ID: 1179144237

View in Genome Browser
Species Human (GRCh38)
Location 21:38753061-38753083
Sequence GGGTGGGTACGCTTTCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179144231_1179144237 -9 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144237 21:38753061-38753083 GGGTGGGTACGCTTTCTCGGAGG No data
1179144223_1179144237 5 Left 1179144223 21:38753033-38753055 CCCTGGACTAGAACCCACCGCCC No data
Right 1179144237 21:38753061-38753083 GGGTGGGTACGCTTTCTCGGAGG No data
1179144224_1179144237 4 Left 1179144224 21:38753034-38753056 CCTGGACTAGAACCCACCGCCCG No data
Right 1179144237 21:38753061-38753083 GGGTGGGTACGCTTTCTCGGAGG No data
1179144230_1179144237 -8 Left 1179144230 21:38753046-38753068 CCCACCGCCCGCCAGGGGTGGGT No data
Right 1179144237 21:38753061-38753083 GGGTGGGTACGCTTTCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179144237 Original CRISPR GGGTGGGTACGCTTTCTCGG AGG Intergenic