ID: 1179144643

View in Genome Browser
Species Human (GRCh38)
Location 21:38757122-38757144
Sequence TCTCCATTGTCACCAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179144641_1179144643 9 Left 1179144641 21:38757090-38757112 CCAAATGTATGATATGAGAGAGT No data
Right 1179144643 21:38757122-38757144 TCTCCATTGTCACCAGCCCCTGG No data
1179144640_1179144643 25 Left 1179144640 21:38757074-38757096 CCTTTAGTGACTAGAACCAAATG No data
Right 1179144643 21:38757122-38757144 TCTCCATTGTCACCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179144643 Original CRISPR TCTCCATTGTCACCAGCCCC TGG Intergenic
No off target data available for this crispr