ID: 1179149560

View in Genome Browser
Species Human (GRCh38)
Location 21:38798337-38798359
Sequence GTGGAGACAGAGAATTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179149557_1179149560 1 Left 1179149557 21:38798313-38798335 CCCTAATGGGGTGGAATTTGTGC No data
Right 1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG No data
1179149556_1179149560 5 Left 1179149556 21:38798309-38798331 CCTTCCCTAATGGGGTGGAATTT No data
Right 1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG No data
1179149558_1179149560 0 Left 1179149558 21:38798314-38798336 CCTAATGGGGTGGAATTTGTGCT No data
Right 1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179149560 Original CRISPR GTGGAGACAGAGAATTATTA AGG Intergenic
No off target data available for this crispr