_1179138312 1 Left 1179138311 21:38699852-38699874 CCTGCTTGTATCAGCTGGGGTTA No data
Right 1179138312 21:38699876-38699898 TTCAGAGAAACAGAAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179138311 Original CRISPR TAACCCCAGCTGATACAAGC AGG (reversed) Intergenic
No off target data available for this crispr