ID: 1179150372

View in Genome Browser
Species Human (GRCh38)
Location 21:38804623-38804645
Sequence AAGGTCTCCGGGTATCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179150372_1179150379 -1 Left 1179150372 21:38804623-38804645 CCACGGTGATACCCGGAGACCTT No data
Right 1179150379 21:38804645-38804667 TCGGGGACCCAGAAACATTAAGG No data
1179150372_1179150382 23 Left 1179150372 21:38804623-38804645 CCACGGTGATACCCGGAGACCTT No data
Right 1179150382 21:38804669-38804691 GCACCGATATCTCAATTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179150372 Original CRISPR AAGGTCTCCGGGTATCACCG TGG (reversed) Intergenic
No off target data available for this crispr