ID: 1179150226

View in Genome Browser
Species Human (GRCh38)
Location 21:38803574-38803596
Sequence CTTTGGAAGGGGAAATAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179150216_1179150226 13 Left 1179150216 21:38803538-38803560 CCAGGGCAAGGGGGCTGCTTGGG No data
Right 1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG No data
1179150214_1179150226 14 Left 1179150214 21:38803537-38803559 CCCAGGGCAAGGGGGCTGCTTGG No data
Right 1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179150226 Original CRISPR CTTTGGAAGGGGAAATAGGG AGG Intergenic
No off target data available for this crispr