ID: 1179150226 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:38803574-38803596 |
Sequence | CTTTGGAAGGGGAAATAGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179150216_1179150226 | 13 | Left | 1179150216 | 21:38803538-38803560 | CCAGGGCAAGGGGGCTGCTTGGG | No data | ||
Right | 1179150226 | 21:38803574-38803596 | CTTTGGAAGGGGAAATAGGGAGG | No data | ||||
1179150214_1179150226 | 14 | Left | 1179150214 | 21:38803537-38803559 | CCCAGGGCAAGGGGGCTGCTTGG | No data | ||
Right | 1179150226 | 21:38803574-38803596 | CTTTGGAAGGGGAAATAGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179150226 | Original CRISPR | CTTTGGAAGGGGAAATAGGG AGG | Intergenic | ||
No off target data available for this crispr |