ID: 1179144242

View in Genome Browser
Species Human (GRCh38)
Location 21:38753083-38753105
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179144232_1179144242 10 Left 1179144232 21:38753050-38753072 CCGCCCGCCAGGGGTGGGTACGC No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144231_1179144242 13 Left 1179144231 21:38753047-38753069 CCACCGCCCGCCAGGGGTGGGTA No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144224_1179144242 26 Left 1179144224 21:38753034-38753056 CCTGGACTAGAACCCACCGCCCG No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144235_1179144242 3 Left 1179144235 21:38753057-38753079 CCAGGGGTGGGTACGCTTTCTCG No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144234_1179144242 6 Left 1179144234 21:38753054-38753076 CCGCCAGGGGTGGGTACGCTTTC No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144233_1179144242 7 Left 1179144233 21:38753053-38753075 CCCGCCAGGGGTGGGTACGCTTT No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144223_1179144242 27 Left 1179144223 21:38753033-38753055 CCCTGGACTAGAACCCACCGCCC No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data
1179144230_1179144242 14 Left 1179144230 21:38753046-38753068 CCCACCGCCCGCCAGGGGTGGGT No data
Right 1179144242 21:38753083-38753105 GCCCCCATGGGGAGGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179144242 Original CRISPR GCCCCCATGGGGAGGCAAAA TGG Intergenic