ID: 1179144231

View in Genome Browser
Species Human (GRCh38)
Location 21:38753047-38753069
Sequence TACCCACCCCTGGCGGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179144231_1179144237 -9 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144237 21:38753061-38753083 GGGTGGGTACGCTTTCTCGGAGG No data
1179144231_1179144239 1 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144239 21:38753071-38753093 GCTTTCTCGGAGGCCCCCATGGG No data
1179144231_1179144240 2 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144240 21:38753072-38753094 CTTTCTCGGAGGCCCCCATGGGG No data
1179144231_1179144241 5 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144241 21:38753075-38753097 TCTCGGAGGCCCCCATGGGGAGG No data
1179144231_1179144238 0 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144238 21:38753070-38753092 CGCTTTCTCGGAGGCCCCCATGG No data
1179144231_1179144242 13 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179144231 Original CRISPR TACCCACCCCTGGCGGGCGG TGG (reversed) Intergenic
No off target data available for this crispr